nextflow_schema.json

{
    "$schema": "http://json-schema.org/draft-07/schema",
    "$id": "https://raw.githubusercontent.com/nf-core/mag/master/nextflow_schema.json",
    "title": "nf-core/mag pipeline parameters",
    "description": "Assembly, binning and annotation of metagenomes",
    "type": "object",
    "definitions": {
        "input_output_options": {
            "title": "Input/output options",
            "type": "object",
            "fa_icon": "fas fa-terminal",
            "description": "Define where the pipeline should find input data and save output data.",
            "required": ["input", "outdir"],
            "properties": {
                "input": {
                    "type": "string",
                    "mimetype": "text/csv",
                    "format": "file-path",
                    "description": "Input FastQ files or CSV samplesheet file containing information about the samples in the experiment.",
                    "help_text": "Use this to specify the location of your input FastQ files. For example:\n\n```bash\n--input 'path/to/data/sample_*_{1,2}.fastq.gz'\n``` \n\nAlternatively, to assign different groups or to include long reads for hybrid assembly with metaSPAdes, you can specify a CSV samplesheet input file with 5 columns and the following header: sample,group,short_reads_1,short_reads_2,long_reads. See [usage docs](https://nf-co.re/mag/usage#input-specifications).",
                    "fa_icon": "fas fa-file-csv"
                },
                "single_end": {
                    "type": "boolean",
                    "description": "Specifies that the input is single-end reads.",
                    "fa_icon": "fas fa-align-center",
                    "help_text": "By default, the pipeline expects paired-end data. If you have single-end data, you need to specify `--single_end` on the command line when you launch the pipeline. A normal glob pattern, enclosed in quotation marks, can then be used for `--input`. For example:\n\n```bash\n--single_end --input '*.fastq'\n```\n\nIt is not possible to run a mixture of single-end and paired-end files in one run."
                },
                "outdir": {
                    "type": "string",
                    "format": "directory-path",
                    "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.",
                    "fa_icon": "fas fa-folder-open"
                },
                "email": {
                    "type": "string",
                    "description": "Email address for completion summary.",
                    "fa_icon": "fas fa-envelope",
                    "help_text": "Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (`~/.nextflow/config`) then you don't need to specify this on the command line for every run.",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$"
                },
                "multiqc_title": {
                    "type": "string",
                    "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
                    "fa_icon": "fas fa-file-signature"
                }
            }
        },
        "reference_genome_options": {
            "title": "Reference genome options",
            "type": "object",
            "fa_icon": "fas fa-dna",
            "description": "Reference genome related files and options required for the workflow.",
            "properties": {
                "igenomes_base": {
                    "type": "string",
                    "format": "directory-path",
                    "description": "Directory / URL base for iGenomes references.",
                    "default": "s3://ngi-igenomes/igenomes",
                    "fa_icon": "fas fa-cloud-download-alt",
                    "hidden": true
                },
                "igenomes_ignore": {
                    "type": "boolean",
                    "description": "Do not load the iGenomes reference config.",
                    "fa_icon": "fas fa-ban",
                    "hidden": true,
                    "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`."
                }
            }
        },
        "institutional_config_options": {
            "title": "Institutional config options",
            "type": "object",
            "fa_icon": "fas fa-university",
            "description": "Parameters used to describe centralised config profiles. These should not be edited.",
            "help_text": "The centralised nf-core configuration profiles use a handful of pipeline parameters to describe themselves. This information is then printed to the Nextflow log when you run a pipeline. You should not need to change these values when you run a pipeline.",
            "properties": {
                "custom_config_version": {
                    "type": "string",
                    "description": "Git commit id for Institutional configs.",
                    "default": "master",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "custom_config_base": {
                    "type": "string",
                    "description": "Base directory for Institutional configs.",
                    "default": "https://raw.githubusercontent.com/nf-core/configs/master",
                    "hidden": true,
                    "help_text": "If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.",
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_name": {
                    "type": "string",
                    "description": "Institutional config name.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_description": {
                    "type": "string",
                    "description": "Institutional config description.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_contact": {
                    "type": "string",
                    "description": "Institutional config contact information.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                },
                "config_profile_url": {
                    "type": "string",
                    "description": "Institutional config URL link.",
                    "hidden": true,
                    "fa_icon": "fas fa-users-cog"
                }
            }
        },
        "max_job_request_options": {
            "title": "Max job request options",
            "type": "object",
            "fa_icon": "fab fa-acquisitions-incorporated",
            "description": "Set the top limit for requested resources for any single job.",
            "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.",
            "properties": {
                "max_cpus": {
                    "type": "integer",
                    "description": "Maximum number of CPUs that can be requested for any single job.",
                    "default": 16,
                    "fa_icon": "fas fa-microchip",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`"
                },
                "max_memory": {
                    "type": "string",
                    "description": "Maximum amount of memory that can be requested for any single job.",
                    "default": "128.GB",
                    "fa_icon": "fas fa-memory",
                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`"
                },
                "max_time": {
                    "type": "string",
                    "description": "Maximum amount of time that can be requested for any single job.",
                    "default": "240.h",
                    "fa_icon": "far fa-clock",
                    "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$",
                    "hidden": true,
                    "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`"
                }
            }
        },
        "generic_options": {
            "title": "Generic options",
            "type": "object",
            "fa_icon": "fas fa-file-import",
            "description": "Less common options for the pipeline, typically set in a config file.",
            "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.",
            "properties": {
                "help": {
                    "type": "boolean",
                    "description": "Display help text.",
                    "fa_icon": "fas fa-question-circle",
                    "hidden": true
                },
                "publish_dir_mode": {
                    "type": "string",
                    "default": "copy",
                    "description": "Method used to save pipeline results to output directory.",
                    "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.",
                    "fa_icon": "fas fa-copy",
                    "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"],
                    "hidden": true
                },
                "email_on_fail": {
                    "type": "string",
                    "description": "Email address for completion summary, only when pipeline fails.",
                    "fa_icon": "fas fa-exclamation-triangle",
                    "pattern": "^([a-zA-Z0-9_\\-\\.]+)@([a-zA-Z0-9_\\-\\.]+)\\.([a-zA-Z]{2,5})$",
                    "help_text": "An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.",
                    "hidden": true
                },
                "plaintext_email": {
                    "type": "boolean",
                    "description": "Send plain-text email instead of HTML.",
                    "fa_icon": "fas fa-remove-format",
                    "hidden": true
                },
                "max_multiqc_email_size": {
                    "type": "string",
                    "description": "File size limit when attaching MultiQC reports to summary emails.",
                    "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$",
                    "default": "25.MB",
                    "fa_icon": "fas fa-file-upload",
                    "hidden": true
                },
                "monochrome_logs": {
                    "type": "boolean",
                    "description": "Do not use coloured log outputs.",
                    "fa_icon": "fas fa-palette",
                    "hidden": true
                },
                "hook_url": {
                    "type": "string",
                    "description": "Incoming hook URL for messaging service",
                    "fa_icon": "fas fa-people-group",
                    "help_text": "Incoming hook URL for messaging service. Currently, only MS Teams is supported.",
                    "hidden": true
                },
                "multiqc_config": {
                    "type": "string",
                    "description": "Custom config file to supply to MultiQC.",
                    "fa_icon": "fas fa-cog",
                    "hidden": true
                },
                "multiqc_logo": {
                    "type": "string",
                    "description": "Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file",
                    "fa_icon": "fas fa-image",
                    "hidden": true
                },
                "multiqc_methods_description": {
                    "type": "string",
                    "description": "Custom MultiQC yaml file containing HTML including a methods description.",
                    "fa_icon": "fas fa-cog"
                },
                "tracedir": {
                    "type": "string",
                    "description": "Directory to keep pipeline Nextflow logs and reports.",
                    "default": "${params.outdir}/pipeline_info",
                    "fa_icon": "fas fa-cogs",
                    "hidden": true
                },
                "validate_params": {
                    "type": "boolean",
                    "description": "Boolean whether to validate parameters against the schema at runtime",
                    "default": true,
                    "fa_icon": "fas fa-check-square",
                    "hidden": true
                },
                "show_hidden_params": {
                    "type": "boolean",
                    "fa_icon": "far fa-eye-slash",
                    "description": "Show all params when using `--help`",
                    "hidden": true,
                    "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters."
                },
                "enable_conda": {
                    "type": "boolean",
                    "description": "Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.",
                    "hidden": true,
                    "fa_icon": "fas fa-bacon"
                }
            }
        },
        "reproducibility_options": {
            "title": "Reproducibility options",
            "type": "object",
            "description": "Use these parameters to also enable reproducible results from the individual assembly and binning tools .",
            "default": "",
            "properties": {
                "megahit_fix_cpu_1": {
                    "type": "boolean",
                    "description": "Fix number of CPUs for MEGAHIT to 1. Not increased with retries.",
                    "help_text": "MEGAHIT only generates reproducible results when run single-threaded. \n\nWhen using this parameter do not change the number of CPUs for the `megahit` process with a custom config file. This would result in an error.\n\nDefault: The number of CPUs is specified in the `base.config` file, and increased with each retry."
                },
                "spades_fix_cpus": {
                    "type": "integer",
                    "default": -1,
                    "description": "Fix number of CPUs used by SPAdes. Not increased with retries.",
                    "help_text": "SPAdes is designed to be deterministic for a given number of threads. To generate reproducible results fix the number of CPUs using this parameter.\n\nWhen using this parameter do not change the number of CPUs for the `spades` process with a custom config file. This would result in an error.\n\nDefault: -1 (the number of CPUs is specified in the `base.config` or in a custom config file, and increased with each retry)."
                },
                "spadeshybrid_fix_cpus": {
                    "type": "integer",
                    "default": -1,
                    "description": "Fix number of CPUs used by SPAdes hybrid. Not increased with retries.",
                    "help_text": "SPAdes is designed to be deterministic for a given number of threads. To generate reproducible results fix the number of CPUs using this parameter.\n\nWhen using this parameter do not change the number of CPUs for the `spadeshybrid` process with a custom config file. This would result in an error.\n\nDefault: -1 (the number of CPUs is specified in the `base.config` or in a custom config file, and increased with each retry)."
                },
                "metabat_rng_seed": {
                    "type": "integer",
                    "default": 1,
                    "description": "RNG seed for MetaBAT2.",
                    "help_text": "MetaBAT2 is run by default with a fixed seed within this pipeline, thus producing reproducible results. You can set it also to any other positive integer to ensure reproducibility. Set the parameter to 0 to use a random seed."
                }
            },
            "help_text": ""
        },
        "quality_control_for_short_reads_options": {
            "title": "Quality control for short reads options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "clip_tool": {
                    "type": "string",
                    "default": "fastp",
                    "description": "Specify which adapter clipping tool to use. Options: 'fastp', 'adapterremoval'",
                    "enum": ["fastp", "adapterremoval"]
                },
                "reads_minlength": {
                    "type": "integer",
                    "default": 15,
                    "description": "The minimum length of reads must have to be retained for downstream analysis."
                },
                "fastp_qualified_quality": {
                    "type": "integer",
                    "default": 15,
                    "description": "Minimum phred quality value of a base to be qualified in fastp.",
                    "help": "Reads with more than 40% of unqualified bases will be discarded."
                },
                "fastp_cut_mean_quality": {
                    "type": "integer",
                    "default": 15,
                    "description": "The mean quality requirement used for per read sliding window cutting by fastp.",
                    "help": "Used in combination with the fastp options '--cut_front' and '--cut_tail'. If the mean quality within a window (of size 4) is below `--fastp_cut_mean_quality`, the bases are dropped and the sliding window is moved further, otherwise it stops."
                },
                "fastp_save_trimmed_fail": {
                    "type": "boolean",
                    "description": "Save reads that fail fastp filtering in a separate file. Not used downstream."
                },
                "adapterremoval_minquality": {
                    "type": "integer",
                    "default": 2,
                    "description": "The minimum base quality for low-quality base trimming by AdapterRemoval."
                },
                "adapterremoval_trim_quality_stretch": {
                    "type": "boolean",
                    "description": "Turn on quality trimming by consecutive stretch of low quality bases, rather than by window.",
                    "help_text": "Default base-quality trimming is set to trim by 'windows', as in FastP. Specifying this flag will use trim via contiguous stretch of low quality bases (Ns) instead.\n\n> Replaces --trimwindows 4 with --trimqualities in AdapterRemoval"
                },
                "adapterremoval_adapter1": {
                    "type": "string",
                    "default": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG",
                    "description": "Forward read adapter to be trimmed by AdapterRemoval."
                },
                "adapterremoval_adapter2": {
                    "type": "string",
                    "default": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT",
                    "description": "Reverse read adapter to be trimmed by AdapterRemoval for paired end data."
                },
                "host_genome": {
                    "type": "string",
                    "help_text": "This parameter is mutually exclusive with `--host_genome`. Host read removal is done with Bowtie2. \nBoth the iGenomes FASTA file as well as corresponding, already pre-built Bowtie 2 index files will be used.",
                    "description": "Name of iGenomes reference for host contamination removal."
                },
                "host_fasta": {
                    "type": "string",
                    "description": "Fasta reference file for host contamination removal.",
                    "help_text": "This parameter is mutually exclusive with `--host_fasta`. The reference can be masked. Host read removal is done with Bowtie2."
                },
                "host_removal_verysensitive": {
                    "type": "boolean",
                    "description": "Use the `--very-sensitive` instead of the`--sensitive`setting for Bowtie 2 to map reads against the host genome."
                },
                "host_removal_save_ids": {
                    "type": "boolean",
                    "description": "Save the read IDs of removed host reads."
                },
                "keep_phix": {
                    "type": "boolean",
                    "description": "Keep reads similar to the Illumina internal standard PhiX genome."
                },
                "phix_reference": {
                    "type": "string",
                    "default": "${baseDir}/assets/data/GCA_002596845.1_ASM259684v1_genomic.fna.gz",
                    "description": "Genome reference used to remove Illumina PhiX contaminant reads.",
                    "hidden": true
                }
            }
        },
        "quality_control_for_long_reads_options": {
            "title": "Quality control for long reads options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "skip_adapter_trimming": {
                    "type": "boolean",
                    "description": "Skip removing adapter sequences from long reads."
                },
                "longreads_min_length": {
                    "type": "integer",
                    "default": 1000,
                    "description": "Discard any read which is shorter than this value."
                },
                "longreads_keep_percent": {
                    "type": "integer",
                    "default": 90,
                    "description": "Keep this percent of bases."
                },
                "longreads_length_weight": {
                    "type": "integer",
                    "default": 10,
                    "description": "The higher the more important is read length when choosing the best reads.",
                    "help_text": "The default value focuses on length instead of quality to improve assembly size.\nIn order to assign equal weights to read lengths and read qualities set this parameter to 1.\nThis might be useful, for example, to benefit indirectly from the removal of short host reads (causing lower qualities for reads not overlapping filtered short reads)."
                },
                "keep_lambda": {
                    "type": "boolean",
                    "description": "Keep reads similar to the ONT internal standard Escherichia virus Lambda genome."
                },
                "lambda_reference": {
                    "type": "string",
                    "default": "${baseDir}/assets/data/GCA_000840245.1_ViralProj14204_genomic.fna.gz",
                    "hidden": true,
                    "description": "Genome reference used to remove ONT Lambda contaminant reads."
                }
            }
        },
        "taxonomic_profiling_options": {
            "title": "Taxonomic profiling options",
            "type": "object",
            "description": "Taxonomic classification is disabled by default. You have to specify one of the options below to activate it.",
            "default": "",
            "properties": {
                "centrifuge_db": {
                    "type": "string",
                    "description": "Database for taxonomic binning with centrifuge.",
                    "help_text": "E.g. ftp://ftp.ccb.jhu.edu/pub/infphilo/centrifuge/data/p_compressed+h+v.tar.gz."
                },
                "kraken2_db": {
                    "type": "string",
                    "description": "Database for taxonomic binning with kraken2.",
                    "help_text": "The database file must be a compressed tar archive that contains at least the three files `hash.k2d`, `opts.k2d` and `taxo.k2d`. E.g. ftp://ftp.ccb.jhu.edu/pub/data/kraken2_dbs/minikraken_8GB_202003.tgz."
                },
                "skip_krona": {
                    "type": "boolean",
                    "description": "Skip creating a krona plot for taxonomic binning."
                },
                "cat_db": {
                    "type": "string",
                    "description": "Database for taxonomic classification of metagenome assembled genomes.",
                    "help_text": "E.g. https://tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20210107.tar.gz. This parameter is mutually exclusive with `--cat_db_generate`. The zipped file needs to contain a folder named `*taxonomy*` and `*database*` that hold the respective files."
                },
                "cat_db_generate": {
                    "type": "boolean",
                    "description": "Generate CAT database.",
                    "help_text": "Download the taxonomy files from NCBI taxonomy, the nr database and generate CAT database. This parameter is mutually exclusive with `--cat_db`. Useful to build a CAT database with the same DIAMOND version as used for running CAT classification, avoiding compatibility problems."
                },
                "save_cat_db": {
                    "type": "boolean",
                    "description": "Save the CAT database generated when specified by `--cat_db_generate`.",
                    "help_text": "Useful to allow reproducibility, as old versions of prebuild CAT databases do not always remain accessible and underlying NCBI taxonomy and nr databases change."
                },
                "gtdb": {
                    "type": "string",
                    "default": "https://data.gtdb.ecogenomic.org/releases/release202/202.0/auxillary_files/gtdbtk_r202_data.tar.gz",
                    "description": "GTDB database for taxonomic classification of bins with GTDB-tk.",
                    "help_text": "For information which GTDB reference databases are compatible with the used GTDB-tk version see https://ecogenomics.github.io/GTDBTk/installing/index.html#gtdb-tk-reference-data."
                },
                "gtdbtk_min_completeness": {
                    "type": "number",
                    "default": 50,
                    "description": "Min. bin completeness (in %) required to apply GTDB-tk classification.",
                    "help_text": "Completeness assessed with BUSCO analysis (100% - %Missing). Must be greater than 0 (min. 0.01) to avoid GTDB-tk errors. If too low, GTDB-tk classification results can be impaired due to not enough marker genes!",
                    "minimum": 0.01,
                    "maximum": 100
                },
                "gtdbtk_max_contamination": {
                    "type": "number",
                    "default": 10,
                    "description": "Max. bin contamination (in %) allowed to apply GTDB-tk classification.",
                    "help_text": "Contamination approximated based on BUSCO analysis (%Complete and duplicated). If too high, GTDB-tk classification results can be impaired due to contamination!",
                    "minimum": 0,
                    "maximum": 100
                },
                "gtdbtk_min_perc_aa": {
                    "type": "number",
                    "default": 10,
                    "description": "Min. fraction of AA (in %) in the MSA for bins to be kept.",
                    "minimum": 0,
                    "maximum": 100
                },
                "gtdbtk_min_af": {
                    "type": "number",
                    "default": 0.65,
                    "description": "Min. alignment fraction to consider closest genome.",
                    "minimum": 0,
                    "maximum": 1
                },
                "gtdbtk_pplacer_cpus": {
                    "type": "number",
                    "default": 1,
                    "description": "Number of CPUs used for the by GTDB-Tk run tool pplacer.",
                    "help_text": "A low number of CPUs helps to reduce the memory required/reported by GTDB-Tk. See also the [GTDB-Tk documentation](https://ecogenomics.github.io/GTDBTk/faq.html#gtdb-tk-reaches-the-memory-limit-pplacer-crashes)."
                },
                "gtdbtk_pplacer_scratch": {
                    "type": "boolean",
                    "default": true,
                    "description": "Reduce GTDB-Tk memory consumption by running pplacer in a setting writing to disk.",
                    "help_text": "Will be slower. Set to `false` to turn this off."
                },
                "virus_classification": {
                    "type": "boolean",
                    "description": "Turn on/off virus classification with geNomad"
                },
                "genomad_db": {
                    "type": "string",
                    "default": "https://portal.nersc.gov/genomad/__data__/genomad_db_v1.1.tar.gz",
                    "description": "Database for virus classification with geNomad"
                }
            }
        },
        "assembly_options": {
            "title": "Assembly options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "coassemble_group": {
                    "type": "boolean",
                    "description": "Co-assemble samples within one group, instead of assembling each sample separately."
                },
                "spades_options": {
                    "type": "string",
                    "description": "Additional custom options for SPAdes.",
                    "help_text": "An example is adjusting k-mers (\"-k 21,33,55,77\") or adding [advanced options](https://github.com/ablab/spades#advanced-options). But not -t, -m, -o or --out-prefix, because these are already in use."
                },
                "megahit_options": {
                    "type": "string",
                    "description": "Additional custom options for MEGAHIT.",
                    "help_text": "An example is adjusting presets (e.g. \"--presets meta-large\"), k-mers (e.g. \"-k 21,33,55,77\") or adding other [advanced options](https://github.com/voutcn/megahit#advanced-usage). For example, increase the minimum k-mer in the event of an error message such as \"Too many vertices in the unitig graph, you may increase the kmer size to remove tons of erroneous kmers.\" in the MEGAHIT log file. But not --threads, --memory, -o or input read files, because these are already in use."
                },
                "skip_spades": {
                    "type": "boolean",
                    "description": "Skip Illumina-only SPAdes assembly."
                },
                "skip_spadeshybrid": {
                    "type": "boolean",
                    "description": "Skip SPAdes hybrid assembly."
                },
                "skip_megahit": {
                    "type": "boolean",
                    "description": "Skip MEGAHIT assembly."
                },
                "skip_quast": {
                    "type": "boolean",
                    "description": "Skip metaQUAST."
                }
            }
        },
        "gene_prediction_options": {
            "title": "Gene prediction options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "skip_prodigal": {
                    "type": "boolean",
                    "description": "Skip Prodigal gene prediction"
                }
            }
        },
        "binning_options": {
            "title": "Binning options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "binning_map_mode": {
                    "type": "string",
                    "default": "group",
                    "description": "Defines mapping strategy to compute co-abundances for binning, i.e. which samples will be mapped against the assembly.",
                    "help_text": "Available: `all`, `group` or `own`. Note that `own` cannot be specified in combination with `--coassemble_group`.\n\nNote that specifying `all` without additionally specifying `--coassemble_group` results in `n^2` mapping processes for each assembly method, where `n` is the number of samples."
                },
                "skip_binning": {
                    "type": "boolean",
                    "description": "Skip metagenome binning entirely"
                },
                "skip_metabat2": {
                    "type": "boolean",
                    "description": "Skip MetaBAT2 Binning"
                },
                "skip_maxbin2": {
                    "type": "boolean",
                    "description": "Skip MaxBin2 Binning"
                },
                "min_contig_size": {
                    "type": "integer",
                    "default": 1500,
                    "description": "Minimum contig size to be considered for binning and for bin quality check.",
                    "help_text": "For forwarding into downstream analysis, i.e. QUAST and BUSCO, and reporting."
                },
                "min_length_unbinned_contigs": {
                    "type": "integer",
                    "default": 1000000,
                    "description": "Minimal length of contigs that are not part of any bin but treated as individual genome.",
                    "help_text": "Contigs that do not fulfill the thresholds of `--min_length_unbinned_contigs` and `--max_unbinned_contigs` are pooled for downstream analysis and reporting, except contigs that also do not fullfill `--min_contig_size` are not considered further."
                },
                "max_unbinned_contigs": {
                    "type": "integer",
                    "default": 100,
                    "description": "Maximal number of contigs that are not part of any bin but treated as individual genome.",
                    "help_text": "Contigs that do not fulfill the thresholds of `--min_length_unbinned_contigs` and `--max_unbinned_contigs` are pooled for downstream analysis and reporting, except contigs that also do not fullfill `--min_contig_size` are not considered further."
                },
                "bowtie2_mode": {
                    "type": "string",
                    "description": "Bowtie2 alignment mode",
                    "help_text": "Bowtie2 alignment mode options, for example: `--very-fast` , `--very-sensitive-local -N 1` , ..."
                },
                "skip_prokka": {
                    "type": "boolean",
                    "description": "Skip Prokka genome annotation."
                }
            }
        },
        "bin_quality_check_options": {
            "title": "Bin quality check options",
            "type": "object",
            "description": "",
            "default": "",
            "properties": {
                "skip_busco": {
                    "type": "boolean",
                    "description": "Disable bin QC with BUSCO."
                },
                "busco_reference": {
                    "type": "string",
                    "description": "Download path for BUSCO lineage dataset, instead of using automated lineage selection.",
                    "help_text": "E.g. https://busco-data.ezlab.org/v5/data/lineages/bacteria_odb10.2020-03-06.tar.gz. Available databases are listed here: https://busco-data.ezlab.org/v5/data/lineages/."
                },
                "busco_download_path": {
                    "type": "string",
                    "description": "Path to local folder containing already downloaded and unpacked lineage datasets.",
                    "help_text": "If provided, BUSCO analysis will be run in offline mode. Data can be downloaded from https://busco-data.ezlab.org/v5/data/ (files still need to be unpacked manually). Run in combination with automated lineage selection."
                },
                "busco_auto_lineage_prok": {
                    "type": "boolean",
                    "description": "Run BUSCO with automated lineage selection, but ignoring eukaryotes (saves runtime)."
                },
                "save_busco_reference": {
                    "type": "boolean",
                    "description": "Save the used BUSCO lineage datasets provided via --busco_reference or downloaded when not using --busco_reference or --busco_download_path.",
                    "help_text": "Useful to allow reproducibility, as BUSCO datasets are frequently updated and old versions do not always remain accessible."
                },
                "refine_bins_dastool": {
                    "type": "boolean",
                    "description": "Turn on bin refinement using DAS Tool."
                },
                "refine_bins_dastool_threshold": {
                    "type": "number",
                    "default": 0.5,
                    "description": "Specify single-copy gene score threshold for bin refinement.",
                    "help_text": "Score threshold for single-copy gene selection algorithm to keep selecting bins, with a value ranging from 0-1.\n\nFor description of scoring algorithm, see: Sieber, Christian M. K., et al. 2018. Nature Microbiology 3 (7): 836\u201343. https://doi.org/10.1038/s41564-018-0171-1.\n\n> Modifies DAS Tool parameter --score_threshold\n"
                },
                "postbinning_input": {
                    "type": "string",
                    "default": "raw_bins_only",
                    "description": "Specify which binning output is sent for downstream annotation, taxonomic classification, bin quality control etc.",
                    "help_text": "`raw_bins_only`: only bins (and unbinned contigs) from the binners.\n`refined_bins_only`:  only bins (and unbinned contigs) from the bin refinement step .\n`both`: bins and unbinned contigs from both the binning and bin refinement steps.",
                    "enum": ["raw_bins_only", "refined_bins_only", "both"]
                },
                "busco_clean": {
                    "type": "boolean",
                    "description": "Enable clean-up of temporary files created during BUSCO runs.",
                    "help_text": "By default, BUSCO creates a large number of intermediate files every run. This may cause problems on some clusters which have file number limits in plate, particularly with large numbers of bins. Enabling this option cleans these files, reducing the total file count of the work directory."
                }
            }
        },
        "ancient_dna_assembly": {
            "title": "Ancient DNA assembly",
            "type": "object",
            "description": "Performs ancient DNA assembly validation and contig consensus sequence recalling.",
            "default": "",
            "properties": {
                "ancient_dna": {
                    "type": "boolean",
                    "description": "Turn on/off the ancient DNA subworfklow"
                },
                "freebayes_ploidy": {
                    "type": "integer",
                    "default": 1,
                    "description": "Ploidy for variant calling"
                },
                "freebayes_min_basequality": {
                    "type": "integer",
                    "default": 20,
                    "description": "minimum base quality required for variant calling"
                },
                "freebayes_minallelefreq": {
                    "type": "number",
                    "default": 0.33,
                    "description": "minimum minor allele frequency for considering variants"
                },
                "bcftools_view_high_variant_quality": {
                    "type": "integer",
                    "default": 30,
                    "description": "minimum genotype quality for considering a variant high quality"
                },
                "bcftools_view_medium_variant_quality": {
                    "type": "integer",
                    "default": 20,
                    "description": "minimum genotype quality for considering a variant medium quality"
                },
                "bcftools_view_minimal_allelesupport": {
                    "type": "integer",
                    "default": 3,
                    "description": "minimum number of bases supporting the alternative allele"
                },
                "pydamage_accuracy": {
                    "type": "number",
                    "default": 0.5,
                    "description": "PyDamage accuracy threshold"
                }
            }
        }
    },
    "allOf": [
        {
            "$ref": "#/definitions/input_output_options"
        },
        {
            "$ref": "#/definitions/reference_genome_options"
        },
        {
            "$ref": "#/definitions/institutional_config_options"
        },
        {
            "$ref": "#/definitions/max_job_request_options"
        },
        {
            "$ref": "#/definitions/generic_options"
        },
        {
            "$ref": "#/definitions/reproducibility_options"
        },
        {
            "$ref": "#/definitions/quality_control_for_short_reads_options"
        },
        {
            "$ref": "#/definitions/quality_control_for_long_reads_options"
        },
        {
            "$ref": "#/definitions/taxonomic_profiling_options"
        },
        {
            "$ref": "#/definitions/assembly_options"
        },
        {
            "$ref": "#/definitions/gene_prediction_options"
        },
        {
            "$ref": "#/definitions/binning_options"
        },
        {
            "$ref": "#/definitions/bin_quality_check_options"
        },
        {
            "$ref": "#/definitions/ancient_dna_assembly"
        }
    ]
}