diff --git a/docs/build/.doctrees/environment.pickle b/docs/build/.doctrees/environment.pickle
index 080dcd35..2ad1942d 100644
Binary files a/docs/build/.doctrees/environment.pickle and b/docs/build/.doctrees/environment.pickle differ
diff --git a/docs/build/searchindex.js b/docs/build/searchindex.js
index 0d3ddfc3..3b28dec5 100644
--- a/docs/build/searchindex.js
+++ b/docs/build/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"docnames": ["api_reference", "contributing", "faq", "genindex", "glossary", "history", "index", "installation", "quick_start", "readme", "rnalysis", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.add", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.clear", "rnalysis.enrichment.FeatureSet.copy", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.difference_update", "rnalysis.enrichment.FeatureSet.discard", "rnalysis.enrichment.FeatureSet.filter_by_attribute", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.intersection_update", "rnalysis.enrichment.FeatureSet.isdisjoint", "rnalysis.enrichment.FeatureSet.issubset", "rnalysis.enrichment.FeatureSet.issuperset", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.pop", "rnalysis.enrichment.FeatureSet.remove", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.symmetric_difference_update", "rnalysis.enrichment.FeatureSet.translate_gene_ids", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.update", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.add", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.clear", "rnalysis.enrichment.RankedSet.copy", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.difference_update", "rnalysis.enrichment.RankedSet.discard", "rnalysis.enrichment.RankedSet.filter_by_attribute", "rnalysis.enrichment.RankedSet.filter_by_go_annotations", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.intersection_update", "rnalysis.enrichment.RankedSet.isdisjoint", "rnalysis.enrichment.RankedSet.issubset", "rnalysis.enrichment.RankedSet.issuperset", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.pop", "rnalysis.enrichment.RankedSet.remove", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.symmetric_difference_update", "rnalysis.enrichment.RankedSet.translate_gene_ids", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.update", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.enrichment_bar_plot", "rnalysis.enrichment.gene_ontology_graph", "rnalysis.enrichment.kegg_pathway_graph", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.fastq", "rnalysis.fastq.PairedEndPipeline", "rnalysis.fastq.PairedEndPipeline.add_function", "rnalysis.fastq.PairedEndPipeline.apply_to", "rnalysis.fastq.PairedEndPipeline.export_pipeline", "rnalysis.fastq.PairedEndPipeline.import_pipeline", "rnalysis.fastq.PairedEndPipeline.remove_last_function", "rnalysis.fastq.SingleEndPipeline", "rnalysis.fastq.SingleEndPipeline.add_function", "rnalysis.fastq.SingleEndPipeline.apply_to", "rnalysis.fastq.SingleEndPipeline.export_pipeline", "rnalysis.fastq.SingleEndPipeline.import_pipeline", "rnalysis.fastq.SingleEndPipeline.remove_last_function", "rnalysis.fastq.bowtie2_align_paired_end", "rnalysis.fastq.bowtie2_align_single_end", "rnalysis.fastq.bowtie2_create_index", "rnalysis.fastq.featurecounts_paired_end", "rnalysis.fastq.featurecounts_single_end", "rnalysis.fastq.kallisto_create_index", "rnalysis.fastq.kallisto_quantify_paired_end", "rnalysis.fastq.kallisto_quantify_single_end", "rnalysis.fastq.shortstack_align_smallrna", "rnalysis.fastq.trim_adapters_paired_end", "rnalysis.fastq.trim_adapters_single_end", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.differential_expression_limma_voom", "rnalysis.filtering.CountFilter.drop_columns", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_name", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_duplicate_ids", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.find_paralogs_ensembl", "rnalysis.filtering.CountFilter.find_paralogs_panther", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.from_folder_htseqcount", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.map_orthologs_ensembl", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector", "rnalysis.filtering.CountFilter.map_orthologs_panther", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpkm", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_to_tpm", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.save_parquet", "rnalysis.filtering.CountFilter.save_table", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.sort_by_principal_component", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_principal_components", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.drop_columns", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_by_row_name", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl", "rnalysis.filtering.DESeqFilter.find_paralogs_panther", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector", "rnalysis.filtering.DESeqFilter.map_orthologs_panther", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.save_parquet", "rnalysis.filtering.DESeqFilter.save_table", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.drop_columns", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_by_row_name", "rnalysis.filtering.Filter.filter_duplicate_ids", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.find_paralogs_ensembl", "rnalysis.filtering.Filter.find_paralogs_panther", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.map_orthologs_ensembl", "rnalysis.filtering.Filter.map_orthologs_orthoinspector", "rnalysis.filtering.Filter.map_orthologs_panther", "rnalysis.filtering.Filter.map_orthologs_phylomedb", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.save_parquet", "rnalysis.filtering.Filter.save_table", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.drop_columns", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.save_parquet", "rnalysis.filtering.FoldChangeFilter.save_table", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.general", "rnalysis.general.clear_all_cache", "rnalysis.general.clear_gui_cache", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "tutorial", "user_guide", "user_guide_gui"], "filenames": ["api_reference.rst", "contributing.rst", "faq.rst", "genindex.rst", "glossary.rst", "history.rst", "index.rst", "installation.rst", "quick_start.rst", "readme.rst", "rnalysis.rst", "rnalysis.enrichment.rst", "rnalysis.enrichment.FeatureSet.rst", "rnalysis.enrichment.FeatureSet.add.rst", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table.rst", "rnalysis.enrichment.FeatureSet.change_set_name.rst", "rnalysis.enrichment.FeatureSet.clear.rst", "rnalysis.enrichment.FeatureSet.copy.rst", "rnalysis.enrichment.FeatureSet.difference.rst", "rnalysis.enrichment.FeatureSet.difference_update.rst", "rnalysis.enrichment.FeatureSet.discard.rst", "rnalysis.enrichment.FeatureSet.filter_by_attribute.rst", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations.rst", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations.rst", "rnalysis.enrichment.FeatureSet.go_enrichment.rst", "rnalysis.enrichment.FeatureSet.intersection.rst", "rnalysis.enrichment.FeatureSet.intersection_update.rst", "rnalysis.enrichment.FeatureSet.isdisjoint.rst", "rnalysis.enrichment.FeatureSet.issubset.rst", "rnalysis.enrichment.FeatureSet.issuperset.rst", "rnalysis.enrichment.FeatureSet.kegg_enrichment.rst", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment.rst", "rnalysis.enrichment.FeatureSet.pop.rst", "rnalysis.enrichment.FeatureSet.remove.rst", "rnalysis.enrichment.FeatureSet.save_txt.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference_update.rst", "rnalysis.enrichment.FeatureSet.translate_gene_ids.rst", "rnalysis.enrichment.FeatureSet.union.rst", "rnalysis.enrichment.FeatureSet.update.rst", "rnalysis.enrichment.FeatureSet.user_defined_enrichment.rst", "rnalysis.enrichment.RankedSet.rst", "rnalysis.enrichment.RankedSet.add.rst", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table.rst", "rnalysis.enrichment.RankedSet.change_set_name.rst", "rnalysis.enrichment.RankedSet.clear.rst", "rnalysis.enrichment.RankedSet.copy.rst", "rnalysis.enrichment.RankedSet.difference.rst", "rnalysis.enrichment.RankedSet.difference_update.rst", "rnalysis.enrichment.RankedSet.discard.rst", "rnalysis.enrichment.RankedSet.filter_by_attribute.rst", "rnalysis.enrichment.RankedSet.filter_by_go_annotations.rst", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations.rst", "rnalysis.enrichment.RankedSet.go_enrichment.rst", "rnalysis.enrichment.RankedSet.intersection.rst", "rnalysis.enrichment.RankedSet.intersection_update.rst", "rnalysis.enrichment.RankedSet.isdisjoint.rst", "rnalysis.enrichment.RankedSet.issubset.rst", "rnalysis.enrichment.RankedSet.issuperset.rst", "rnalysis.enrichment.RankedSet.kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.non_categorical_enrichment.rst", "rnalysis.enrichment.RankedSet.pop.rst", "rnalysis.enrichment.RankedSet.remove.rst", "rnalysis.enrichment.RankedSet.save_txt.rst", "rnalysis.enrichment.RankedSet.single_set_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_go_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.symmetric_difference.rst", "rnalysis.enrichment.RankedSet.symmetric_difference_update.rst", "rnalysis.enrichment.RankedSet.translate_gene_ids.rst", "rnalysis.enrichment.RankedSet.union.rst", "rnalysis.enrichment.RankedSet.update.rst", "rnalysis.enrichment.RankedSet.user_defined_enrichment.rst", "rnalysis.enrichment.enrichment_bar_plot.rst", "rnalysis.enrichment.gene_ontology_graph.rst", "rnalysis.enrichment.kegg_pathway_graph.rst", "rnalysis.enrichment.upset_plot.rst", "rnalysis.enrichment.venn_diagram.rst", "rnalysis.fastq.rst", "rnalysis.fastq.PairedEndPipeline.rst", "rnalysis.fastq.PairedEndPipeline.add_function.rst", "rnalysis.fastq.PairedEndPipeline.apply_to.rst", "rnalysis.fastq.PairedEndPipeline.export_pipeline.rst", "rnalysis.fastq.PairedEndPipeline.import_pipeline.rst", "rnalysis.fastq.PairedEndPipeline.remove_last_function.rst", "rnalysis.fastq.SingleEndPipeline.rst", "rnalysis.fastq.SingleEndPipeline.add_function.rst", "rnalysis.fastq.SingleEndPipeline.apply_to.rst", "rnalysis.fastq.SingleEndPipeline.export_pipeline.rst", "rnalysis.fastq.SingleEndPipeline.import_pipeline.rst", "rnalysis.fastq.SingleEndPipeline.remove_last_function.rst", "rnalysis.fastq.bowtie2_align_paired_end.rst", "rnalysis.fastq.bowtie2_align_single_end.rst", "rnalysis.fastq.bowtie2_create_index.rst", "rnalysis.fastq.featurecounts_paired_end.rst", "rnalysis.fastq.featurecounts_single_end.rst", "rnalysis.fastq.kallisto_create_index.rst", "rnalysis.fastq.kallisto_quantify_paired_end.rst", "rnalysis.fastq.kallisto_quantify_single_end.rst", "rnalysis.fastq.shortstack_align_smallrna.rst", "rnalysis.fastq.trim_adapters_paired_end.rst", "rnalysis.fastq.trim_adapters_single_end.rst", "rnalysis.filtering.rst", "rnalysis.filtering.CountFilter.rst", "rnalysis.filtering.CountFilter.average_replicate_samples.rst", "rnalysis.filtering.CountFilter.biotypes_from_gtf.rst", "rnalysis.filtering.CountFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.CountFilter.box_plot.rst", "rnalysis.filtering.CountFilter.clustergram.rst", "rnalysis.filtering.CountFilter.describe.rst", "rnalysis.filtering.CountFilter.difference.rst", "rnalysis.filtering.CountFilter.differential_expression_deseq2.rst", "rnalysis.filtering.CountFilter.differential_expression_limma_voom.rst", "rnalysis.filtering.CountFilter.drop_columns.rst", "rnalysis.filtering.CountFilter.enhanced_box_plot.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.CountFilter.filter_by_attribute.rst", "rnalysis.filtering.CountFilter.filter_by_go_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_row_name.rst", "rnalysis.filtering.CountFilter.filter_by_row_sum.rst", "rnalysis.filtering.CountFilter.filter_duplicate_ids.rst", "rnalysis.filtering.CountFilter.filter_low_reads.rst", "rnalysis.filtering.CountFilter.filter_missing_values.rst", "rnalysis.filtering.CountFilter.filter_percentile.rst", "rnalysis.filtering.CountFilter.filter_top_n.rst", "rnalysis.filtering.CountFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.CountFilter.find_paralogs_panther.rst", "rnalysis.filtering.CountFilter.fold_change.rst", "rnalysis.filtering.CountFilter.from_dataframe.rst", "rnalysis.filtering.CountFilter.from_folder.rst", "rnalysis.filtering.CountFilter.from_folder_htseqcount.rst", "rnalysis.filtering.CountFilter.head.rst", "rnalysis.filtering.CountFilter.intersection.rst", "rnalysis.filtering.CountFilter.ma_plot.rst", "rnalysis.filtering.CountFilter.majority_vote_intersection.rst", "rnalysis.filtering.CountFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.CountFilter.map_orthologs_panther.rst", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.CountFilter.normalize_median_of_ratios.rst", "rnalysis.filtering.CountFilter.normalize_rle.rst", "rnalysis.filtering.CountFilter.normalize_tmm.rst", "rnalysis.filtering.CountFilter.normalize_to_quantile.rst", "rnalysis.filtering.CountFilter.normalize_to_rpkm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.rst", "rnalysis.filtering.CountFilter.normalize_to_tpm.rst", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors.rst", "rnalysis.filtering.CountFilter.number_filters.rst", "rnalysis.filtering.CountFilter.pairplot.rst", "rnalysis.filtering.CountFilter.pca.rst", "rnalysis.filtering.CountFilter.plot_expression.rst", "rnalysis.filtering.CountFilter.print_features.rst", "rnalysis.filtering.CountFilter.save_csv.rst", "rnalysis.filtering.CountFilter.save_parquet.rst", "rnalysis.filtering.CountFilter.save_table.rst", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample.rst", "rnalysis.filtering.CountFilter.sort.rst", "rnalysis.filtering.CountFilter.sort_by_principal_component.rst", "rnalysis.filtering.CountFilter.split_by_attribute.rst", "rnalysis.filtering.CountFilter.split_by_percentile.rst", "rnalysis.filtering.CountFilter.split_by_principal_components.rst", "rnalysis.filtering.CountFilter.split_by_reads.rst", "rnalysis.filtering.CountFilter.split_clicom.rst", "rnalysis.filtering.CountFilter.split_hdbscan.rst", "rnalysis.filtering.CountFilter.split_hierarchical.rst", "rnalysis.filtering.CountFilter.split_kmeans.rst", "rnalysis.filtering.CountFilter.split_kmedoids.rst", "rnalysis.filtering.CountFilter.symmetric_difference.rst", "rnalysis.filtering.CountFilter.tail.rst", "rnalysis.filtering.CountFilter.text_filters.rst", "rnalysis.filtering.CountFilter.transform.rst", "rnalysis.filtering.CountFilter.translate_gene_ids.rst", "rnalysis.filtering.CountFilter.union.rst", "rnalysis.filtering.CountFilter.violin_plot.rst", "rnalysis.filtering.DESeqFilter.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.describe.rst", "rnalysis.filtering.DESeqFilter.difference.rst", "rnalysis.filtering.DESeqFilter.drop_columns.rst", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.filter_by_attribute.rst", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_row_name.rst", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids.rst", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.filter_missing_values.rst", "rnalysis.filtering.DESeqFilter.filter_percentile.rst", "rnalysis.filtering.DESeqFilter.filter_significant.rst", "rnalysis.filtering.DESeqFilter.filter_top_n.rst", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.DESeqFilter.find_paralogs_panther.rst", "rnalysis.filtering.DESeqFilter.from_dataframe.rst", "rnalysis.filtering.DESeqFilter.head.rst", "rnalysis.filtering.DESeqFilter.intersection.rst", "rnalysis.filtering.DESeqFilter.majority_vote_intersection.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_panther.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.DESeqFilter.number_filters.rst", "rnalysis.filtering.DESeqFilter.print_features.rst", "rnalysis.filtering.DESeqFilter.save_csv.rst", "rnalysis.filtering.DESeqFilter.save_parquet.rst", "rnalysis.filtering.DESeqFilter.save_table.rst", "rnalysis.filtering.DESeqFilter.sort.rst", "rnalysis.filtering.DESeqFilter.split_by_attribute.rst", "rnalysis.filtering.DESeqFilter.split_by_percentile.rst", "rnalysis.filtering.DESeqFilter.split_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.symmetric_difference.rst", "rnalysis.filtering.DESeqFilter.tail.rst", "rnalysis.filtering.DESeqFilter.text_filters.rst", "rnalysis.filtering.DESeqFilter.transform.rst", "rnalysis.filtering.DESeqFilter.translate_gene_ids.rst", "rnalysis.filtering.DESeqFilter.union.rst", "rnalysis.filtering.DESeqFilter.volcano_plot.rst", "rnalysis.filtering.Filter.rst", "rnalysis.filtering.Filter.biotypes_from_gtf.rst", "rnalysis.filtering.Filter.biotypes_from_ref_table.rst", "rnalysis.filtering.Filter.describe.rst", "rnalysis.filtering.Filter.difference.rst", "rnalysis.filtering.Filter.drop_columns.rst", "rnalysis.filtering.Filter.filter_biotype_from_gtf.rst", "rnalysis.filtering.Filter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.Filter.filter_by_attribute.rst", "rnalysis.filtering.Filter.filter_by_go_annotations.rst", "rnalysis.filtering.Filter.filter_by_kegg_annotations.rst", "rnalysis.filtering.Filter.filter_by_row_name.rst", "rnalysis.filtering.Filter.filter_duplicate_ids.rst", "rnalysis.filtering.Filter.filter_missing_values.rst", "rnalysis.filtering.Filter.filter_percentile.rst", "rnalysis.filtering.Filter.filter_top_n.rst", "rnalysis.filtering.Filter.find_paralogs_ensembl.rst", "rnalysis.filtering.Filter.find_paralogs_panther.rst", "rnalysis.filtering.Filter.from_dataframe.rst", "rnalysis.filtering.Filter.head.rst", "rnalysis.filtering.Filter.intersection.rst", "rnalysis.filtering.Filter.majority_vote_intersection.rst", "rnalysis.filtering.Filter.map_orthologs_ensembl.rst", "rnalysis.filtering.Filter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.Filter.map_orthologs_panther.rst", "rnalysis.filtering.Filter.map_orthologs_phylomedb.rst", "rnalysis.filtering.Filter.number_filters.rst", "rnalysis.filtering.Filter.print_features.rst", "rnalysis.filtering.Filter.save_csv.rst", "rnalysis.filtering.Filter.save_parquet.rst", "rnalysis.filtering.Filter.save_table.rst", "rnalysis.filtering.Filter.sort.rst", "rnalysis.filtering.Filter.split_by_attribute.rst", "rnalysis.filtering.Filter.split_by_percentile.rst", "rnalysis.filtering.Filter.symmetric_difference.rst", "rnalysis.filtering.Filter.tail.rst", "rnalysis.filtering.Filter.text_filters.rst", "rnalysis.filtering.Filter.transform.rst", "rnalysis.filtering.Filter.translate_gene_ids.rst", "rnalysis.filtering.Filter.union.rst", "rnalysis.filtering.FoldChangeFilter.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.describe.rst", "rnalysis.filtering.FoldChangeFilter.difference.rst", "rnalysis.filtering.FoldChangeFilter.drop_columns.rst", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name.rst", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids.rst", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.filter_missing_values.rst", "rnalysis.filtering.FoldChangeFilter.filter_percentile.rst", "rnalysis.filtering.FoldChangeFilter.filter_top_n.rst", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther.rst", "rnalysis.filtering.FoldChangeFilter.from_dataframe.rst", "rnalysis.filtering.FoldChangeFilter.head.rst", "rnalysis.filtering.FoldChangeFilter.intersection.rst", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.FoldChangeFilter.number_filters.rst", "rnalysis.filtering.FoldChangeFilter.print_features.rst", "rnalysis.filtering.FoldChangeFilter.randomization_test.rst", "rnalysis.filtering.FoldChangeFilter.save_csv.rst", "rnalysis.filtering.FoldChangeFilter.save_parquet.rst", "rnalysis.filtering.FoldChangeFilter.save_table.rst", "rnalysis.filtering.FoldChangeFilter.sort.rst", "rnalysis.filtering.FoldChangeFilter.split_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.split_by_percentile.rst", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.symmetric_difference.rst", "rnalysis.filtering.FoldChangeFilter.tail.rst", "rnalysis.filtering.FoldChangeFilter.text_filters.rst", "rnalysis.filtering.FoldChangeFilter.transform.rst", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids.rst", "rnalysis.filtering.FoldChangeFilter.union.rst", "rnalysis.filtering.Pipeline.rst", "rnalysis.filtering.Pipeline.add_function.rst", "rnalysis.filtering.Pipeline.apply_to.rst", "rnalysis.filtering.Pipeline.export_pipeline.rst", "rnalysis.filtering.Pipeline.import_pipeline.rst", "rnalysis.filtering.Pipeline.remove_last_function.rst", "rnalysis.general.rst", "rnalysis.general.clear_all_cache.rst", "rnalysis.general.clear_gui_cache.rst", "rnalysis.general.parse_gene_name_string.rst", "rnalysis.general.parse_sequence_name_string.rst", "rnalysis.general.parse_wbgene_string.rst", "rnalysis.general.print_settings_file.rst", "rnalysis.general.reset_settings_file.rst", "rnalysis.general.save_to_csv.rst", "rnalysis.general.set_attr_ref_table_path.rst", "rnalysis.general.set_biotype_ref_table_path.rst", "tutorial.rst", "user_guide.rst", "user_guide_gui.rst"], "titles": ["API Reference", "How can I contribute to <em>RNAlysis</em>?", "Frequently asked questions", "Index", "Glossary - programmatic interface", "History", "RNAlysis 3.10.1 documentation", "Installation", "<em>RNAlysis</em> quick-start video guide", "What is <em>RNAlysis?</em>", "rnalysis package", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.add", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.clear", "rnalysis.enrichment.FeatureSet.copy", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.difference_update", "rnalysis.enrichment.FeatureSet.discard", "rnalysis.enrichment.FeatureSet.filter_by_attribute", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.intersection_update", "rnalysis.enrichment.FeatureSet.isdisjoint", "rnalysis.enrichment.FeatureSet.issubset", "rnalysis.enrichment.FeatureSet.issuperset", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.pop", "rnalysis.enrichment.FeatureSet.remove", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.symmetric_difference_update", "rnalysis.enrichment.FeatureSet.translate_gene_ids", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.update", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.add", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.clear", "rnalysis.enrichment.RankedSet.copy", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.difference_update", "rnalysis.enrichment.RankedSet.discard", "rnalysis.enrichment.RankedSet.filter_by_attribute", "rnalysis.enrichment.RankedSet.filter_by_go_annotations", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.intersection_update", "rnalysis.enrichment.RankedSet.isdisjoint", "rnalysis.enrichment.RankedSet.issubset", "rnalysis.enrichment.RankedSet.issuperset", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.pop", "rnalysis.enrichment.RankedSet.remove", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.symmetric_difference_update", "rnalysis.enrichment.RankedSet.translate_gene_ids", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.update", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.enrichment_bar_plot", "rnalysis.enrichment.gene_ontology_graph", "rnalysis.enrichment.kegg_pathway_graph", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.fastq", "rnalysis.fastq.PairedEndPipeline", "rnalysis.fastq.PairedEndPipeline.add_function", "rnalysis.fastq.PairedEndPipeline.apply_to", "rnalysis.fastq.PairedEndPipeline.export_pipeline", "rnalysis.fastq.PairedEndPipeline.import_pipeline", "rnalysis.fastq.PairedEndPipeline.remove_last_function", "rnalysis.fastq.SingleEndPipeline", "rnalysis.fastq.SingleEndPipeline.add_function", "rnalysis.fastq.SingleEndPipeline.apply_to", "rnalysis.fastq.SingleEndPipeline.export_pipeline", "rnalysis.fastq.SingleEndPipeline.import_pipeline", "rnalysis.fastq.SingleEndPipeline.remove_last_function", "rnalysis.fastq.bowtie2_align_paired_end", "rnalysis.fastq.bowtie2_align_single_end", "rnalysis.fastq.bowtie2_create_index", "rnalysis.fastq.featurecounts_paired_end", "rnalysis.fastq.featurecounts_single_end", "rnalysis.fastq.kallisto_create_index", "rnalysis.fastq.kallisto_quantify_paired_end", "rnalysis.fastq.kallisto_quantify_single_end", "rnalysis.fastq.shortstack_align_smallrna", "rnalysis.fastq.trim_adapters_paired_end", "rnalysis.fastq.trim_adapters_single_end", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.differential_expression_limma_voom", "rnalysis.filtering.CountFilter.drop_columns", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_name", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_duplicate_ids", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.find_paralogs_ensembl", "rnalysis.filtering.CountFilter.find_paralogs_panther", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.from_folder_htseqcount", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.map_orthologs_ensembl", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector", "rnalysis.filtering.CountFilter.map_orthologs_panther", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpkm", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_to_tpm", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.save_parquet", "rnalysis.filtering.CountFilter.save_table", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.sort_by_principal_component", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_principal_components", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.drop_columns", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_by_row_name", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl", "rnalysis.filtering.DESeqFilter.find_paralogs_panther", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector", "rnalysis.filtering.DESeqFilter.map_orthologs_panther", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.save_parquet", "rnalysis.filtering.DESeqFilter.save_table", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.drop_columns", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_by_row_name", "rnalysis.filtering.Filter.filter_duplicate_ids", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.find_paralogs_ensembl", "rnalysis.filtering.Filter.find_paralogs_panther", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.map_orthologs_ensembl", "rnalysis.filtering.Filter.map_orthologs_orthoinspector", "rnalysis.filtering.Filter.map_orthologs_panther", "rnalysis.filtering.Filter.map_orthologs_phylomedb", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.save_parquet", "rnalysis.filtering.Filter.save_table", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.drop_columns", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.save_parquet", "rnalysis.filtering.FoldChangeFilter.save_table", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.general", "rnalysis.general.clear_all_cache", "rnalysis.general.clear_gui_cache", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "A-to-Z tutorial - example analysis", "User guide - programmatic interface", "User guide - graphical interface"], "terms": {"privat": 0, "function": [0, 1, 4, 5, 7, 8, 9, 10, 11, 21, 22, 23, 24, 30, 41, 50, 51, 52, 53, 59, 65, 66, 73, 74, 78, 80, 84, 86, 90, 91, 92, 97, 98, 103, 104, 107, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 172, 173, 174, 176, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 217, 218, 219, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 258, 259, 260, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 302, 303, 304, 306, 307, 308, 311, 312, 323, 324], "ar": [0, 1, 5, 7, 10, 18, 21, 22, 23, 24, 30, 31, 40, 47, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 111, 112, 117, 118, 119, 123, 124, 129, 140, 141, 143, 148, 161, 165, 166, 177, 186, 187, 188, 192, 205, 212, 221, 222, 230, 231, 232, 235, 247, 254, 262, 271, 272, 273, 289, 297, 324, 325], "meant": [0, 103], "us": [0, 1, 4, 5, 6, 7, 8, 10, 12, 14, 21, 22, 24, 30, 31, 37, 40, 41, 43, 50, 51, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 111, 112, 114, 115, 116, 117, 118, 127, 128, 129, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 147, 148, 149, 155, 156, 157, 158, 160, 161, 165, 166, 167, 168, 169, 174, 176, 177, 178, 179, 184, 185, 186, 187, 196, 197, 202, 203, 204, 205, 208, 209, 210, 212, 219, 221, 222, 223, 224, 228, 229, 230, 231, 238, 239, 244, 245, 246, 247, 250, 251, 252, 254, 260, 262, 263, 264, 269, 270, 271, 272, 280, 281, 286, 287, 288, 289, 292, 293, 294, 295, 297, 304, 307, 318, 323], "out": [0, 1, 2, 5, 7, 10, 21, 22, 23, 50, 51, 52, 76, 111, 112, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 143, 150, 162, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 213, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 255, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 298, 302, 324, 325], "context": [0, 5], "do": [0, 5, 6, 7, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 97, 98, 99, 115, 116, 118, 119, 127, 128, 137, 138, 139, 140, 184, 185, 187, 188, 196, 197, 202, 203, 204, 205, 228, 229, 231, 232, 238, 239, 244, 245, 246, 247, 269, 270, 272, 273, 280, 281, 286, 287, 288, 289, 307, 323, 324, 325], "so": [0, 2, 7, 9, 10, 91, 97, 100, 141, 143, 323, 324, 325], "mai": [0, 2, 7, 9, 10, 77, 99, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 323, 324, 325], "lead": [0, 2, 5, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 262, 323, 324, 325], "unexpect": 0, "result": [0, 5, 8, 10, 11, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 91, 92, 94, 95, 97, 98, 111, 112, 124, 161, 162, 164, 165, 166, 167, 168, 169, 173, 192, 212, 213, 214, 218, 235, 254, 255, 259, 292, 297, 299, 308, 312, 323, 325], "The": [0, 1, 2, 4, 5, 7, 8, 9, 10, 18, 24, 25, 30, 31, 38, 40, 47, 53, 54, 59, 60, 64, 65, 66, 70, 72, 74, 75, 78, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 107, 108, 109, 111, 112, 113, 114, 115, 116, 121, 123, 125, 131, 132, 135, 136, 145, 148, 151, 152, 153, 162, 164, 165, 166, 167, 168, 169, 173, 176, 177, 178, 179, 180, 182, 183, 184, 185, 193, 201, 213, 214, 218, 221, 222, 223, 224, 225, 227, 228, 229, 236, 243, 255, 259, 262, 263, 264, 265, 267, 268, 269, 270, 278, 285, 292, 298, 299, 303, 306, 315, 316, 317, 324, 325], "provid": [0, 1, 5, 7, 10, 78, 99, 105, 106, 166, 178, 179, 194, 223, 224, 263, 264, 323, 324, 325], "unifi": [0, 78, 324], "programmat": [0, 1, 5, 6, 7, 9, 78, 323], "interfac": [0, 1, 5, 6, 7, 9, 78, 323], "extern": [0, 5, 7, 78, 324], "tool": [0, 5, 6, 9, 78, 97, 98, 323, 324, 325], "process": [0, 2, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 78, 100, 101, 165, 166, 167, 168, 169, 323, 324, 325], "file": [0, 1, 4, 5, 7, 8, 10, 11, 14, 24, 30, 31, 34, 40, 43, 53, 59, 60, 63, 64, 65, 66, 72, 74, 75, 78, 82, 83, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 105, 111, 112, 115, 116, 131, 132, 145, 147, 148, 149, 155, 156, 157, 177, 178, 184, 185, 208, 209, 210, 222, 223, 228, 229, 250, 251, 252, 262, 263, 269, 270, 292, 293, 294, 295, 309, 310, 312, 318, 319, 320, 321, 322], "those": [0, 2, 8, 10, 75, 78, 91, 92, 141, 144, 165, 166, 167, 168, 169, 312, 323, 324, 325], "current": [0, 1, 2, 5, 10, 18, 21, 22, 23, 25, 35, 38, 47, 50, 51, 52, 54, 67, 70, 78, 99, 103, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 154, 155, 156, 157, 172, 173, 174, 177, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 207, 208, 209, 210, 217, 218, 219, 222, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 249, 250, 251, 252, 258, 259, 260, 262, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 291, 293, 294, 295, 302, 303, 304, 318, 324, 325], "includ": [0, 1, 5, 7, 8, 10, 11, 22, 24, 30, 31, 34, 40, 51, 53, 59, 60, 63, 64, 65, 66, 72, 76, 77, 78, 102, 106, 109, 118, 131, 132, 143, 151, 164, 179, 180, 187, 224, 225, 231, 264, 265, 272, 307, 312, 323, 324, 325], "cutadapt": [0, 5, 9, 78, 100, 101], "adapt": [0, 5, 7, 8, 9, 78, 99, 100, 101], "trim": [0, 5, 7, 8, 9, 10, 78, 99, 100, 101, 143, 325], "kallisto": [0, 5, 7, 9, 78, 96, 97, 98], "rna": [0, 5, 6, 7, 9, 10, 78, 99, 103, 147, 325], "sequenc": [0, 5, 6, 9, 10, 75, 78, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 158, 315, 316, 325], "quantif": [0, 5, 7, 9, 78, 97, 98, 323], "bowtie2": [0, 5, 9, 78, 91, 92, 93, 94, 95], "align": [0, 5, 8, 9, 10, 78, 91, 92, 93, 94, 95, 99, 131, 132, 147, 167, 323, 325], "featurecount": [0, 5, 78, 94, 95], "featur": [0, 4, 5, 7, 8, 9, 10, 11, 12, 21, 22, 23, 24, 30, 31, 34, 37, 40, 41, 50, 51, 52, 53, 59, 60, 63, 65, 66, 69, 72, 75, 76, 77, 78, 94, 95, 97, 98, 103, 105, 106, 110, 115, 116, 117, 118, 119, 121, 123, 124, 125, 126, 127, 128, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 153, 154, 158, 161, 162, 164, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 177, 178, 179, 181, 183, 184, 185, 186, 187, 188, 191, 192, 193, 194, 195, 196, 197, 200, 201, 202, 203, 204, 205, 206, 207, 212, 213, 214, 215, 217, 218, 219, 220, 221, 222, 223, 224, 226, 228, 229, 230, 231, 232, 235, 236, 237, 238, 239, 242, 243, 244, 245, 246, 247, 248, 249, 254, 255, 256, 258, 259, 260, 261, 262, 263, 264, 266, 268, 269, 270, 271, 272, 273, 276, 278, 279, 280, 281, 284, 285, 286, 287, 288, 289, 290, 291, 292, 297, 298, 299, 300, 302, 304, 305, 308, 312, 323, 325], "count": [0, 1, 2, 4, 5, 8, 9, 10, 12, 14, 41, 43, 78, 94, 95, 97, 98, 102, 103, 104, 105, 106, 109, 110, 111, 112, 116, 117, 121, 123, 126, 131, 132, 136, 141, 142, 143, 144, 145, 146, 147, 148, 149, 153, 154, 158, 159, 161, 164, 170, 173, 175, 178, 179, 180, 181, 185, 186, 195, 201, 207, 211, 212, 215, 218, 220, 222, 223, 224, 225, 226, 229, 230, 237, 243, 249, 253, 254, 256, 259, 261, 263, 264, 265, 266, 270, 271, 279, 285, 291, 296, 297, 300, 305, 323], "class": [0, 5, 10, 11, 12, 41, 78, 79, 85, 102, 103, 177, 222, 262, 306, 324], "pairedendpipelin": [0, 5], "base": [0, 2, 4, 5, 7, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 73, 74, 75, 97, 98, 99, 100, 101, 108, 111, 112, 118, 119, 127, 128, 137, 138, 139, 140, 160, 163, 164, 165, 166, 167, 168, 169, 173, 174, 187, 188, 196, 197, 202, 203, 204, 205, 214, 218, 219, 231, 232, 238, 239, 244, 245, 246, 247, 259, 260, 272, 273, 280, 281, 286, 287, 288, 289, 299, 303, 304, 324, 325], "_fastqpipelin": 0, "_func_signatur": 0, "func": [0, 10, 80, 86, 307], "arg": [0, 10, 80, 86, 307], "tupl": [0, 10, 24, 30, 31, 40, 41, 53, 59, 60, 64, 65, 66, 72, 77, 94, 95, 103, 111, 112, 152, 158, 161, 162, 163, 164, 165, 166, 167, 168, 169, 177, 212, 213, 214, 222, 254, 255, 262, 297, 298, 299, 308, 324], "kwarg": [0, 10, 80, 86, 307], "dict": [0, 5, 10, 76, 77, 165, 308], "return": [0, 5, 10, 14, 17, 18, 21, 22, 23, 24, 25, 27, 30, 31, 32, 35, 37, 38, 40, 43, 46, 47, 50, 51, 52, 53, 54, 56, 59, 60, 61, 64, 65, 66, 67, 69, 70, 72, 73, 74, 76, 77, 82, 83, 88, 89, 94, 95, 97, 98, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 253, 254, 255, 256, 257, 258, 259, 260, 261, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 292, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 308, 309, 310, 315, 316, 317, 323, 324, 325], "string": [0, 5, 10, 12, 21, 24, 30, 31, 40, 41, 50, 53, 59, 60, 72, 82, 83, 88, 89, 99, 103, 110, 115, 116, 117, 134, 136, 153, 155, 156, 157, 158, 161, 165, 170, 175, 177, 181, 184, 185, 186, 200, 201, 208, 209, 210, 212, 215, 220, 222, 226, 228, 229, 230, 242, 243, 250, 251, 252, 254, 256, 261, 262, 266, 269, 270, 271, 284, 285, 293, 294, 295, 297, 300, 305, 309, 310, 315, 316, 317, 324], "signatur": [0, 5], "given": [0, 1, 5, 10, 11, 21, 22, 23, 50, 51, 52, 65, 66, 91, 92, 94, 95, 97, 98, 99, 104, 108, 117, 118, 119, 129, 131, 132, 134, 136, 144, 145, 148, 161, 186, 187, 188, 200, 201, 212, 230, 231, 232, 242, 243, 254, 271, 272, 273, 284, 285, 292, 297, 308, 315, 316, 317, 324, 325], "argument": [0, 4, 5, 10, 99, 129, 173, 218, 259, 303, 307, 324], "paramet": [0, 1, 2, 5, 8, 10, 12, 14, 15, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 37, 38, 40, 41, 43, 44, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 82, 83, 84, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 206, 208, 209, 210, 211, 212, 213, 215, 216, 217, 218, 219, 220, 221, 222, 223, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 248, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 290, 292, 293, 294, 295, 296, 297, 298, 300, 301, 302, 303, 304, 305, 306, 308, 309, 310, 311, 323], "method": [0, 5, 7, 8, 9, 10, 20, 22, 24, 30, 31, 40, 49, 51, 53, 59, 60, 64, 65, 66, 72, 97, 98, 103, 108, 118, 141, 142, 143, 144, 145, 148, 155, 156, 157, 165, 166, 177, 187, 208, 209, 210, 222, 231, 250, 251, 252, 262, 272, 293, 294, 295, 323], "keyword": [0, 10, 173, 218, 259, 303, 307, 324], "type": [0, 4, 5, 6, 7, 9, 10, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 73, 75, 77, 83, 89, 91, 92, 93, 94, 95, 99, 105, 107, 108, 109, 110, 114, 115, 118, 119, 124, 127, 128, 129, 134, 135, 136, 137, 138, 139, 140, 145, 148, 160, 161, 162, 163, 164, 170, 171, 174, 175, 176, 178, 180, 181, 184, 187, 188, 192, 196, 197, 200, 201, 202, 203, 204, 205, 212, 213, 214, 215, 216, 219, 220, 221, 223, 225, 226, 228, 231, 232, 235, 238, 239, 242, 243, 244, 245, 246, 247, 254, 255, 256, 257, 260, 261, 263, 265, 266, 269, 272, 273, 280, 281, 284, 285, 286, 287, 288, 289, 292, 297, 298, 299, 300, 301, 304, 305, 306, 307, 308, 310, 312, 315, 316, 317, 320, 321, 322, 323], "str": [0, 5, 10, 12, 14, 15, 21, 22, 23, 24, 30, 31, 34, 37, 40, 41, 43, 44, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 108, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 145, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 166, 169, 170, 172, 173, 174, 175, 176, 177, 178, 179, 181, 182, 184, 185, 186, 187, 188, 189, 193, 195, 196, 197, 198, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 212, 213, 215, 217, 218, 219, 220, 221, 222, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 236, 237, 238, 239, 240, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 256, 258, 259, 260, 261, 262, 263, 264, 266, 267, 269, 270, 271, 272, 273, 274, 279, 280, 281, 282, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 297, 300, 302, 303, 304, 305, 306, 307, 309, 310, 315, 316, 317, 320, 321, 322], "static": 0, "_param_str": 0, "format": [0, 1, 4, 5, 7, 8, 10, 24, 30, 53, 59, 65, 66, 74, 75, 77, 93, 94, 95, 96, 97, 98, 99, 102, 105, 106, 115, 131, 132, 178, 179, 184, 223, 224, 228, 263, 264, 269, 315, 316, 317, 323, 324], "argumentss": 0, "_readable_func_signatur": 0, "human": 0, "readabl": [0, 5, 323], "export_pipelin": [0, 10], "filenam": [0, 4, 5, 10, 21, 34, 50, 63, 82, 83, 88, 89, 103, 117, 161, 177, 186, 212, 222, 230, 254, 262, 271, 297, 309, 310, 320, 324], "option": [0, 2, 4, 5, 10, 12, 24, 30, 37, 40, 53, 59, 69, 72, 74, 75, 76, 77, 82, 88, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 111, 112, 143, 152, 158, 166, 167, 168, 169, 174, 219, 221, 260, 292, 304, 308, 309, 323], "union": [0, 5, 10, 12, 14, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 37, 39, 40, 41, 43, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 69, 71, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 114, 115, 116, 117, 118, 119, 120, 124, 126, 127, 128, 130, 134, 135, 136, 137, 138, 139, 140, 143, 145, 147, 148, 149, 151, 152, 153, 155, 156, 157, 158, 159, 161, 163, 165, 166, 167, 168, 169, 170, 173, 174, 176, 177, 178, 179, 180, 181, 184, 185, 186, 187, 188, 189, 192, 195, 196, 197, 198, 200, 201, 202, 203, 204, 205, 208, 209, 210, 211, 212, 215, 218, 219, 221, 222, 223, 224, 225, 226, 228, 229, 230, 231, 232, 233, 235, 237, 238, 239, 240, 242, 243, 244, 245, 246, 247, 250, 251, 252, 253, 254, 256, 259, 260, 262, 263, 264, 265, 266, 269, 270, 271, 272, 273, 274, 279, 280, 281, 282, 284, 285, 286, 287, 288, 289, 293, 294, 295, 296, 297, 300, 303, 304, 306, 307, 308, 309, 310, 320, 323, 324, 325], "path": [0, 10, 14, 21, 23, 24, 30, 31, 34, 40, 43, 50, 52, 53, 59, 60, 63, 64, 65, 66, 72, 73, 74, 76, 77, 81, 82, 83, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 111, 112, 115, 116, 117, 119, 130, 131, 132, 145, 147, 148, 149, 155, 156, 157, 161, 177, 178, 179, 184, 185, 186, 188, 198, 208, 209, 210, 212, 222, 223, 224, 228, 229, 230, 232, 240, 250, 251, 252, 254, 262, 263, 264, 269, 270, 271, 273, 282, 292, 293, 294, 295, 297, 309, 310, 320, 321, 322, 323, 325], "none": [0, 5, 10, 12, 21, 22, 24, 30, 31, 40, 50, 51, 53, 59, 60, 64, 65, 66, 72, 74, 75, 76, 77, 82, 88, 93, 94, 95, 97, 98, 99, 100, 101, 103, 111, 112, 117, 118, 131, 132, 137, 138, 139, 140, 143, 152, 155, 156, 157, 158, 159, 160, 166, 167, 168, 169, 177, 186, 187, 202, 203, 204, 205, 208, 209, 210, 211, 221, 222, 230, 231, 244, 245, 246, 247, 250, 251, 252, 253, 271, 272, 286, 287, 288, 289, 292, 293, 294, 295, 296, 308, 309, 321, 322, 323], "export": [0, 5, 6, 10, 82, 88, 309, 323, 324], "pipelin": [0, 2, 4, 5, 6, 9, 10, 82, 83, 84, 88, 89, 90, 112], "yaml": [0, 5, 10, 82, 83, 88, 89, 116, 185, 229, 270, 309, 310, 324, 325], "like": [0, 1, 2, 4, 5, 10, 82, 83, 88, 89, 109, 143, 180, 225, 265, 309, 310, 315, 323, 324, 325], "pathlib": [0, 10, 14, 21, 24, 30, 31, 34, 40, 43, 50, 53, 59, 60, 63, 64, 65, 66, 72, 76, 77, 82, 83, 88, 89, 103, 117, 131, 132, 149, 155, 156, 157, 177, 186, 208, 209, 210, 222, 230, 250, 251, 252, 262, 271, 292, 293, 294, 295, 309, 310], "save": [0, 2, 5, 6, 10, 11, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 82, 88, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 111, 112, 124, 131, 132, 155, 156, 157, 161, 162, 164, 165, 166, 167, 168, 169, 173, 177, 192, 208, 209, 210, 212, 213, 214, 218, 222, 235, 250, 251, 252, 254, 255, 259, 262, 292, 293, 294, 295, 297, 299, 308, 309, 312, 320, 323, 325], "instead": [0, 2, 4, 5, 8, 9, 10, 21, 22, 23, 50, 51, 52, 82, 88, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 132, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 307, 309, 323, 324, 325], "i": [0, 4, 5, 6, 7, 10, 13, 14, 20, 21, 22, 23, 24, 30, 31, 32, 33, 35, 37, 40, 42, 43, 49, 50, 51, 52, 53, 59, 60, 61, 62, 64, 65, 66, 67, 69, 72, 73, 74, 75, 76, 77, 82, 84, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 103, 105, 106, 107, 109, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 131, 132, 135, 136, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 158, 159, 163, 165, 166, 167, 168, 169, 172, 173, 174, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 201, 205, 206, 211, 217, 218, 219, 221, 222, 223, 224, 225, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 243, 247, 248, 253, 258, 259, 260, 262, 263, 264, 265, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 285, 289, 290, 292, 296, 302, 303, 304, 309, 311, 315, 316, 317, 319, 323], "list": [0, 1, 4, 5, 6, 9, 10, 12, 21, 22, 23, 24, 30, 31, 34, 40, 41, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 77, 81, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 107, 108, 109, 113, 114, 115, 116, 117, 118, 119, 120, 126, 127, 128, 129, 135, 137, 138, 139, 140, 141, 151, 152, 153, 158, 159, 160, 161, 163, 165, 166, 167, 168, 169, 173, 176, 177, 180, 182, 184, 185, 186, 187, 188, 189, 195, 196, 197, 202, 203, 204, 205, 211, 212, 218, 222, 225, 227, 228, 229, 230, 231, 232, 233, 237, 238, 239, 244, 245, 246, 247, 253, 254, 259, 262, 265, 267, 269, 270, 271, 272, 273, 274, 279, 280, 281, 286, 287, 288, 289, 296, 297, 306, 323, 324, 325], "perform": [0, 2, 4, 5, 6, 9, 10, 11, 22, 24, 31, 51, 53, 60, 65, 99, 102, 108, 118, 125, 152, 159, 160, 162, 163, 187, 193, 211, 213, 231, 236, 253, 255, 272, 292, 296, 323], "classmethod": [0, 10, 83, 89, 130, 131, 132, 198, 240, 282, 310], "import_pipelin": [0, 10, 324], "genericpipelin": [0, 10, 83, 89, 310], "import": [0, 5, 6, 7, 9, 10, 12, 14, 18, 25, 35, 38, 41, 43, 47, 54, 67, 70, 83, 84, 89, 90, 102, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 262, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 306, 307, 308, 310, 311, 315, 316, 317, 318, 321, 322], "from": [0, 1, 2, 4, 5, 6, 8, 9, 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 30, 31, 33, 35, 37, 38, 40, 41, 43, 45, 47, 48, 49, 50, 51, 52, 53, 54, 59, 60, 62, 64, 65, 66, 67, 69, 70, 72, 76, 77, 83, 84, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 109, 110, 113, 115, 116, 117, 118, 119, 120, 121, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 146, 147, 149, 150, 154, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 253, 254, 255, 256, 257, 258, 259, 260, 261, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 276, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 296, 297, 299, 300, 301, 302, 304, 305, 306, 307, 308, 310, 311, 315, 316, 317, 318, 321, 322, 323], "name": [0, 1, 2, 4, 5, 8, 10, 12, 15, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 41, 44, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 83, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 102, 103, 104, 105, 106, 107, 108, 111, 112, 113, 114, 115, 116, 118, 119, 120, 122, 124, 125, 126, 127, 128, 129, 130, 131, 132, 135, 137, 138, 139, 140, 141, 143, 145, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 172, 173, 174, 176, 177, 178, 179, 182, 184, 185, 187, 188, 189, 190, 192, 193, 195, 196, 197, 198, 202, 203, 204, 205, 206, 208, 209, 210, 211, 212, 213, 217, 218, 219, 221, 222, 223, 224, 227, 228, 229, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 244, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 258, 259, 260, 262, 263, 264, 267, 268, 269, 270, 272, 273, 274, 275, 276, 279, 280, 281, 282, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 297, 299, 302, 303, 304, 307, 310, 315, 316, 320, 323, 325], "contain": [0, 2, 4, 5, 10, 28, 29, 57, 58, 73, 74, 83, 89, 92, 93, 94, 95, 97, 98, 99, 101, 103, 105, 110, 111, 112, 115, 131, 132, 134, 141, 142, 143, 144, 145, 146, 147, 148, 149, 161, 162, 164, 165, 166, 172, 177, 178, 181, 184, 200, 212, 213, 214, 217, 222, 223, 226, 228, 242, 254, 255, 258, 262, 263, 266, 269, 284, 292, 297, 298, 299, 302, 310, 312, 315, 316, 317, 323, 324, 325], "param": [0, 10, 22, 23, 24, 51, 52, 53, 65, 93, 105, 106, 107, 118, 119, 124, 135, 140, 145, 148, 151, 176, 178, 179, 187, 188, 192, 205, 221, 223, 224, 231, 232, 235, 247, 263, 264, 272, 273, 289, 306, 307, 315, 316, 317, 320, 321, 322], "remove_last_funct": [0, 10, 324], "remov": [0, 9, 10, 16, 19, 20, 32, 45, 48, 49, 61, 84, 90, 103, 120, 121, 122, 123, 124, 125, 137, 138, 139, 140, 177, 189, 190, 192, 193, 194, 202, 203, 204, 205, 222, 233, 234, 235, 236, 244, 245, 246, 247, 262, 274, 275, 277, 278, 286, 287, 288, 289, 311, 324, 325], "last": [0, 10, 84, 90, 122, 126, 137, 138, 139, 140, 159, 171, 190, 195, 202, 203, 204, 205, 211, 216, 234, 237, 244, 245, 246, 247, 253, 257, 275, 279, 286, 287, 288, 289, 296, 301, 311, 323, 324, 325], "wa": [0, 2, 5, 7, 9, 10, 84, 90, 100, 101, 103, 125, 132, 193, 236, 278, 311, 323, 324, 325], "ad": [0, 8, 10, 84, 90, 140, 143, 151, 205, 247, 289, 307, 308, 311, 323, 324, 325], "place": [0, 2, 5, 6, 10, 84, 90, 110, 134, 159, 160, 181, 200, 211, 226, 242, 253, 266, 284, 296, 308, 311, 324, 325], "exampl": [0, 1, 2, 5, 6, 7, 8, 10, 12, 14, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 41, 43, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 75, 76, 77, 84, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 106, 107, 108, 109, 110, 111, 112, 114, 115, 116, 117, 118, 119, 121, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 146, 147, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 179, 180, 181, 183, 184, 185, 186, 187, 188, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 224, 225, 226, 228, 229, 230, 231, 232, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 264, 265, 266, 268, 269, 270, 271, 272, 273, 276, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 306, 307, 308, 311, 315, 316, 317, 318, 321, 322, 324, 325], "pipe": [0, 10, 84, 90, 306, 307, 308, 311, 324], "add_funct": [0, 10, 84, 90, 308, 311, 324], "filter_missing_valu": [0, 5, 10, 84, 90, 307, 308, 311, 324], "singleendpipelin": [0, 5], "abc": 0, "_merge_kallisto_output": 0, "output_fold": [0, 5, 10, 81, 87, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 111, 112, 324], "output": [0, 2, 4, 5, 10, 21, 22, 23, 34, 50, 51, 52, 63, 91, 92, 97, 98, 100, 101, 109, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 147, 150, 168, 169, 172, 177, 180, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 222, 225, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 265, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 308, 323], "merg": [0, 1, 10, 99, 166, 167, 323, 324, 325], "csv": [0, 2, 4, 5, 10, 11, 12, 14, 24, 30, 31, 40, 41, 43, 53, 59, 60, 64, 65, 66, 72, 97, 98, 102, 103, 106, 109, 110, 111, 112, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 155, 157, 159, 161, 162, 164, 170, 171, 172, 173, 175, 177, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 208, 210, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 250, 252, 253, 254, 255, 256, 257, 258, 259, 261, 262, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 293, 295, 296, 297, 299, 300, 301, 302, 305, 308, 320, 323], "transcript": [0, 5, 7, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 94, 95, 97, 98, 105, 115, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 174, 178, 184, 187, 188, 196, 197, 202, 203, 204, 205, 219, 223, 228, 231, 232, 238, 239, 244, 245, 246, 247, 260, 263, 269, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324], "estim": [0, 5, 9, 10, 97, 98, 167, 168, 169, 323, 324, 325], "tpm": [0, 5, 10, 97, 98, 123, 148, 158, 164, 323, 324], "bowtie2_align_paired_end": [0, 324], "r1_file": [0, 81, 91, 97, 100, 324], "r2_file": [0, 81, 91, 97, 100, 324], "index_fil": [0, 91, 92, 97, 98, 324], "bowtie2_installation_fold": [0, 91, 92, 93], "liter": [0, 10, 14, 21, 22, 23, 24, 30, 31, 37, 40, 43, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 104, 105, 106, 107, 108, 110, 111, 112, 114, 115, 116, 117, 118, 119, 122, 124, 127, 128, 134, 135, 136, 137, 138, 139, 140, 143, 145, 148, 150, 151, 152, 153, 157, 158, 161, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 176, 178, 179, 181, 184, 185, 186, 187, 188, 190, 191, 192, 196, 197, 200, 201, 202, 203, 204, 205, 206, 210, 212, 215, 217, 218, 219, 220, 221, 223, 224, 226, 228, 229, 230, 231, 232, 234, 235, 238, 239, 242, 243, 244, 245, 246, 247, 248, 252, 254, 256, 258, 259, 260, 261, 263, 264, 266, 269, 270, 271, 272, 273, 275, 276, 280, 281, 284, 285, 286, 287, 288, 289, 290, 295, 297, 300, 302, 303, 304, 305], "auto": [0, 5, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 104, 107, 108, 111, 112, 114, 118, 119, 127, 128, 135, 137, 138, 139, 140, 143, 151, 152, 158, 167, 168, 169, 174, 176, 187, 188, 196, 197, 202, 203, 204, 205, 219, 221, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "new_sample_nam": [0, 91, 92, 94, 95, 97, 98, 99, 323], "mode": [0, 2, 5, 10, 21, 22, 23, 50, 51, 52, 91, 92, 99, 117, 118, 119, 158, 186, 187, 188, 221, 230, 231, 232, 271, 272, 273, 324], "end": [0, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 126, 159, 172, 195, 211, 217, 237, 253, 258, 279, 296, 302, 323, 325], "local": [0, 1, 2, 10, 91, 92, 319, 323], "settings_preset": [0, 91, 92], "veri": [0, 2, 91, 92, 323, 324, 325], "fast": [0, 9, 91, 92], "sensit": [0, 91, 92, 324, 325], "ignore_qu": [0, 91, 92], "bool": [0, 10, 21, 22, 23, 24, 30, 31, 37, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 130, 131, 132, 134, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 158, 159, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 198, 200, 202, 203, 204, 205, 206, 211, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 242, 244, 245, 246, 247, 248, 253, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 282, 284, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 308], "fals": [0, 2, 5, 10, 21, 22, 23, 24, 30, 31, 37, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 158, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 198, 200, 201, 202, 203, 204, 205, 206, 207, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 243, 244, 245, 246, 247, 248, 249, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 282, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303, 304, 307, 308, 323, 324, 325], "quality_score_typ": [0, 91, 92], "phred33": [0, 91, 92], "phred64": [0, 91, 92], "solexa": [0, 91, 92], "qual": [0, 91, 92], "int": [0, 5, 10, 22, 23, 24, 30, 31, 40, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 118, 119, 126, 127, 128, 133, 137, 138, 139, 140, 141, 152, 158, 160, 163, 165, 166, 167, 168, 169, 171, 172, 183, 187, 188, 195, 196, 197, 199, 202, 203, 204, 205, 216, 217, 231, 232, 237, 238, 239, 241, 244, 245, 246, 247, 257, 258, 268, 272, 273, 279, 280, 281, 283, 286, 287, 288, 289, 292, 301, 302], "mate_orient": [0, 91], "fwd": [0, 91], "rev": [0, 91, 93], "min_fragment_length": [0, 91, 94], "nonnegativeint": [0, 10, 91, 92, 93, 94, 100, 101, 126, 141, 168, 169, 195, 237, 279], "0": [0, 2, 6, 7, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 106, 109, 116, 125, 133, 136, 140, 141, 143, 144, 158, 159, 162, 163, 165, 166, 179, 180, 183, 185, 193, 194, 199, 201, 205, 211, 213, 221, 224, 225, 229, 236, 241, 243, 247, 253, 255, 262, 264, 265, 268, 270, 278, 283, 285, 289, 292, 296, 298, 299, 307, 315, 316, 323, 324, 325], "max_fragment_length": [0, 91, 94], "positiveint": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 133, 152, 160, 163, 165, 166, 167, 168, 169, 171, 199, 216, 241, 257, 283, 292, 301], "500": [0, 91, 324], "allow_individual_align": [0, 91], "true": [0, 5, 10, 21, 22, 23, 24, 27, 30, 31, 37, 40, 50, 51, 52, 53, 56, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 131, 132, 134, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 158, 159, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 200, 202, 203, 204, 205, 206, 211, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 242, 244, 245, 246, 247, 248, 253, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 284, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 307, 308, 323, 324, 325], "allow_disconcordant_align": [0, 91], "random_se": [0, 5, 10, 24, 30, 40, 53, 59, 72, 91, 92, 93, 168, 169, 292, 323, 324, 325], "thread": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 93, 94, 95, 99, 165, 166, 167, 168, 169], "1": [0, 2, 9, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 64, 65, 66, 72, 73, 77, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 106, 107, 109, 111, 112, 114, 124, 125, 133, 136, 140, 141, 143, 144, 151, 158, 159, 162, 163, 165, 166, 171, 173, 176, 179, 180, 183, 192, 193, 194, 199, 201, 205, 211, 213, 216, 218, 221, 224, 225, 235, 236, 241, 243, 247, 253, 255, 257, 259, 264, 265, 268, 278, 283, 285, 289, 292, 296, 298, 301, 303, 307, 315, 324, 325], "pair": [0, 5, 10, 91, 92, 94, 97, 98, 99, 100, 137, 138, 139, 140, 151, 152, 165, 167, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 325], "read": [0, 2, 5, 9, 10, 21, 22, 24, 50, 51, 53, 65, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 107, 111, 112, 114, 117, 118, 123, 132, 139, 140, 141, 143, 144, 145, 146, 147, 148, 149, 153, 158, 164, 165, 176, 186, 187, 204, 205, 230, 231, 246, 247, 271, 272, 288, 289, 312, 325], "individu": [0, 2, 10, 91, 92, 97, 98, 105, 111, 112, 115, 131, 132, 135, 178, 184, 223, 228, 263, 269, 323, 324, 325], "sam": [0, 91, 92, 94, 95, 324, 325], "folder": [0, 2, 5, 10, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 111, 112, 131, 132, 323], "you": [0, 1, 2, 4, 5, 6, 7, 9, 10, 24, 37, 53, 69, 75, 91, 92, 94, 95, 97, 98, 99, 100, 102, 105, 111, 112, 115, 139, 140, 141, 142, 143, 144, 158, 160, 163, 165, 174, 178, 184, 204, 205, 219, 221, 223, 228, 246, 247, 260, 263, 269, 288, 289, 304, 321, 322, 323, 324, 325], "can": [0, 4, 5, 6, 7, 8, 10, 11, 21, 22, 23, 24, 34, 37, 41, 50, 51, 52, 53, 63, 69, 91, 92, 93, 94, 95, 96, 97, 98, 102, 103, 107, 110, 112, 114, 117, 118, 119, 131, 132, 134, 137, 138, 139, 140, 151, 152, 153, 158, 160, 163, 165, 174, 176, 177, 181, 186, 187, 188, 200, 202, 203, 204, 205, 219, 221, 226, 230, 231, 232, 242, 244, 245, 246, 247, 260, 266, 271, 272, 273, 284, 286, 287, 288, 289, 304, 306, 307, 315, 316, 317, 323, 324, 325], "more": [0, 1, 4, 5, 6, 7, 10, 21, 22, 23, 24, 50, 51, 52, 53, 65, 76, 91, 92, 93, 94, 95, 97, 98, 99, 102, 109, 117, 118, 119, 139, 140, 151, 165, 166, 180, 186, 187, 188, 204, 205, 225, 230, 231, 232, 246, 247, 265, 271, 272, 273, 288, 289, 323, 324, 325], "about": [0, 1, 4, 5, 8, 10, 21, 22, 24, 50, 51, 53, 65, 91, 92, 100, 105, 106, 115, 116, 117, 118, 139, 140, 141, 147, 162, 165, 177, 178, 179, 184, 185, 186, 187, 204, 205, 213, 223, 224, 228, 229, 230, 231, 246, 247, 255, 262, 263, 264, 269, 270, 271, 272, 288, 289, 298, 323, 324, 325], "how": [0, 5, 6, 10, 24, 30, 40, 53, 59, 72, 91, 92, 99, 100, 126, 137, 138, 139, 140, 195, 202, 203, 204, 205, 237, 244, 245, 246, 247, 279, 286, 287, 288, 289, 292, 323, 324, 325], "work": [0, 1, 5, 6, 7, 91, 92, 99, 323], "manual": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 91, 92, 97, 98, 292, 324, 325], "exist": [0, 5, 10, 25, 38, 54, 70, 91, 92, 97, 98, 99, 100, 101, 110, 134, 170, 175, 181, 200, 215, 220, 226, 242, 256, 261, 266, 284, 300, 305, 323, 325], "your": [0, 1, 2, 4, 5, 6, 7, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 76, 77, 91, 93, 96, 97, 100, 101, 102, 105, 112, 115, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 165, 178, 184, 187, 188, 196, 197, 202, 203, 204, 205, 223, 228, 231, 232, 238, 239, 244, 245, 246, 247, 263, 269, 272, 273, 280, 281, 286, 287, 288, 289, 323], "should": [0, 1, 5, 7, 10, 75, 91, 92, 94, 95, 97, 98, 99, 100, 103, 104, 105, 109, 111, 112, 115, 121, 123, 141, 143, 145, 148, 160, 163, 165, 173, 177, 178, 180, 184, 218, 223, 225, 228, 259, 262, 263, 265, 269, 323, 324, 325], "sort": [0, 5, 6, 10, 41, 64, 65, 66, 91, 97, 100, 126, 154, 160, 195, 207, 237, 249, 279, 291, 307, 308, 323, 324, 325], "tandem": [0, 91, 97, 100], "thei": [0, 1, 2, 5, 10, 37, 69, 91, 94, 95, 97, 98, 99, 100, 102, 107, 114, 129, 136, 137, 138, 139, 140, 141, 143, 151, 152, 153, 158, 165, 174, 176, 191, 201, 202, 203, 204, 205, 219, 243, 244, 245, 246, 247, 260, 276, 285, 286, 287, 288, 289, 304, 308, 323, 324, 325], "line": [0, 2, 5, 9, 91, 97, 99, 100, 323, 324, 325], "up": [0, 1, 5, 6, 7, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 64, 65, 66, 72, 91, 97, 98, 100, 118, 183, 187, 221, 231, 268, 272, 323, 324, 325], "form": [0, 4, 5, 10, 91, 97, 100, 105, 106, 178, 179, 223, 224, 263, 264, 324], "r1": [0, 10, 91, 97, 100, 140, 205, 247, 289], "r2": [0, 91, 97, 100], "2": [0, 2, 6, 9, 10, 76, 77, 91, 92, 93, 94, 95, 97, 99, 100, 108, 109, 110, 111, 112, 124, 133, 134, 136, 140, 150, 152, 159, 161, 163, 165, 171, 180, 181, 183, 191, 192, 199, 200, 201, 205, 206, 211, 212, 214, 216, 225, 226, 235, 241, 242, 243, 247, 248, 253, 254, 257, 265, 266, 268, 283, 284, 285, 289, 290, 292, 296, 297, 301, 315, 324, 325], "an": [0, 1, 4, 5, 6, 9, 10, 13, 20, 21, 23, 24, 31, 32, 33, 40, 42, 49, 50, 52, 53, 60, 61, 62, 64, 65, 72, 73, 74, 76, 77, 91, 92, 96, 97, 98, 99, 100, 101, 105, 107, 111, 112, 114, 115, 117, 119, 131, 132, 135, 137, 138, 139, 140, 141, 143, 151, 152, 153, 166, 167, 168, 169, 176, 178, 184, 186, 188, 202, 203, 204, 205, 222, 223, 228, 230, 232, 244, 245, 246, 247, 263, 269, 271, 273, 286, 287, 288, 289, 323], "which": [0, 1, 2, 5, 7, 8, 10, 18, 21, 22, 23, 24, 25, 30, 31, 35, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 73, 76, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 105, 106, 109, 111, 112, 115, 116, 117, 118, 119, 122, 123, 125, 126, 131, 132, 143, 144, 147, 149, 160, 162, 163, 164, 165, 166, 167, 173, 177, 178, 179, 180, 184, 185, 186, 187, 188, 190, 191, 193, 194, 195, 213, 218, 222, 223, 224, 225, 228, 229, 230, 231, 232, 234, 236, 237, 255, 259, 262, 263, 264, 265, 269, 270, 271, 272, 273, 275, 276, 279, 292, 306, 323], "well": [0, 2, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 105, 106, 111, 112, 137, 138, 139, 140, 178, 179, 202, 203, 204, 205, 223, 224, 244, 245, 246, 247, 263, 264, 286, 287, 288, 289, 323, 324, 325], "log": [0, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 108, 111, 112, 142, 173, 218, 259, 303, 323, 324, 325], "pre": [0, 2, 9, 10, 91, 92, 93, 96, 97, 98, 99, 103, 149, 323], "built": [0, 5, 91, 92, 93, 96, 97, 98, 324, 325], "index": [0, 5, 6, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 91, 92, 93, 94, 95, 96, 97, 98, 99, 120, 122, 141, 189, 190, 233, 234, 274, 275, 317, 323], "target": [0, 10, 91, 92, 93, 96, 97, 98, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 324], "genom": [0, 1, 4, 9, 10, 11, 12, 21, 22, 23, 24, 30, 31, 37, 40, 41, 50, 51, 52, 53, 59, 60, 65, 66, 69, 72, 75, 91, 92, 93, 94, 95, 99, 103, 117, 118, 119, 127, 128, 137, 138, 139, 140, 174, 186, 187, 188, 196, 197, 202, 203, 204, 205, 219, 230, 231, 232, 238, 239, 244, 245, 246, 247, 260, 271, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 312, 323, 324, 325], "either": [0, 5, 8, 9, 10, 24, 30, 31, 35, 40, 53, 59, 60, 64, 65, 66, 67, 72, 73, 76, 77, 91, 92, 97, 98, 100, 101, 117, 134, 170, 186, 200, 215, 230, 242, 256, 271, 284, 300, 323, 324, 325], "download": [0, 2, 5, 7, 91, 92, 93, 96, 97, 98, 323, 324], "websit": [0, 1, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 91, 92, 93, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "menu": [0, 2, 5, 8, 91, 92, 93, 323, 324, 325], "right": [0, 5, 7, 8, 91, 92, 93, 323, 324, 325], "fasta": [0, 91, 92, 93, 96, 97, 98, 99, 323, 324], "bowtie2_create_index": [0, 91, 92, 324], "note": [0, 5, 10, 24, 30, 40, 53, 59, 72, 91, 92, 97, 98, 132, 323, 324, 325], "indic": [0, 5, 10, 18, 21, 22, 23, 24, 25, 30, 31, 35, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 73, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 103, 107, 110, 114, 115, 116, 117, 118, 119, 134, 136, 143, 154, 158, 170, 175, 176, 177, 181, 183, 184, 185, 186, 187, 188, 200, 201, 207, 215, 220, 221, 222, 226, 228, 229, 230, 231, 232, 242, 243, 249, 256, 261, 262, 266, 268, 269, 270, 271, 272, 273, 284, 285, 291, 292, 300, 305, 312, 315, 316, 317, 323, 325], "compos": [0, 91, 92], "multipl": [0, 5, 6, 10, 18, 21, 22, 23, 24, 25, 30, 31, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 70, 72, 76, 91, 92, 107, 114, 117, 118, 119, 126, 129, 151, 152, 153, 159, 161, 165, 166, 167, 168, 169, 175, 176, 186, 187, 188, 195, 211, 212, 220, 230, 231, 232, 237, 253, 254, 261, 271, 272, 273, 279, 296, 297, 305, 323], "bt2": [0, 91, 92, 93, 324], "suffix": [0, 2, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 91, 92, 93, 96, 99, 131, 132, 157, 210, 252, 292, 295], "all": [0, 1, 5, 7, 8, 9, 10, 16, 19, 21, 22, 23, 24, 25, 30, 31, 37, 38, 40, 41, 45, 48, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 69, 70, 72, 73, 76, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 107, 108, 109, 111, 112, 114, 115, 116, 117, 118, 119, 121, 122, 123, 124, 125, 127, 128, 131, 132, 134, 135, 137, 138, 139, 140, 141, 143, 144, 145, 148, 151, 152, 153, 162, 164, 165, 166, 167, 168, 169, 173, 174, 176, 177, 180, 183, 184, 185, 186, 187, 188, 190, 192, 193, 194, 196, 197, 200, 202, 203, 204, 205, 213, 218, 219, 222, 225, 228, 229, 230, 231, 232, 234, 235, 236, 238, 239, 242, 244, 245, 246, 247, 255, 259, 260, 262, 265, 268, 269, 270, 271, 272, 273, 275, 277, 278, 280, 281, 284, 286, 287, 288, 289, 298, 304, 307, 308, 323, 324, 325], "same": [0, 4, 5, 6, 10, 77, 91, 92, 93, 94, 96, 97, 98, 103, 104, 107, 114, 126, 127, 128, 135, 141, 151, 152, 153, 159, 161, 165, 166, 167, 168, 169, 176, 177, 195, 196, 197, 211, 212, 222, 237, 238, 239, 253, 254, 279, 280, 281, 296, 297, 323, 324, 325], "locat": [0, 5, 91, 92, 323, 324, 325], "It": [0, 5, 10, 91, 92, 107, 114, 176, 323, 324, 325], "enough": [0, 91, 92, 323, 325], "specifi": [0, 1, 5, 8, 10, 21, 22, 23, 24, 30, 31, 34, 40, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 74, 75, 91, 92, 93, 94, 95, 100, 101, 103, 107, 111, 112, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 131, 132, 143, 145, 148, 150, 151, 152, 153, 158, 159, 161, 162, 163, 164, 165, 167, 172, 173, 176, 177, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 211, 212, 213, 217, 218, 222, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 253, 254, 255, 258, 259, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 292, 296, 297, 298, 302, 303, 320, 323, 324, 325], "one": [0, 2, 5, 6, 7, 10, 21, 22, 23, 31, 37, 38, 50, 51, 52, 60, 69, 70, 76, 91, 92, 94, 95, 99, 100, 103, 111, 112, 117, 118, 119, 123, 152, 161, 162, 164, 167, 168, 169, 170, 174, 175, 186, 187, 188, 212, 213, 215, 219, 220, 230, 231, 232, 254, 255, 256, 260, 261, 271, 272, 273, 297, 298, 300, 304, 305, 323, 324, 325], "main": [0, 5, 91, 92, 323, 324, 325], "default": [0, 1, 2, 4, 5, 10, 14, 21, 22, 23, 24, 30, 31, 37, 40, 43, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 300, 301, 302, 303, 304, 305, 306, 308, 323], "instal": [0, 1, 5, 6, 8, 10, 91, 92, 93, 94, 95, 96, 97, 98, 99, 111, 112, 323, 324, 325], "For": [0, 1, 2, 4, 7, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 108, 109, 111, 112, 118, 119, 125, 127, 128, 137, 138, 139, 140, 151, 163, 165, 166, 167, 169, 174, 180, 183, 187, 188, 193, 196, 197, 202, 203, 204, 205, 219, 225, 231, 232, 236, 238, 239, 244, 245, 246, 247, 260, 265, 268, 272, 273, 278, 280, 281, 286, 287, 288, 289, 292, 304, 307, 323, 324, 325], "c": [0, 2, 7, 9, 10, 23, 24, 30, 31, 40, 52, 53, 59, 60, 64, 65, 66, 72, 91, 92, 93, 94, 95, 96, 97, 98, 111, 112, 119, 121, 123, 129, 131, 132, 140, 141, 142, 143, 144, 146, 147, 149, 164, 188, 205, 232, 247, 273, 289, 292, 323, 325], "program": [0, 2, 6, 7, 10, 91, 92, 93, 94, 95, 96, 97, 98, 111, 112, 323, 324, 325], "5": [0, 2, 6, 7, 10, 91, 92, 93, 99, 100, 101, 109, 121, 123, 125, 133, 136, 140, 143, 163, 164, 165, 171, 172, 180, 193, 199, 201, 205, 216, 217, 225, 236, 241, 243, 247, 257, 258, 265, 278, 283, 285, 289, 292, 301, 302, 307, 316, 317, 323, 324, 325], "set": [0, 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 102, 103, 108, 110, 116, 134, 136, 140, 143, 167, 170, 175, 177, 181, 185, 200, 201, 205, 215, 220, 222, 226, 229, 242, 243, 247, 256, 261, 262, 266, 270, 284, 285, 289, 292, 300, 305, 312, 315, 316, 317, 318, 319, 321, 322], "attempt": [0, 2, 5, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 91, 92, 93, 96, 97, 98, 99, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "find": [0, 2, 5, 9, 10, 91, 92, 93, 96, 97, 98, 99, 127, 128, 163, 165, 166, 196, 197, 238, 239, 280, 281, 323, 324, 325], "automat": [0, 5, 6, 7, 8, 9, 10, 37, 69, 73, 91, 92, 93, 94, 95, 96, 97, 98, 99, 103, 104, 107, 108, 114, 129, 132, 135, 143, 151, 152, 155, 156, 157, 158, 165, 166, 167, 168, 169, 174, 176, 177, 208, 209, 210, 219, 221, 222, 250, 251, 252, 260, 262, 293, 294, 295, 304, 323, 324, 325], "give": [0, 1, 5, 10, 91, 92, 94, 95, 97, 98, 99, 129, 143, 323], "new": [0, 1, 2, 6, 10, 15, 18, 21, 22, 23, 25, 35, 37, 38, 44, 47, 50, 51, 52, 54, 67, 69, 70, 91, 92, 94, 95, 97, 98, 99, 102, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 129, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 161, 162, 164, 165, 166, 167, 168, 169, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 212, 213, 214, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 254, 255, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 292, 297, 299, 302, 303, 304, 308, 323], "each": [0, 2, 4, 5, 10, 24, 30, 31, 40, 53, 59, 60, 72, 76, 91, 92, 94, 95, 97, 98, 99, 100, 101, 104, 105, 106, 111, 112, 122, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 152, 153, 160, 161, 163, 165, 166, 167, 168, 169, 177, 178, 179, 190, 202, 203, 204, 205, 212, 223, 224, 234, 244, 245, 246, 247, 254, 263, 264, 275, 286, 287, 288, 289, 297, 323, 324, 325], "quantifi": [0, 91, 92, 94, 95, 97, 98, 99, 324], "sampl": [0, 1, 5, 9, 10, 31, 60, 91, 92, 94, 95, 97, 98, 99, 104, 107, 108, 111, 112, 114, 123, 141, 142, 143, 144, 149, 151, 152, 153, 158, 164, 166, 176, 323, 324, 325], "If": [0, 1, 2, 7, 8, 9, 10, 21, 22, 23, 24, 30, 31, 33, 37, 40, 50, 51, 52, 53, 59, 60, 62, 64, 65, 66, 69, 72, 73, 76, 91, 92, 94, 95, 97, 98, 99, 104, 107, 108, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 155, 156, 157, 158, 159, 160, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 176, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 215, 217, 218, 219, 220, 221, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 256, 258, 259, 260, 261, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 300, 302, 303, 304, 305, 308, 323, 324, 325], "sample_nam": [0, 10, 91, 92, 94, 95, 97, 98, 99, 108], "otherwis": [0, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 73, 91, 92, 94, 95, 97, 98, 99, 100, 101, 105, 106, 135, 137, 138, 139, 140, 145, 148, 153, 159, 160, 165, 166, 167, 168, 169, 174, 178, 179, 202, 203, 204, 205, 211, 219, 223, 224, 244, 245, 246, 247, 253, 260, 263, 264, 286, 287, 288, 289, 296, 304, 308, 323, 324, 325], "order": [0, 2, 4, 5, 8, 10, 31, 40, 60, 64, 72, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 103, 121, 123, 126, 148, 154, 159, 160, 161, 164, 195, 207, 211, 212, 237, 249, 253, 254, 279, 291, 296, 297, 307, 323, 324, 325], "match": [0, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 91, 92, 94, 95, 97, 98, 99, 100, 101, 104, 105, 115, 116, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 161, 178, 184, 185, 187, 188, 196, 197, 202, 203, 204, 205, 212, 223, 228, 229, 231, 232, 238, 239, 244, 245, 246, 247, 254, 263, 269, 270, 272, 273, 280, 281, 286, 287, 288, 289, 297, 323, 324, 325], "determin": [0, 5, 9, 10, 14, 22, 24, 30, 31, 37, 40, 43, 51, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 93, 98, 99, 100, 105, 106, 107, 108, 114, 115, 116, 118, 122, 135, 136, 145, 148, 151, 152, 158, 165, 166, 167, 168, 169, 174, 176, 178, 179, 184, 185, 187, 190, 194, 201, 219, 221, 223, 224, 228, 229, 231, 234, 243, 260, 263, 264, 269, 270, 272, 275, 285, 304, 308, 323, 324, 325], "look": [0, 1, 2, 5, 6, 91, 92, 97, 98, 323, 324, 325], "involv": [0, 91, 92], "charact": [0, 5, 10, 91, 92, 99, 315, 316], "allow": [0, 1, 2, 5, 9, 10, 91, 92, 94, 95, 100, 101, 102, 165, 323, 324, 325], "clip": [0, 91, 92], "nucleotid": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 91, 92, 99, 100, 101, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "both": [0, 1, 4, 5, 7, 10, 24, 30, 35, 40, 53, 59, 64, 65, 66, 67, 72, 91, 92, 94, 100, 107, 114, 117, 137, 138, 139, 140, 151, 165, 170, 176, 186, 202, 203, 204, 205, 215, 230, 244, 245, 246, 247, 256, 271, 286, 287, 288, 289, 300, 323, 324, 325], "side": [0, 91, 92, 323, 325], "maxim": [0, 91, 92, 324, 325], "score": [0, 10, 24, 30, 40, 53, 59, 72, 73, 74, 91, 92, 94, 95, 100, 101, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289, 292, 323, 324, 325], "preset": [0, 91, 92], "higher": [0, 10, 91, 92, 166, 292, 323, 324, 325], "accur": [0, 1, 5, 91, 92, 324, 325], "take": [0, 5, 7, 9, 10, 76, 91, 92, 140, 165, 205, 247, 289, 323, 324, 325], "longer": [0, 5, 91, 92, 94], "calcul": [0, 5, 10, 18, 24, 25, 30, 31, 35, 38, 40, 47, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 91, 92, 110, 129, 134, 136, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 165, 166, 167, 168, 169, 170, 175, 181, 200, 201, 205, 215, 220, 226, 242, 243, 247, 256, 261, 262, 266, 284, 285, 289, 292, 300, 305, 323], "ignor": [0, 10, 91, 92, 145, 148, 299, 324, 325], "qualiti": [0, 5, 91, 92, 94, 95, 100, 101, 324, 325], "treat": [0, 10, 91, 92, 99, 112], "them": [0, 1, 2, 5, 8, 10, 12, 24, 30, 40, 41, 53, 59, 64, 65, 66, 72, 91, 92, 94, 100, 111, 112, 131, 132, 158, 221, 323, 324, 325], "maximum": [0, 10, 91, 92, 94, 100, 101, 164, 167, 168, 169, 324], "encod": [0, 5, 91, 92], "most": [0, 1, 4, 5, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "modern": [0, 91, 92], "setup": [0, 1, 2, 5, 7, 10, 91, 92, 165, 323], "phred": [0, 91, 92], "33": [0, 10, 91, 92, 109, 140, 180, 205, 225, 247, 265, 289], "minimum": [0, 10, 64, 65, 66, 91, 94, 95, 99, 100, 101, 140, 152, 165, 166, 205, 247, 289, 323, 324, 325], "fragment": [0, 91, 94, 95, 98, 323, 324], "length": [0, 10, 91, 94, 96, 98, 126, 145, 148, 159, 195, 211, 237, 253, 279, 296, 323, 324, 325], "valid": [0, 10, 65, 66, 91, 94, 99, 103, 140, 177, 205, 247, 262, 289, 323, 324, 325], "seed": [0, 10, 24, 53, 91, 92, 93, 168, 169, 323, 324, 325], "pseudo": [0, 10, 91, 92, 93, 140, 142, 205, 247, 289], "random": [0, 5, 7, 10, 24, 30, 40, 53, 59, 72, 91, 92, 93, 99, 112, 137, 138, 139, 140, 168, 169, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 292, 323, 325], "number": [0, 4, 5, 9, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 105, 106, 118, 119, 123, 127, 128, 133, 137, 138, 139, 140, 141, 144, 150, 152, 164, 165, 166, 167, 168, 169, 171, 172, 174, 178, 179, 187, 188, 196, 197, 199, 202, 203, 204, 205, 206, 216, 217, 219, 223, 224, 231, 232, 238, 239, 241, 244, 245, 246, 247, 248, 257, 258, 260, 263, 264, 272, 273, 280, 281, 283, 286, 287, 288, 289, 290, 292, 301, 302, 304, 323, 324, 325], "run": [0, 1, 4, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 93, 94, 95, 99, 100, 101, 102, 111, 112, 165, 166, 167, 168, 169, 292, 324, 325], "build": [0, 9, 10, 91, 92, 93, 94, 95, 96, 99, 111, 112, 325], "make": [0, 1, 2, 5, 6, 7, 9, 10, 91, 92, 93, 94, 95, 99, 168, 169, 323, 324, 325], "faster": [0, 5, 8, 91, 92, 93, 94, 95, 99], "bowtie2_align_single_end": [0, 324], "fastq_fold": [0, 92, 98, 99, 101, 324], "singl": [0, 1, 2, 4, 5, 7, 9, 10, 92, 95, 98, 99, 100, 101, 107, 108, 112, 114, 131, 132, 151, 160, 167, 168, 169, 176, 262, 323], "want": [0, 1, 7, 10, 75, 92, 94, 95, 98, 99, 323, 324, 325], "genome_fasta": [0, 93, 99, 324], "index_nam": [0, 93], "bowti": [0, 9, 93], "first": [0, 5, 7, 10, 18, 47, 76, 77, 93, 94, 97, 98, 100, 110, 111, 112, 122, 126, 133, 134, 137, 138, 139, 140, 141, 142, 143, 144, 148, 152, 158, 159, 162, 164, 170, 181, 190, 195, 199, 200, 202, 203, 204, 205, 211, 213, 214, 215, 226, 234, 237, 241, 242, 244, 245, 246, 247, 253, 255, 256, 262, 266, 275, 279, 283, 284, 286, 287, 288, 289, 296, 298, 299, 300, 307, 323, 324, 325], "Be": [0, 93, 96], "awar": [0, 93, 96], "popular": [0, 93, 96, 323], "model": [0, 5, 9, 10, 93, 96, 97, 98, 112, 323, 324, 325], "organ": [0, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 93, 96, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "These": [0, 5, 10, 11, 93, 94, 95, 96, 99, 323, 324, 325], "basenam": [0, 93], "creat": [0, 1, 5, 6, 9, 10, 93, 158, 165, 221, 308], "3": [0, 1, 2, 9, 10, 77, 93, 99, 100, 101, 106, 109, 117, 124, 133, 136, 140, 143, 152, 165, 168, 169, 171, 179, 180, 186, 191, 192, 199, 201, 205, 216, 224, 225, 230, 235, 241, 243, 247, 257, 264, 265, 271, 283, 285, 289, 301, 308, 315, 323, 324, 325], "4": [0, 6, 10, 77, 93, 94, 95, 99, 111, 112, 121, 133, 140, 159, 171, 194, 199, 205, 211, 216, 241, 247, 253, 257, 268, 283, 289, 296, 301, 315, 316, 324, 325], "stem": [0, 93], "suppli": [0, 5, 10, 76, 77, 93, 99, 105, 106, 111, 112, 115, 116, 165, 173, 178, 179, 184, 185, 218, 223, 224, 228, 229, 259, 263, 264, 269, 270, 303, 323, 324, 325], "fa": [0, 10, 93, 140, 205, 247, 289], "gz": [0, 93], "featurecounts_paired_end": [0, 5, 324], "input_fold": [0, 87, 94, 95, 324], "gtf_file": [0, 10, 94, 95, 97, 98, 145, 148, 324], "gtf_feature_typ": [0, 94, 95, 324], "exon": [0, 10, 94, 95, 145, 148, 324], "gtf_attr_nam": [0, 94, 95, 324], "gene_id": [0, 94, 95], "r_installation_fold": [0, 10, 94, 95, 111, 112], "strand": [0, 94, 95, 97, 98, 99, 323], "forward": [0, 5, 94, 95, 97, 98, 323], "revers": [0, 5, 94, 95, 97, 98, 323], "min_mapping_qu": [0, 94, 95], "count_multi_mapping_read": [0, 94, 95], "count_multi_overlapping_read": [0, 94, 95], "ignore_secondari": [0, 94, 95], "count_fraction": [0, 94, 95], "is_long_read": [0, 94, 95], "require_both_map": [0, 94], "count_chimeric_frag": [0, 94], "50": [0, 9, 10, 31, 60, 94, 109, 140, 165, 168, 180, 205, 225, 247, 265, 289, 323, 324], "600": [0, 94], "report_read_assign": [0, 5, 94, 95], "bam": [0, 94, 95, 99, 324, 325], "core": [0, 10, 94, 95, 100, 101, 166], "countfilt": [0, 4, 5, 10, 12, 41, 94, 95, 97, 98, 181, 215, 226, 256, 266, 278, 300, 306, 308, 325], "datafram": [0, 5, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 64, 65, 66, 72, 94, 95, 103, 105, 106, 109, 125, 127, 128, 130, 131, 132, 133, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 162, 171, 177, 178, 179, 180, 193, 196, 197, 198, 199, 202, 203, 204, 205, 213, 216, 222, 223, 224, 225, 236, 238, 239, 240, 241, 244, 245, 246, 247, 255, 257, 262, 263, 264, 265, 280, 281, 282, 283, 286, 287, 288, 289, 292, 301, 320, 324, 325], "assign": [0, 10, 94, 95, 166, 324], "map": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 94, 95, 97, 98, 99, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "rsubread": [0, 94, 95, 324], "matrix": [0, 5, 10, 94, 95, 103, 104, 111, 112, 141, 142, 143, 144, 145, 146, 147, 148, 165, 323, 324], "input": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 72, 94, 95, 107, 108, 114, 127, 128, 131, 132, 137, 138, 139, 140, 151, 152, 153, 155, 156, 157, 176, 196, 197, 202, 203, 204, 205, 208, 209, 210, 238, 239, 244, 245, 246, 247, 250, 251, 252, 280, 281, 286, 287, 288, 289, 293, 294, 295, 323, 324, 325], "summar": [0, 10, 94, 95, 97, 98, 109, 180, 225, 265, 323, 324], "were": [0, 2, 5, 10, 94, 95, 102, 103, 125, 139, 161, 165, 166, 177, 193, 204, 212, 222, 236, 246, 254, 262, 288, 297, 323, 324, 325], "statist": [0, 1, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 94, 95, 97, 98, 105, 106, 109, 165, 166, 167, 168, 169, 178, 179, 180, 223, 224, 225, 262, 263, 264, 265, 323], "quantfi": [0, 94, 95], "r": [0, 5, 7, 9, 10, 73, 74, 75, 77, 94, 95, 97, 98, 111, 112, 140, 142, 143, 144, 151, 205, 247, 289, 323, 324, 325], "script": [0, 1, 2, 5, 10, 94, 111, 112], "gtf": [0, 5, 10, 94, 95, 97, 98, 105, 115, 145, 148, 178, 184, 223, 228, 263, 269, 323, 324], "annot": [0, 1, 2, 5, 9, 10, 22, 23, 24, 30, 40, 51, 52, 53, 59, 64, 65, 66, 72, 94, 95, 97, 98, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 158, 187, 188, 196, 197, 202, 203, 204, 205, 221, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "thi": [0, 1, 2, 4, 5, 7, 9, 10, 11, 13, 16, 18, 19, 24, 25, 28, 29, 30, 35, 38, 40, 42, 45, 47, 48, 53, 54, 57, 58, 59, 64, 65, 66, 67, 70, 72, 76, 94, 95, 97, 98, 99, 100, 101, 102, 103, 107, 111, 112, 114, 126, 132, 137, 138, 139, 140, 141, 142, 143, 144, 145, 148, 159, 160, 163, 165, 167, 176, 195, 202, 203, 204, 205, 211, 237, 244, 245, 246, 247, 253, 262, 279, 286, 287, 288, 289, 296, 312, 319, 323, 324, 325], "chromosom": [0, 94, 95, 324], "ones": [0, 10, 30, 40, 59, 64, 72, 94, 95, 97, 98, 145, 148], "select": [0, 2, 5, 8, 10, 94, 95, 166, 323, 324, 325], "row": [0, 1, 4, 5, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 94, 95, 103, 105, 106, 115, 116, 117, 120, 121, 122, 123, 124, 125, 126, 133, 137, 138, 139, 140, 150, 159, 171, 172, 174, 177, 178, 179, 183, 184, 185, 186, 189, 190, 191, 192, 193, 194, 195, 199, 202, 203, 204, 205, 206, 211, 216, 217, 219, 222, 223, 224, 228, 229, 230, 233, 234, 235, 236, 237, 241, 244, 245, 246, 247, 248, 253, 257, 258, 260, 262, 263, 264, 268, 269, 270, 271, 274, 275, 276, 277, 279, 283, 286, 287, 288, 289, 290, 292, 296, 301, 302, 304, 323, 324, 325], "attribut": [0, 4, 5, 9, 10, 11, 21, 22, 23, 31, 40, 50, 51, 52, 60, 64, 65, 66, 72, 76, 77, 94, 95, 103, 105, 115, 117, 118, 119, 161, 177, 178, 184, 186, 187, 188, 212, 222, 223, 228, 230, 231, 232, 254, 262, 263, 269, 271, 272, 273, 297, 306, 318, 321], "group": [0, 5, 8, 10, 94, 95, 103, 104, 107, 114, 122, 140, 141, 151, 152, 153, 165, 176, 190, 205, 234, 247, 275, 289, 292, 323, 324, 325], "eg": [0, 94, 95], "meta": [0, 94, 95], "gene": [0, 1, 2, 4, 5, 6, 9, 10, 11, 12, 14, 22, 23, 24, 30, 31, 37, 40, 41, 43, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 94, 95, 97, 98, 103, 104, 105, 106, 115, 118, 119, 127, 128, 137, 138, 139, 140, 141, 142, 143, 144, 145, 148, 153, 158, 160, 163, 165, 166, 174, 177, 178, 179, 184, 187, 188, 194, 196, 197, 202, 203, 204, 205, 219, 221, 223, 224, 228, 231, 232, 238, 239, 244, 245, 246, 247, 260, 262, 263, 264, 269, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 315], "stranded": [0, 94, 95, 97, 98], "data": [0, 1, 4, 5, 6, 9, 10, 73, 94, 95, 97, 98, 99, 102, 105, 106, 115, 116, 131, 132, 137, 138, 139, 140, 151, 152, 153, 155, 156, 157, 158, 160, 163, 165, 166, 167, 168, 169, 173, 178, 179, 184, 185, 202, 203, 204, 205, 208, 209, 210, 218, 221, 223, 224, 228, 229, 244, 245, 246, 247, 250, 251, 252, 259, 263, 264, 269, 270, 286, 287, 288, 289, 293, 294, 295, 303], "where": [0, 2, 4, 5, 8, 10, 21, 22, 23, 31, 50, 51, 52, 60, 76, 77, 94, 95, 97, 98, 99, 117, 118, 119, 158, 163, 186, 187, 188, 230, 231, 232, 271, 272, 273, 320, 323, 324, 325], "must": [0, 10, 33, 62, 65, 66, 94, 95, 99, 100, 101, 107, 111, 112, 114, 126, 141, 151, 152, 153, 159, 165, 167, 176, 195, 211, 237, 253, 279, 296, 308, 324, 325], "satisfi": [0, 94, 95], "least": [0, 5, 7, 10, 21, 22, 23, 38, 50, 51, 52, 65, 66, 70, 94, 99, 100, 111, 112, 117, 118, 119, 123, 136, 139, 164, 165, 175, 186, 187, 188, 201, 204, 220, 230, 231, 232, 243, 246, 261, 271, 272, 273, 285, 288, 305, 323, 324, 325], "criteria": [0, 94, 100, 325], "multi": [0, 94, 95, 99], "nh": [0, 94, 95], "tag": [0, 1, 94, 95], "than": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 72, 94, 95, 100, 101, 143, 150, 183, 206, 248, 268, 290, 292, 307, 323, 324, 325], "found": [0, 5, 10, 94, 95, 100, 101, 122, 137, 138, 139, 140, 165, 166, 190, 202, 203, 204, 205, 234, 244, 245, 246, 247, 275, 286, 287, 288, 289, 323, 324, 325], "overlap": [0, 10, 31, 60, 94, 95, 99, 145, 148, 162, 164, 165, 166, 167, 168, 169, 213, 214, 255, 298, 299, 323, 324, 325], "onli": [0, 4, 5, 7, 10, 21, 22, 23, 24, 30, 31, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 94, 95, 99, 100, 101, 110, 112, 116, 117, 118, 119, 123, 125, 126, 127, 133, 134, 136, 137, 139, 140, 150, 161, 164, 167, 172, 181, 183, 185, 186, 187, 188, 191, 193, 194, 195, 196, 199, 200, 201, 202, 204, 205, 206, 212, 214, 217, 226, 229, 230, 231, 232, 236, 237, 238, 241, 242, 243, 244, 246, 247, 248, 254, 258, 266, 268, 270, 271, 272, 273, 276, 279, 280, 283, 284, 285, 286, 288, 289, 290, 292, 297, 299, 302, 323, 324, 325], "primari": [0, 94, 95, 323, 325], "secondari": [0, 94, 95, 99], "identifi": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 94, 95, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324], "bit": [0, 1, 94, 95, 323], "0x100": [0, 94, 95], "flag": [0, 10, 94, 95, 139, 204, 246, 288], "field": [0, 10, 94, 95, 165, 323, 325], "dataset": [0, 5, 8, 10, 76, 94, 95, 109, 151, 180, 225, 265], "matter": [0, 94, 95, 323, 324, 325], "fraction": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 94, 95, 99, 100, 101, 125, 140, 143, 144, 158, 162, 163, 165, 193, 194, 205, 213, 221, 236, 247, 255, 278, 289, 292, 298, 323], "produc": [0, 94, 95, 98, 324], "long": [0, 5, 10, 94, 95, 105, 106, 178, 179, 223, 224, 263, 264, 323, 324, 325], "nanopor": [0, 94, 95], "pacbio": [0, 94, 95], "detail": [0, 1, 4, 94, 95, 323, 324], "three": [0, 5, 10, 94, 95, 97, 98, 111, 112, 323, 324, 325], "requir": [0, 7, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 94, 97, 98, 99, 100, 140, 205, 247, 289, 292, 323, 324, 325], "successfulli": [0, 2, 5, 94, 323], "befor": [0, 1, 2, 5, 10, 94, 148, 323, 325], "whether": [0, 1, 5, 10, 28, 29, 57, 58, 94, 99, 100, 103, 105, 115, 165, 178, 184, 223, 228, 263, 269, 292, 308, 323, 324, 325], "chimer": [0, 94, 324], "ha": [0, 2, 5, 10, 13, 42, 94, 99, 140, 164, 205, 214, 247, 289, 299, 323, 324, 325], "its": [0, 4, 8, 10, 94, 97, 98, 102, 135, 145, 148, 153, 158, 161, 165, 166, 167, 168, 169, 212, 221, 254, 297, 323, 324, 325], "two": [0, 1, 2, 4, 5, 7, 9, 10, 27, 35, 56, 67, 94, 111, 112, 131, 132, 136, 162, 164, 183, 191, 201, 213, 214, 243, 255, 262, 268, 276, 285, 298, 299, 323, 324, 325], "differ": [0, 1, 4, 5, 6, 10, 35, 36, 67, 68, 94, 97, 98, 137, 138, 139, 140, 149, 152, 165, 168, 169, 170, 202, 203, 204, 205, 215, 244, 245, 246, 247, 256, 286, 287, 288, 289, 292, 300, 323, 324, 325], "shorter": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 94, 100, 101, 165, 166, 167, 168, 169, 323, 324], "pd": [0, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 94, 95, 140, 205, 247, 289], "featurecounts_single_end": [0, 5, 324], "alphabet": [0, 5, 10, 95, 103], "directori": [0, 2, 5, 7, 10, 95, 111, 112, 320, 324, 325], "kallisto_create_index": [0, 97, 98, 324], "transcriptome_fasta": [0, 96], "kallisto_installation_fold": [0, 96, 97, 98, 324], "kmer_length": [0, 96, 324], "31": [0, 6, 9, 10, 96, 140, 205, 247, 289, 324], "make_uniqu": [0, 5, 96, 324], "transcriptom": [0, 1, 96, 97, 98, 323, 324, 325], "idx": [0, 96, 324], "site": [0, 5, 96, 97, 98, 324, 325], "desir": [0, 8, 96, 323], "odd": [0, 96, 324], "between": [0, 2, 4, 5, 6, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 96, 99, 100, 101, 109, 125, 129, 134, 136, 140, 141, 142, 143, 144, 151, 152, 158, 162, 163, 165, 166, 167, 169, 175, 180, 183, 191, 193, 194, 200, 201, 205, 213, 220, 221, 225, 236, 242, 243, 247, 255, 261, 262, 265, 268, 276, 278, 284, 285, 289, 292, 298, 305, 324, 325], "k": [0, 5, 9, 10, 96, 140, 165, 168, 169, 205, 247, 289], "mer": [0, 96, 324], "replac": [0, 5, 96, 324, 325], "repeat": [0, 10, 96, 165, 323, 324], "uniqu": [0, 10, 96, 99, 127, 131, 132, 137, 138, 139, 140, 196, 202, 203, 204, 205, 238, 244, 245, 246, 247, 280, 286, 287, 288, 289], "kallisto_quantify_paired_end": [0, 324], "bootstrap_sampl": [0, 97, 98], "legacy_arg": [0, 97, 98], "abund": [0, 97, 98, 99, 323, 324], "mrna": [0, 5, 97, 98, 323], "own": [0, 10, 76, 77, 97, 98, 135, 153, 165, 166, 167, 168, 169, 323, 324, 325], "sub": [0, 5, 97, 98, 323, 324, 325], "alongsid": [0, 5, 97, 98, 323, 324], "per": [0, 1, 5, 10, 74, 75, 97, 98, 99, 103, 105, 106, 112, 132, 141, 145, 146, 147, 148, 153, 167, 168, 169, 178, 179, 223, 224, 263, 264, 323, 324, 325], "tabl": [0, 1, 4, 5, 9, 10, 21, 23, 24, 30, 31, 37, 40, 50, 52, 53, 59, 60, 64, 69, 72, 73, 74, 76, 77, 97, 98, 103, 105, 106, 111, 112, 113, 115, 116, 117, 119, 120, 131, 132, 137, 138, 139, 140, 147, 149, 157, 160, 161, 163, 174, 177, 178, 179, 182, 184, 185, 186, 188, 189, 202, 203, 204, 205, 210, 212, 219, 222, 223, 224, 227, 228, 229, 230, 232, 233, 244, 245, 246, 247, 252, 254, 260, 262, 263, 264, 267, 269, 270, 271, 273, 274, 286, 287, 288, 289, 295, 297, 298, 304, 312, 318, 321, 322, 323], "scale": [0, 1, 5, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 97, 98, 107, 114, 141, 142, 143, 144, 145, 146, 147, 148, 149, 176, 323, 324, 325], "scaledtpm": [0, 97, 98, 323, 324], "librari": [0, 2, 5, 10, 97, 98, 99, 103, 147, 149, 323, 324], "size": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 76, 77, 97, 98, 99, 107, 108, 114, 135, 151, 152, 158, 165, 166, 176, 221, 292, 323, 324, 325], "describ": [0, 7, 9, 10, 97, 98, 99, 105, 106, 115, 127, 128, 137, 138, 139, 140, 178, 179, 184, 196, 197, 202, 203, 204, 205, 223, 224, 228, 238, 239, 244, 245, 246, 247, 263, 264, 269, 280, 281, 286, 287, 288, 289, 323, 324, 325], "soneson": [0, 97, 98, 323, 324], "et": [0, 5, 9, 10, 22, 24, 51, 53, 65, 97, 98, 99, 118, 141, 144, 187, 231, 272, 323, 324], "al": [0, 5, 9, 10, 22, 24, 51, 53, 65, 97, 98, 99, 118, 141, 144, 187, 231, 272, 323, 324], "2015": [0, 5, 9, 97, 98, 323, 324], "tximport": [0, 97, 98, 323, 324], "packag": [0, 2, 5, 6, 9, 97, 98, 106, 179, 224, 264, 323, 324], "consid": [0, 5, 10, 65, 66, 97, 98, 99, 140, 165, 166, 205, 247, 289, 323, 324, 325], "un": [0, 97, 98, 323, 324], "normal": [0, 2, 4, 5, 9, 10, 97, 98, 102, 103, 107, 112, 114, 132, 141, 142, 143, 144, 145, 146, 147, 148, 149, 153, 165, 176, 307, 323], "therefor": [0, 97, 98, 323, 324, 325], "directli": [0, 5, 97, 98, 323, 324, 325], "infer": [0, 5, 97, 98, 99, 323, 324], "deseq2": [0, 2, 4, 5, 7, 9, 10, 97, 98, 111, 142], "onc": [0, 2, 5, 7, 10, 97, 98, 145, 148, 165, 323, 324, 325], "analysi": [0, 1, 4, 5, 6, 7, 9, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 97, 98, 99, 111, 112, 118, 152, 160, 163, 165, 166, 167, 168, 169, 187, 231, 272], "finish": [0, 2, 5, 97, 98, 323, 324], "resid": [0, 97, 98], "within": [0, 5, 7, 10, 97, 98, 104, 127, 128, 141, 142, 144, 196, 197, 238, 239, 280, 281, 323, 324, 325], "itself": [0, 26, 36, 39, 55, 68, 71, 97, 98, 324, 325], "we": [0, 2, 5, 8, 97, 98, 324, 325], "recommend": [0, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 97, 98, 107, 114, 176, 292, 324, 325], "cdna": [0, 97, 98], "sourc": [0, 1, 6, 9, 10, 97, 98, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 323, 325], "pseudoalign": [0, 97, 98, 323, 324], "learn_bia": [0, 5, 97, 98], "learn": [0, 2, 9, 10, 21, 50, 97, 98, 117, 186, 230, 271, 323, 324, 325], "specif": [0, 2, 5, 8, 9, 10, 22, 23, 24, 30, 31, 40, 51, 52, 53, 59, 60, 72, 97, 98, 113, 118, 119, 120, 160, 163, 182, 187, 188, 189, 227, 231, 232, 233, 262, 267, 272, 273, 274, 292, 324, 325], "bia": [0, 97, 98, 324, 325], "correct": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 97, 98], "accordlingli": [0, 97, 98], "support": [0, 1, 4, 5, 8, 9, 10, 24, 30, 40, 53, 59, 72, 97, 98, 99, 165, 166, 167, 169, 262, 307, 323, 324, 325], "version": [0, 1, 5, 7, 10, 97, 98, 99, 111, 112, 165, 323, 324, 325], "beyond": [0, 97, 98], "48": [0, 5, 10, 97, 98, 106, 140, 179, 205, 224, 247, 264, 289, 324], "seek_fusion_gen": [0, 5, 97, 98], "doe": [0, 5, 10, 20, 21, 22, 23, 24, 30, 40, 49, 50, 51, 52, 53, 59, 64, 65, 66, 72, 97, 98, 117, 118, 119, 131, 132, 165, 166, 167, 168, 169, 186, 187, 188, 230, 231, 232, 262, 271, 272, 273, 323, 324, 325], "addition": [0, 97, 98, 325], "becaus": [0, 97, 98, 323, 324], "potenti": [0, 97, 98, 323, 324, 325], "fusion": [0, 97, 98], "written": [0, 97, 98, 323], "txt": [0, 2, 5, 10, 34, 63, 97, 98, 131, 132], "bootstrap": [0, 97, 98], "affect": [0, 5, 8, 10, 21, 22, 23, 24, 30, 40, 50, 51, 52, 53, 59, 64, 65, 66, 72, 97, 98, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 165, 166, 167, 168, 169, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 302, 303, 304, 323, 324, 325], "valu": [0, 1, 2, 4, 5, 10, 24, 30, 31, 40, 41, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 97, 98, 100, 101, 104, 105, 106, 107, 109, 114, 122, 123, 124, 125, 126, 143, 144, 150, 158, 159, 165, 166, 167, 168, 169, 172, 173, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 206, 211, 217, 218, 221, 223, 224, 225, 234, 235, 236, 237, 248, 253, 258, 259, 262, 263, 264, 265, 275, 276, 277, 278, 279, 290, 292, 296, 302, 303, 307, 323, 324, 325], "addit": [0, 1, 2, 5, 7, 8, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 97, 98, 99, 105, 106, 166, 173, 178, 179, 218, 223, 224, 259, 263, 264, 303, 308, 323, 324, 325], "hdf5": [0, 97, 98], "uncertainti": [0, 97, 98], "express": [0, 2, 4, 5, 6, 8, 9, 10, 41, 97, 98, 102, 104, 111, 112, 123, 141, 142, 143, 144, 153, 164, 165, 166, 167, 168, 169, 177, 315, 316], "level": [0, 2, 10, 41, 97, 98, 99, 100, 101, 111, 112, 164, 323, 324, 325], "sleuth": [0, 97, 98], "downstream": [0, 12, 41, 97, 98, 323, 325], "differenti": [0, 2, 4, 5, 6, 8, 9, 10, 97, 98, 99, 102, 111, 112, 143, 177, 324], "tradit": [0, 97, 98, 323, 324, 325], "edger": [0, 10, 97, 98, 143, 324, 325], "kallisto_quantify_single_end": [0, 324], "average_fragment_length": [0, 98, 324], "float": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 98, 99, 100, 101, 107, 108, 109, 114, 121, 123, 125, 135, 136, 140, 143, 144, 150, 151, 152, 158, 162, 163, 164, 165, 166, 167, 172, 176, 180, 183, 193, 201, 205, 206, 213, 217, 221, 225, 236, 243, 247, 248, 255, 258, 265, 268, 278, 285, 289, 290, 292, 298, 302], "stdev_fragment_length": [0, 98, 324], "averag": [0, 10, 98, 104, 107, 108, 114, 129, 151, 153, 158, 165, 166, 167, 176, 323, 324, 325], "typic": [0, 10, 98, 99, 112], "illumina": [0, 98, 323], "rang": [0, 8, 10, 98, 99, 140, 205, 247, 289, 324], "180": [0, 10, 98, 140, 166, 205, 247, 289], "200bp": [0, 98], "": [0, 1, 2, 5, 8, 9, 10, 12, 18, 22, 24, 25, 38, 47, 51, 53, 54, 65, 70, 76, 77, 98, 99, 103, 109, 111, 112, 118, 140, 141, 142, 143, 144, 147, 155, 156, 157, 165, 177, 180, 187, 205, 208, 209, 210, 222, 225, 231, 247, 250, 251, 252, 262, 265, 272, 289, 293, 294, 295, 323, 324, 325], "best": [0, 1, 2, 6, 10, 98, 99, 168, 169, 324], "instrument": [0, 98], "agil": [0, 98], "bioanalyz": [0, 98], "standard": [0, 5, 10, 98, 152, 153, 173, 218, 259, 303, 323, 324], "deviat": [0, 98, 323, 324], "shortstack_align_smallrna": [0, 5], "shortstack_installation_fold": [0, 99], "known_rna": [0, 99], "trim_adapt": [0, 99], "autotrim": [0, 99], "autotrim_kei": [0, 99], "tcggaccaggcttcattcccc": [0, 99], "multimap_mod": [0, 99], "align_onli": [0, 99], "show_secondary_align": [0, 99], "dicer_min_length": [0, 99], "21": [0, 9, 10, 99, 109, 125, 140, 162, 180, 193, 205, 213, 225, 236, 247, 255, 265, 289, 323, 324, 325], "dicer_max_length": [0, 99], "24": [0, 10, 99, 140, 205, 247, 289], "loci_fil": [0, 99], "locu": [0, 99], "search_microrna": [0, 99], "de": [0, 99, 324, 325], "novo": [0, 99], "known": [0, 99, 323, 324], "strand_cutoff": [0, 99], "8": [0, 2, 6, 9, 10, 99, 117, 133, 140, 171, 186, 199, 205, 216, 230, 241, 247, 257, 271, 276, 283, 289, 299, 301, 317, 323, 324, 325], "min_coverag": [0, 99], "pad": [0, 99], "75": [0, 10, 99, 106, 107, 109, 114, 125, 140, 144, 162, 165, 166, 171, 176, 179, 180, 193, 205, 213, 216, 224, 225, 236, 247, 255, 257, 264, 265, 289, 301, 323, 324, 325], "small": [0, 5, 9, 99, 323, 325], "shortstack": [0, 5, 9, 99], "comput": [0, 1, 2, 5, 8, 9, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 99, 102, 118, 165, 166, 167, 168, 169, 187, 231, 272, 323, 324, 325], "window": [0, 1, 2, 5, 7, 8, 9, 99, 323, 325], "home": [0, 2, 99], "myuser": [0, 99], "anaconda3": [0, 99], "env": [0, 99], "myenv": [0, 99], "bin": [0, 10, 31, 60, 99, 324], "atcguatcgu": [0, 99], "accept": [0, 1, 2, 5, 10, 99, 167, 324, 325], "microrna": [0, 99], "instanc": [0, 10, 21, 22, 23, 50, 51, 52, 73, 99, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 129, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 302, 303, 304], "matur": [0, 99, 324, 325], "mirna": [0, 10, 99, 115, 116, 184, 185, 228, 229, 269, 270, 324], "pull": [0, 6, 99], "http": [0, 1, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "www": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "mirbas": [0, 99], "org": [0, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "increas": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 323, 324, 325], "accuraci": [0, 10, 99, 165, 323, 324, 325], "identif": [0, 99], "untrim": [0, 99, 101], "coordin": [0, 99], "dna": [0, 9, 99, 324], "mir166": [0, 99], "A": [0, 1, 2, 4, 6, 7, 9, 10, 35, 65, 66, 67, 99, 103, 107, 108, 114, 129, 135, 140, 143, 151, 152, 153, 161, 164, 176, 177, 205, 212, 221, 222, 247, 254, 262, 289, 292, 297, 306, 315, 316, 324, 325], "dure": [0, 5, 10, 99, 158, 221, 323, 324, 325], "procedur": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 99, 323], "discov": [0, 5, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 127, 128, 137, 138, 139, 140, 165, 166, 167, 168, 169, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 323, 324, 325], "scan": [0, 99], "begin": [0, 2, 10, 99, 126, 159, 195, 211, 237, 253, 279, 296, 323, 325], "highli": [0, 5, 10, 99, 164, 323, 324], "present": [0, 10, 13, 42, 99, 107, 114, 151, 152, 153, 176, 323], "nearli": [0, 2, 99], "plant": [0, 99], "high": [0, 1, 9, 99, 323, 324], "non": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 99, 127, 137, 138, 139, 140, 143, 162, 164, 165, 166, 167, 168, 169, 191, 196, 202, 203, 204, 205, 213, 214, 221, 238, 244, 245, 246, 247, 255, 276, 280, 286, 287, 288, 289, 298, 299, 323], "experi": [0, 5, 10, 99, 111, 112, 323, 324, 325], "altern": [0, 7, 99, 324, 325], "handl": [0, 10, 99, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "johnson": [0, 99], "2016": [0, 9, 99], "In": [0, 1, 2, 5, 7, 8, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 165, 166, 167, 168, 169, 323, 324, 325], "weight": [0, 9, 10, 22, 24, 51, 53, 65, 77, 99, 108, 118, 141, 143, 187, 231, 272, 324, 325], "scheme": [0, 99], "placement": [0, 99], "termin": [0, 7, 8, 10, 22, 24, 51, 53, 65, 99, 118, 187, 231, 272, 325], "after": [0, 2, 5, 7, 10, 99, 100, 101, 148, 323, 324, 325], "phase": [0, 99], "occur": [0, 5, 99, 100, 101, 324, 325], "retain": [0, 99], "multimap": [0, 99], "possibli": [0, 99, 323], "lot": [0, 99], "posit": [0, 5, 10, 65, 66, 99, 133, 158, 160, 171, 191, 199, 214, 216, 221, 241, 257, 276, 283, 299, 301, 323, 324, 325], "togeth": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 77, 99, 165, 323, 324, 325], "bound": [0, 5, 10, 99, 143], "discrimin": [0, 99], "dicer": [0, 99], "deriv": [0, 10, 99, 167, 324, 325], "loci": [0, 99], "other": [0, 1, 4, 5, 6, 7, 10, 12, 18, 25, 35, 38, 39, 41, 47, 54, 67, 70, 71, 99, 108, 110, 134, 136, 162, 165, 170, 175, 181, 200, 201, 213, 214, 215, 220, 226, 242, 243, 255, 256, 261, 266, 284, 285, 298, 299, 300, 305, 323, 324, 325], "At": [0, 8, 10, 99, 140, 205, 247, 289, 323, 324, 325], "80": [0, 10, 99, 109, 166, 167, 180, 225, 265], "cluster": [0, 5, 7, 8, 9, 10, 99, 108, 140, 165, 166, 167, 168, 169, 205, 247, 289], "maximun": [0, 99], "analyz": [0, 6, 9, 10, 99, 111, 112, 163, 323], "prevent": [0, 5, 99], "discoveri": [0, 5, 99, 324, 325], "gff3": [0, 10, 99, 145, 148], "bed": [0, 99], "simpl": [0, 8, 99], "tab": [0, 2, 5, 6, 99, 323, 325], "delimit": [0, 2, 5, 10, 99, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305], "chr": [0, 99], "start": [0, 5, 10, 99, 172, 217, 258, 302, 324, 325], "stop": [0, 99], "mutual": [0, 99], "exclus": [0, 99, 323, 324, 325], "inclus": [0, 99], "search": [0, 5, 10, 24, 53, 65, 99, 100, 101], "time": [0, 5, 6, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 165, 166, 167, 168, 169, 324, 325], "t": [0, 5, 7, 8, 9, 10, 31, 34, 60, 63, 99, 117, 140, 170, 186, 205, 215, 230, 247, 256, 271, 289, 300, 323, 324, 325], "confin": [0, 99], "queri": [0, 99], "comprehens": [0, 5, 9, 99], "wide": [0, 9, 99, 323, 324, 325], "alreadi": [0, 5, 13, 42, 99, 103, 323, 324, 325], "caution": [0, 99], "point": [0, 1, 5, 10, 99, 158, 166, 167, 169, 221, 323, 324, 325], "cutoff": [0, 5, 10, 65, 66, 99], "standed": [0, 99], "By": [0, 2, 10, 24, 53, 99, 323, 324, 325], "top": [0, 5, 10, 65, 66, 73, 99, 107, 114, 126, 143, 160, 163, 195, 237, 279, 323, 324, 325], "20": [0, 10, 76, 99, 100, 101, 107, 108, 109, 114, 135, 140, 152, 158, 159, 161, 176, 180, 205, 211, 212, 225, 247, 253, 254, 265, 289, 296, 297, 323, 324, 325], "unstrand": [0, 99, 323], "depth": [0, 99, 323], "unit": [0, 10, 99, 153, 323], "million": [0, 5, 10, 99, 112, 132, 145, 146, 147, 148, 153, 323, 324, 325], "nucleat": [0, 99], "initi": [0, 10, 24, 53, 99, 165, 168, 169, 325], "peak": [0, 99, 323], "continu": [0, 99, 324], "region": [0, 5, 10, 99, 145, 148], "exceed": [0, 99], "distanc": [0, 5, 10, 99, 108, 166, 167, 169], "less": [0, 8, 10, 99, 183, 268, 323, 324, 325], "trim_adapters_paired_end": [0, 5, 324], "three_prime_adapters_r1": [0, 100], "three_prime_adapters_r2": [0, 100], "five_prime_adapters_r1": [0, 100], "five_prime_adapters_r2": [0, 100], "any_position_adapters_r1": [0, 100], "any_position_adapters_r2": [0, 100], "quality_trim": [0, 100, 101], "trim_n": [0, 100, 101], "minimum_read_length": [0, 100, 101], "10": [0, 1, 2, 9, 10, 64, 65, 66, 77, 100, 101, 108, 109, 114, 126, 132, 140, 145, 146, 147, 148, 152, 158, 165, 180, 195, 205, 221, 225, 237, 247, 265, 276, 279, 289, 292, 299, 323, 324, 325], "maximum_read_length": [0, 100, 101], "discard_untrimmed_read": [0, 100, 101, 323], "pair_filter_if": [0, 100], "ani": [0, 1, 2, 4, 5, 8, 10, 22, 24, 41, 51, 53, 65, 100, 101, 102, 108, 118, 163, 165, 173, 187, 218, 231, 259, 272, 303, 308, 315, 316, 317, 323, 324, 325], "error_toler": [0, 100, 101], "minimum_overlap": [0, 100, 101], "allow_indel": [0, 100, 101], "parallel": [0, 2, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 100, 101, 165, 166, 167, 168, 169, 323, 325], "gzip_output": [0, 5, 100, 101], "return_new_filenam": [0, 100], "middl": [0, 2, 100, 101, 323], "low": [0, 100, 101, 324, 325], "below": [0, 1, 5, 10, 100, 101, 125, 162, 164, 166, 183, 193, 213, 236, 255, 268, 298, 323, 324, 325], "removem": [0, 100, 101], "flank": [0, 100, 101, 323], "n": [0, 5, 9, 10, 73, 100, 101, 126, 133, 140, 171, 195, 199, 205, 216, 237, 241, 247, 257, 279, 283, 289, 301, 308, 323, 324, 325], "nnacgtacgtnnnn": [0, 100, 101], "down": [0, 5, 10, 100, 101, 183, 221, 268, 323, 324, 325], "acgtacgt": [0, 100, 101], "discard": [0, 5, 10, 100, 101, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323], "alwai": [0, 1, 2, 5, 10, 100, 132, 323, 324, 325], "combin": [0, 10, 22, 24, 51, 53, 65, 100, 118, 131, 132, 165, 187, 231, 272, 323, 324, 325], "decis": [0, 100], "when": [0, 1, 5, 8, 10, 20, 21, 22, 23, 49, 50, 51, 52, 75, 100, 101, 102, 103, 112, 117, 118, 119, 127, 137, 140, 177, 186, 187, 188, 196, 202, 205, 222, 230, 231, 232, 238, 244, 247, 262, 271, 272, 273, 280, 286, 289, 307, 323, 324, 325], "appli": [0, 4, 5, 6, 10, 21, 22, 23, 41, 50, 51, 52, 100, 103, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 217, 218, 219, 222, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 258, 259, 260, 262, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 302, 303, 304, 306, 307, 308], "fulfil": [0, 100], "criterion": [0, 10, 100, 167, 323, 324, 325], "error": [0, 5, 8, 10, 100, 101, 153, 323, 324, 325], "toler": [0, 100, 101], "permit": [0, 100, 101], "lowest": [0, 10, 65, 66, 100, 101, 126, 195, 237, 279, 323], "being": [0, 5, 10, 100, 101, 143, 166, 323, 324, 325], "100": [0, 5, 10, 100, 101, 126, 136, 140, 165, 166, 167, 168, 169, 195, 201, 205, 237, 243, 247, 279, 285, 289, 323, 324, 325], "mismatch": [0, 5, 100, 101], "insert": [0, 100, 101], "delet": [0, 5, 10, 100, 101, 319, 323, 325], "exactli": [0, 1, 10, 35, 67, 100, 101, 111, 112, 145, 148, 170, 215, 256, 262, 300, 317, 323, 324, 325], "avail": [0, 5, 7, 10, 24, 30, 40, 53, 59, 72, 100, 101, 108, 165, 323, 324], "processor": [0, 100, 101], "gzip": [0, 5, 100, 101], "trim_adapters_single_end": [0, 5, 324], "three_prime_adapt": [0, 101, 323], "five_prime_adapt": [0, 101], "any_position_adapt": [0, 101], "intersect": [0, 5, 6, 10, 11, 21, 22, 23, 26, 27, 50, 51, 52, 55, 56, 102, 110, 117, 118, 119, 136, 181, 186, 187, 188, 201, 226, 230, 231, 232, 243, 266, 271, 272, 273, 285, 323], "visual": [0, 2, 4, 5, 6, 7, 9, 10, 11, 102, 152, 165, 166, 167, 168, 169], "tabular": [0, 2, 4, 9, 10, 102, 323, 324], "variou": [0, 4, 5, 8, 10, 12, 41, 102, 103, 177, 323, 324, 325], "oper": [0, 1, 2, 5, 6, 10, 102, 103, 150, 159, 160, 172, 177, 206, 211, 217, 222, 248, 253, 258, 262, 290, 296, 302, 308, 323], "etc": [0, 1, 2, 4, 5, 10, 11, 24, 30, 31, 40, 41, 53, 59, 60, 64, 72, 102, 111, 112, 115, 116, 123, 131, 132, 147, 158, 164, 184, 185, 228, 229, 269, 270, 312, 323, 324, 325], "basic": [0, 2, 4, 5, 7, 10, 102, 323, 324], "exploratori": [0, 9, 10, 102], "analys": [0, 2, 4, 5, 9, 10, 11, 12, 41, 102, 262, 323, 324, 325], "plot": [0, 1, 5, 8, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 102, 107, 108, 114, 135, 151, 152, 153, 158, 165, 166, 167, 168, 169, 176, 221, 307, 323], "pca": [0, 5, 10, 102, 140, 160, 163, 205, 247, 289, 323, 324, 325], "clustergram": [0, 5, 10, 102, 324, 325], "violin": [0, 10, 102, 176], "scatter": [0, 1, 5, 10, 102, 107, 114, 152, 158, 221, 323], "modifi": [0, 1, 5, 8, 10, 102, 103, 159, 160, 165, 177, 211, 222, 253, 262, 296, 323, 324, 325], "easi": [0, 10, 102, 323, 324], "traceback": [0, 10, 102], "fname": [0, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 103, 131, 177, 222, 262, 292, 324], "drop_column": [0, 5, 10, 103, 177, 222], "is_norm": [0, 10, 103, 130, 325], "receiv": [0, 10, 12, 41, 103, 149, 177, 315, 316, 317, 324, 325], "accord": [0, 5, 10, 21, 22, 23, 31, 40, 50, 51, 52, 60, 64, 72, 103, 117, 118, 119, 125, 131, 132, 145, 148, 155, 156, 157, 162, 177, 186, 187, 188, 191, 193, 194, 208, 209, 210, 213, 230, 231, 232, 236, 250, 251, 252, 255, 271, 272, 273, 276, 293, 294, 295, 324, 325], "characterist": [0, 10, 103, 177, 323], "df": [0, 10, 103, 130, 140, 177, 198, 205, 222, 240, 247, 262, 282, 289, 320], "panda": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 103, 105, 106, 109, 133, 171, 177, 178, 179, 180, 199, 216, 222, 223, 224, 225, 241, 257, 262, 263, 264, 265, 283, 292, 301, 320, 324, 325], "content": [0, 10, 103, 177, 222, 262, 323, 324, 325], "upon": [0, 10, 103, 177, 222, 262], "usag": [0, 5, 6, 10, 103, 177, 222, 262, 323, 324], "shape": [0, 10, 103, 109, 177, 180, 222, 225, 262, 265, 324, 325], "column": [0, 1, 2, 4, 5, 10, 21, 50, 73, 74, 76, 77, 103, 104, 105, 106, 109, 111, 112, 113, 117, 123, 124, 125, 126, 129, 133, 135, 141, 143, 145, 146, 147, 148, 149, 150, 159, 162, 171, 172, 173, 177, 178, 179, 180, 182, 186, 192, 193, 195, 199, 206, 211, 213, 216, 217, 218, 222, 223, 224, 225, 227, 230, 235, 236, 237, 241, 248, 253, 255, 257, 258, 259, 262, 263, 264, 265, 267, 271, 279, 283, 290, 292, 296, 301, 302, 323, 324, 325], "dimens": [0, 8, 10, 103, 152, 177, 222, 262, 323], "purpos": [0, 1, 10, 103, 177, 222, 262, 312, 323, 324, 325], "updat": [0, 1, 5, 10, 26, 36, 55, 68, 103, 177, 222, 262, 312, 321, 322, 323, 325], "index_set": [0, 10, 103, 177, 222, 262, 324], "previous": [0, 5, 10, 103, 177, 222, 262, 323, 324, 325], "index_str": [0, 5, 10, 103, 177, 222, 262, 324], "separ": [0, 2, 5, 7, 10, 103, 104, 131, 132, 154, 163, 165, 177, 207, 222, 249, 262, 291, 323, 324, 325], "newlin": [0, 10, 103, 154, 177, 207, 222, 249, 262, 291, 324], "triplic": [0, 10, 103], "nest": [0, 5, 10, 103, 104, 112, 141, 151, 165], "a_rep1": [0, 10, 103], "a_rep2": [0, 10, 103], "a_rep3": [0, 10, 103], "b_rep1": [0, 10, 103], "b_rep2": [0, 10, 103], "_b_rep3": [0, 10, 103], "_avg_subsampl": 0, "sample_group": [0, 10, 104, 141], "groupedcolumn": [0, 10, 104, 107, 114, 141, 151, 152, 153, 165, 176], "mean": [0, 1, 2, 5, 10, 65, 66, 104, 106, 108, 109, 111, 129, 135, 141, 142, 143, 145, 148, 165, 168, 179, 180, 224, 225, 264, 265, 323], "median": [0, 5, 10, 104, 107, 108, 114, 125, 141, 142, 145, 148, 176, 193, 236, 278, 323, 324, 325], "geometric_mean": [0, 10, 104, 145, 148], "new_column_nam": [0, 10, 104], "avarag": 0, "subsampl": 0, "replic": [0, 4, 5, 10, 104, 107, 111, 112, 114, 141, 151, 152, 153, 158, 165, 176, 323, 324, 325], "everi": [0, 1, 4, 5, 10, 21, 22, 23, 50, 51, 52, 65, 66, 117, 118, 119, 152, 158, 165, 186, 187, 188, 230, 231, 232, 271, 272, 273, 292, 323, 324, 325], "member": [0, 10, 20, 33, 49, 62, 166], "pass": [0, 1, 324], "user": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 21, 24, 31, 40, 50, 53, 60, 64, 65, 72, 76, 77, 105, 106, 111, 112, 115, 116, 117, 166, 167, 169, 178, 179, 184, 185, 186, 223, 224, 228, 229, 230, 263, 264, 269, 270, 271, 323], "object": [0, 4, 5, 10, 12, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 38, 40, 41, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 70, 72, 73, 77, 103, 104, 105, 106, 107, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 158, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 312, 320, 325], "To": [0, 2, 7, 8, 9, 10, 21, 22, 24, 50, 51, 53, 65, 107, 111, 112, 114, 117, 118, 141, 142, 143, 144, 151, 152, 153, 165, 176, 186, 187, 230, 231, 271, 272, 323, 324, 325], "condit": [0, 4, 10, 103, 104, 107, 111, 112, 114, 129, 141, 151, 152, 153, 176, 191, 262, 276, 323, 324, 325], "inner": [0, 10, 107, 114, 151, 152, 153, 176], "sample1a": [0, 10, 107, 114, 151, 152, 153, 176], "sample1b": [0, 10, 107, 114, 151, 152, 153, 176], "sample1c": [0, 10, 107, 114, 151, 152, 153, 176], "sample2a": [0, 10, 107, 114, 151, 152, 153, 176], "sample2b": [0, 10, 107, 114, 151, 152, 153, 176], "sample2c": [0, 10, 107, 114, 151, 152, 153, 176], "sample3": [0, 10, 107, 114, 151, 152, 153, 176, 324, 325], "sample6": [0, 10, 107, 114, 151, 152, 153, 176], "follow": [0, 1, 2, 7, 8, 9, 10, 111, 112, 165, 323, 324, 325], "sample1": [0, 10, 158, 324, 325], "sample2": [0, 10, 158, 324, 325], "sample_list": 0, "_from_str": 0, "msg": 0, "split": [0, 4, 5, 10, 161, 162, 163, 164, 165, 166, 167, 168, 169, 212, 213, 214, 254, 255, 297, 298, 299, 307, 323, 324, 325], "promprt": 0, "print": [0, 5, 10, 18, 25, 35, 38, 47, 54, 67, 70, 154, 207, 249, 291, 315, 316, 317, 318, 323, 324], "comma": [0, 2, 5, 7, 10, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305, 323], "seper": [0, 324], "_inplac": 0, "new_df": 0, "opposit": [0, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 148, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 307, 323, 324, 325], "inplac": [0, 5, 10, 21, 22, 23, 37, 50, 51, 52, 69, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 159, 160, 165, 166, 167, 168, 169, 172, 173, 174, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 201, 202, 203, 204, 205, 206, 211, 217, 218, 219, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 243, 244, 245, 246, 247, 248, 253, 258, 259, 260, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 285, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 307, 308, 323, 324, 325], "printout_oper": 0, "filter_update_kwarg": 0, "execut": [0, 7, 8, 324], "choic": [0, 2, 5, 6, 323, 324, 325], "post": [0, 1], "filtrat": 0, "_is_norm": 0, "properti": [0, 10], "_numeric_column": 0, "numer": [0, 5, 10, 111, 112, 129, 262, 268, 276, 282, 292, 299, 323, 324, 325], "_pca_plot": 0, "final_df": 0, "pc1_var": 0, "pc2_var": 0, "label": [0, 5, 10, 73, 74, 75, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221, 325], "titl": [0, 5, 10, 21, 50, 73, 74, 75, 76, 77, 107, 108, 114, 117, 135, 151, 152, 158, 176, 186, 221, 230, 271, 323, 324, 325], "title_fonts": [0, 10, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221], "label_fonts": [0, 10, 107, 114, 135, 151, 152, 158, 176, 221], "tick_fonts": [0, 10, 107, 108, 114, 135, 151, 152, 158, 176, 221], "proportional_ax": [0, 5, 10, 152], "plot_grid": [0, 5, 10, 152], "legend": [0, 5, 10, 152, 325], "figur": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 107, 108, 114, 135, 151, 152, 153, 158, 165, 166, 167, 168, 169, 176, 221, 323, 324, 325], "intern": [0, 323], "varianc": [0, 5, 10, 143, 152, 325], "explain": [0, 1, 5, 10, 152, 323, 324, 325], "pc": [0, 5, 323], "second": [0, 1, 2, 10, 35, 67, 76, 77, 152, 158, 162, 164, 170, 213, 214, 215, 255, 256, 262, 298, 299, 300, 323, 324, 325], "draw": [0, 10, 73, 152, 323, 324, 325], "color": [0, 5, 8, 10, 76, 77, 152, 158, 221, 323, 325], "axi": [0, 5, 10, 31, 60, 73, 74, 75, 107, 114, 135, 151, 152, 153, 158, 176, 221, 324, 325], "_set_op": 0, "return_typ": [0, 10, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305], "op": 0, "symmetr": [0, 5, 10, 35, 36, 67, 68, 170, 215, 256, 300, 324, 325], "symmetric_differ": [0, 10], "_sort": 0, "ascend": [0, 10, 126, 154, 159, 160, 195, 207, 211, 237, 249, 253, 279, 291, 296, 307], "na_posit": [0, 10, 126, 159, 195, 211, 237, 253, 279, 296, 307], "v": [0, 5, 10, 126, 140, 159, 195, 205, 211, 221, 237, 247, 253, 279, 289, 296, 323, 324], "descend": [0, 10, 126, 159, 160, 195, 211, 237, 253, 279, 296], "have": [0, 1, 2, 4, 5, 7, 10, 24, 27, 30, 34, 40, 53, 56, 59, 63, 64, 65, 66, 72, 103, 121, 123, 126, 144, 150, 159, 164, 166, 172, 177, 191, 195, 206, 211, 217, 237, 248, 253, 258, 276, 279, 290, 296, 302, 323, 324, 325], "put": [0, 1, 10, 126, 159, 195, 211, 237, 253, 279, 296], "nan": [0, 5, 10, 109, 124, 126, 159, 180, 192, 195, 211, 225, 235, 237, 253, 265, 279, 296, 323, 324, 325], "copi": [0, 1, 2, 5, 7, 8, 10, 159, 160, 211, 253, 296, 323], "without": [0, 4, 5, 9, 10, 64, 65, 66, 159, 160, 165, 211, 253, 296, 307, 323], "origin": [0, 1, 5, 8, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 110, 116, 117, 121, 123, 124, 125, 126, 132, 134, 137, 138, 139, 140, 150, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 172, 174, 181, 183, 185, 186, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 211, 212, 213, 214, 217, 219, 226, 229, 230, 235, 236, 237, 242, 244, 245, 246, 247, 248, 253, 254, 255, 258, 260, 266, 268, 270, 271, 276, 279, 284, 286, 287, 288, 289, 290, 292, 296, 297, 299, 302, 304, 308, 323, 324, 325], "average_replicate_sampl": [0, 5, 10], "e": [0, 2, 5, 9, 10, 104, 111, 112, 140, 205, 247, 289, 323, 324, 325], "g": [0, 2, 5, 9, 10, 77, 104, 111, 112, 140, 205, 247, 289, 323, 324, 325], "biolog": [0, 8, 10, 41, 104, 323, 324, 325], "technic": [0, 10, 104, 323, 324, 325], "conta": [0, 10, 104, 141], "biotypes_from_gtf": [0, 10], "gtf_path": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "attribute_nam": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "biotyp": [0, 4, 5, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 72, 105, 106, 115, 116, 178, 179, 184, 185, 223, 224, 228, 229, 263, 264, 269, 270, 318, 322], "gene_biotyp": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "transcript_biotyp": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "gene_typ": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "transcript_typ": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "feature_typ": [0, 10, 105, 115, 145, 148, 178, 184, 223, 228, 263, 269], "long_format": [0, 5, 10, 105, 106, 178, 179, 223, 224, 263, 264], "drawn": [0, 10, 24, 31, 40, 53, 60, 64, 65, 72, 76, 77, 105, 106, 115, 116, 178, 179, 184, 185, 223, 224, 228, 229, 263, 264, 269, 270, 323], "transfer": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "id": [0, 2, 4, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 105, 115, 118, 119, 122, 127, 128, 137, 138, 139, 140, 158, 174, 178, 184, 187, 188, 190, 196, 197, 202, 203, 204, 205, 219, 221, 223, 228, 231, 232, 234, 238, 239, 244, 245, 246, 247, 260, 263, 269, 272, 273, 275, 280, 281, 286, 287, 288, 289, 304, 323], "short": [0, 1, 2, 10, 105, 106, 178, 179, 223, 224, 263, 264, 323, 325], "state": [0, 5, 10, 105, 106, 178, 179, 223, 224, 263, 264, 307], "also": [0, 2, 4, 5, 7, 8, 10, 41, 105, 106, 131, 132, 137, 138, 139, 140, 165, 178, 179, 202, 203, 204, 205, 223, 224, 244, 245, 246, 247, 263, 264, 286, 287, 288, 289, 308, 323, 324, 325], "descript": [0, 1, 2, 5, 10, 11, 78, 102, 105, 106, 109, 178, 179, 180, 223, 224, 225, 263, 264, 265, 312, 323, 324, 325], "rtype": [0, 10, 24, 53, 65, 105, 106, 178, 179, 223, 224, 263, 264], "show": [0, 1, 5, 7, 10, 22, 24, 51, 53, 65, 76, 105, 106, 109, 118, 133, 151, 158, 171, 178, 179, 180, 187, 199, 216, 221, 223, 224, 225, 231, 241, 257, 263, 264, 265, 272, 283, 301, 323, 324, 325], "belong": [0, 10, 21, 22, 23, 50, 51, 52, 105, 106, 117, 118, 119, 161, 165, 178, 179, 186, 187, 188, 212, 223, 224, 230, 231, 232, 254, 263, 264, 271, 272, 273, 297, 323, 324, 325], "biotypes_from_ref_t": [0, 4, 5, 10, 324], "ref": [0, 10, 14, 21, 43, 50, 106, 116, 117, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 292, 297, 324], "predefin": [0, 5, 8, 10, 14, 21, 24, 30, 31, 40, 43, 50, 53, 59, 60, 64, 72, 76, 77, 106, 116, 117, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 297, 325], "ce11": [0, 10, 106, 179, 224, 264], "d": [0, 9, 10, 14, 43, 106, 110, 125, 133, 134, 136, 140, 162, 170, 171, 175, 179, 181, 183, 191, 193, 194, 199, 200, 201, 205, 213, 214, 215, 216, 220, 222, 224, 226, 236, 241, 242, 243, 247, 255, 256, 257, 261, 264, 266, 283, 284, 285, 289, 300, 301, 305, 308, 324], "test": [0, 1, 2, 5, 7, 9, 10, 12, 14, 24, 30, 31, 40, 41, 43, 53, 59, 60, 64, 65, 66, 72, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 308, 323], "test_fil": [0, 10, 12, 14, 41, 43, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 308, 324], "test_deseq": [0, 10, 14, 43, 106, 110, 125, 133, 134, 136, 150, 162, 170, 171, 175, 179, 181, 193, 199, 200, 201, 206, 213, 214, 215, 216, 220, 224, 226, 236, 241, 242, 243, 248, 255, 256, 257, 261, 264, 266, 283, 284, 285, 290, 300, 301, 305, 324], "view": [0, 5, 7, 8, 10, 106, 179, 224, 264, 323], "biotype_ref_table_for_test": [0, 10, 14, 43, 106, 116, 179, 185, 224, 229, 264, 270, 292, 324], "protein_cod": [0, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 72, 106, 115, 116, 179, 184, 185, 224, 228, 229, 264, 269, 270, 292, 324, 325], "26": [0, 10, 14, 43, 106, 109, 110, 124, 134, 140, 150, 179, 180, 181, 191, 192, 200, 205, 206, 214, 224, 225, 226, 235, 242, 247, 248, 264, 265, 266, 284, 289, 290, 324], "pseudogen": [0, 4, 10, 14, 43, 106, 115, 116, 179, 184, 185, 224, 228, 229, 264, 269, 270, 324, 325], "unknown": [0, 10, 14, 43, 106, 179, 224, 264, 324], "basemean": [0, 10, 106, 124, 133, 150, 171, 179, 192, 199, 206, 216, 224, 235, 241, 248, 257, 264, 283, 290, 301, 308, 324, 325], "padj": [0, 10, 106, 133, 171, 177, 179, 198, 199, 216, 224, 241, 257, 264, 283, 301, 308, 324, 325], "max": [0, 10, 73, 106, 109, 128, 138, 139, 140, 145, 148, 179, 180, 197, 203, 204, 205, 224, 225, 239, 245, 246, 247, 264, 265, 281, 287, 288, 289, 324], "1823": [0, 10, 106, 179, 224, 264, 324], "089609": [0, 10, 106, 179, 224, 264, 324], "005060e": [0, 10, 106, 179, 224, 264, 324], "90": [0, 10, 106, 109, 140, 171, 179, 180, 205, 216, 224, 225, 247, 257, 264, 265, 289, 301, 324, 325], "9": [0, 6, 9, 10, 106, 109, 116, 133, 140, 171, 179, 180, 185, 199, 205, 216, 224, 225, 229, 241, 247, 257, 264, 265, 270, 283, 289, 292, 301, 315, 316, 323, 324, 325], "290000e": [0, 10, 106, 171, 179, 216, 224, 257, 264, 301, 324], "68": [0, 10, 106, 140, 171, 179, 205, 216, 224, 247, 257, 264, 289, 301, 324], "2688": [0, 10, 106, 179, 224, 264, 324, 325], "043701": [0, 10, 106, 179, 224, 264, 324], "800000e": [0, 10, 106, 133, 179, 199, 224, 241, 264, 283, 324], "94": [0, 9, 10, 106, 140, 171, 179, 205, 216, 224, 247, 257, 264, 289, 301, 324, 325], "2085": [0, 10, 106, 179, 224, 264, 324], "995094": [0, 10, 106, 179, 224, 264, 324], "070000e": [0, 10, 106, 133, 179, 199, 224, 241, 264, 283, 324], "152": [0, 10, 106, 179, 224, 264, 324], "x": [0, 2, 5, 7, 10, 21, 22, 23, 50, 51, 52, 65, 66, 106, 107, 108, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 133, 135, 140, 143, 150, 151, 152, 158, 163, 171, 172, 173, 176, 179, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 199, 205, 206, 216, 217, 218, 221, 224, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 241, 247, 248, 257, 258, 259, 264, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 283, 289, 290, 292, 301, 302, 303, 323, 324, 325], "box_plot": [0, 5, 10], "notch": [0, 10, 107], "ylabel": [0, 10, 73, 74, 75, 107, 114, 158, 176], "log10": [0, 10, 107, 114, 158, 173, 176, 218, 221, 259, 303], "16": [0, 6, 10, 107, 114, 123, 140, 151, 152, 158, 164, 165, 176, 205, 221, 247, 289, 316, 324], "12": [0, 6, 9, 10, 77, 107, 108, 114, 126, 135, 140, 151, 152, 158, 165, 176, 195, 205, 221, 237, 247, 276, 279, 289, 299, 324, 325], "box": [0, 2, 5, 7, 10, 107, 114, 152, 160, 163, 165, 166, 167, 168, 169, 173, 176, 218, 259, 303, 323, 325], "absolut": [0, 10, 107, 114, 132, 176, 183, 221, 268, 323, 324, 325], "25": [0, 6, 10, 64, 65, 66, 107, 109, 114, 124, 125, 140, 176, 180, 192, 193, 194, 205, 225, 235, 236, 247, 265, 289, 308, 324], "percentil": [0, 5, 10, 107, 109, 114, 125, 162, 176, 180, 193, 213, 225, 236, 255, 265, 278, 298, 324], "white": [0, 10, 107, 114, 176], "dot": [0, 10, 74, 75, 107, 114, 158, 176], "add": [0, 1, 5, 8, 10, 77, 107, 114, 307, 323, 325], "confid": [0, 10, 107, 140, 205, 247, 289], "interv": [0, 10, 107], "y": [0, 2, 5, 7, 9, 10, 31, 60, 73, 74, 75, 107, 108, 114, 135, 140, 143, 151, 152, 153, 158, 176, 205, 221, 247, 289, 324, 325], "30": [0, 10, 107, 108, 109, 114, 135, 140, 151, 152, 158, 176, 180, 205, 221, 225, 247, 265, 289], "font": [0, 5, 10, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221], "graph": [0, 2, 5, 6, 10, 24, 30, 53, 59, 65, 66, 73, 74, 75, 107, 108, 114, 135, 151, 152, 158, 176, 221, 323, 324, 325], "15": [0, 9, 10, 107, 109, 114, 117, 135, 140, 151, 152, 158, 159, 161, 165, 176, 180, 186, 205, 211, 212, 221, 225, 230, 247, 253, 254, 265, 271, 289, 296, 297, 324, 325], "tick": [0, 5, 10, 107, 108, 114, 135, 151, 152, 158, 176, 221], "matplotlib": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221, 324, 325], "add_scatt": [0, 10, 107, 114], "columnnam": [0, 10, 108, 113, 124, 125, 126, 129, 135, 143, 150, 158, 162, 172, 173, 182, 192, 193, 195, 206, 213, 217, 218, 227, 235, 236, 237, 248, 255, 258, 259, 267, 279, 290, 302, 307], "metric": [0, 5, 10, 108, 165, 166, 167, 169, 323], "euclidean": [0, 10, 108, 165, 166, 167, 169, 323, 324, 325], "linkag": [0, 10, 108, 165, 167, 323, 324, 325], "complet": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 77, 108, 111, 112, 158, 167, 221, 323, 325], "ward": [0, 10, 108, 165, 167, 323], "centroid": [0, 10, 108, 168, 169], "hierarch": [0, 5, 9, 10, 108, 165, 167, 323], "relev": [0, 5, 10, 108, 323, 324, 325], "condition1_rep1": [0, 10, 108], "condition1_rep2": [0, 10, 108], "condition1_rep3": [0, 10, 108], "condition2_rep1": [0, 10, 108], "condition3_rep1": [0, 10, 108], "condition3_rep2": [0, 10, 108], "ham": [0, 10, 108, 166, 169], "correl": [0, 1, 10, 108, 151, 323, 324, 325], "scipi": [0, 9, 10, 108], "spatial": [0, 10, 108, 323, 324, 325], "pdist": [0, 10, 108], "possibl": [0, 1, 2, 5, 10, 108, 324], "see": [0, 1, 4, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 108, 109, 111, 112, 118, 119, 127, 128, 133, 137, 138, 139, 140, 151, 165, 166, 167, 169, 171, 180, 187, 188, 196, 197, 199, 202, 203, 204, 205, 216, 225, 231, 232, 238, 239, 241, 244, 245, 246, 247, 257, 265, 272, 273, 280, 281, 283, 286, 287, 288, 289, 301, 323, 324, 325], "document": [0, 2, 5, 9, 10, 108, 109, 133, 151, 171, 180, 199, 216, 225, 241, 257, 265, 283, 301, 323, 324, 325], "onlin": [0, 2, 10, 108, 324, 325], "hierarchi": [0, 10, 108, 323, 324, 325], "01": [0, 6, 10, 109, 140, 180, 205, 225, 247, 265, 289], "99": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "central": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "tendenc": [0, 10, 109, 180, 225, 265], "dispers": [0, 9, 10, 109, 180, 225, 265, 323], "distribut": [0, 2, 10, 109, 180, 225, 265, 323, 324, 325], "exclud": [0, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 109, 118, 144, 180, 187, 225, 231, 265, 272, 323, 324, 325], "inform": [0, 2, 4, 5, 8, 10, 109, 141, 147, 151, 180, 225, 265, 323, 324, 325], "fall": [0, 10, 109, 180, 225, 265], "25th": [0, 10, 109, 125, 180, 193, 225, 236, 265], "50th": [0, 10, 109, 180, 225, 265], "75th": [0, 10, 109, 125, 180, 193, 225, 236, 265], "summari": [0, 2, 5, 10, 109, 180, 225, 265, 323, 324, 325], "seri": [0, 4, 5, 6, 10, 109, 180, 225, 262, 265, 324, 325], "numpi": [0, 9, 10, 109, 166, 180, 225, 265, 324], "np": [0, 10, 109, 180, 225, 265], "cond1": [0, 2, 10, 109, 126, 141, 154, 159, 173, 180, 195, 207, 211, 218, 225, 237, 249, 253, 259, 265, 279, 291, 296, 324, 325], "cond2": [0, 2, 10, 109, 126, 141, 159, 180, 195, 211, 225, 237, 253, 265, 279, 296, 324, 325], "cond3": [0, 2, 10, 109, 141, 159, 180, 211, 225, 253, 265, 296, 324, 325], "cond4": [0, 10, 109, 141, 159, 173, 180, 211, 218, 225, 253, 259, 265, 296, 324, 325], "22": [0, 6, 9, 10, 109, 116, 117, 121, 123, 126, 140, 141, 142, 143, 144, 146, 147, 149, 161, 164, 165, 172, 173, 180, 185, 186, 195, 205, 212, 217, 218, 225, 229, 230, 237, 247, 254, 258, 259, 265, 268, 270, 271, 276, 279, 289, 292, 297, 299, 302, 308, 324], "000000": [0, 10, 109, 180, 225, 265], "2515": [0, 10, 109, 180, 225, 265], "590909": [0, 10, 109, 180, 225, 265], "2209": [0, 10, 109, 180, 225, 265], "227273": [0, 10, 109, 180, 225, 265], "4230": [0, 10, 109, 180, 225, 265], "3099": [0, 10, 109, 180, 225, 265], "818182": [0, 10, 109, 180, 225, 265], "std": [0, 10, 109, 180, 225, 265], "4820": [0, 10, 109, 180, 225, 265], "512674": [0, 10, 109, 180, 225, 265], "4134": [0, 10, 109, 180, 225, 265], "948493": [0, 10, 109, 180, 225, 265], "7635": [0, 10, 109, 180, 225, 265], "832664": [0, 10, 109, 180, 225, 265], "5520": [0, 10, 109, 180, 225, 265], "394522": [0, 10, 109, 180, 225, 265], "min": [0, 10, 73, 109, 145, 148, 180, 225, 265], "6": [0, 6, 9, 10, 109, 123, 133, 140, 145, 146, 147, 148, 164, 171, 180, 199, 205, 216, 225, 241, 247, 257, 265, 283, 289, 292, 301, 316, 323, 324, 325], "250000": [0, 10, 109, 180, 225, 265], "57": [0, 10, 109, 140, 159, 166, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "500000": [0, 10, 109, 180, 225, 265], "52": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289, 324, 325], "23": [0, 6, 10, 109, 140, 159, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "2637": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "2479": [0, 10, 109, 180, 225, 265], "6030": [0, 10, 109, 180, 225, 265], "4669": [0, 10, 109, 180, 225, 265], "750000": [0, 10, 109, 180, 225, 265], "15054": [0, 10, 109, 180, 225, 265], "950000": [0, 10, 109, 180, 225, 265], "12714": [0, 10, 109, 180, 225, 265], "290000": [0, 10, 109, 180, 225, 265], "21955": [0, 10, 109, 180, 225, 265], "390000": [0, 10, 109, 180, 225, 265], "15603": [0, 10, 109, 180, 225, 265], "510000": [0, 10, 109, 180, 225, 265], "15056": [0, 10, 109, 180, 225, 265], "12746": [0, 10, 109, 180, 225, 265], "22027": [0, 10, 109, 180, 225, 265], "15639": [0, 10, 109, 180, 225, 265], "decil": [0, 10, 109, 180, 225, 265], "arang": [0, 10, 109, 180, 225, 265], "200000": [0, 10, 109, 180, 225, 265], "400000": [0, 10, 109, 180, 225, 265], "700000": [0, 10, 109, 180, 225, 265], "600000": [0, 10, 109, 180, 225, 265], "40": [0, 10, 109, 140, 165, 167, 180, 205, 225, 247, 265, 289, 324], "28": [0, 6, 10, 109, 110, 124, 125, 134, 140, 150, 162, 180, 181, 183, 192, 193, 200, 205, 206, 213, 214, 225, 226, 235, 236, 242, 247, 248, 255, 265, 266, 284, 289, 290, 308, 324], "800000": [0, 10, 109, 180, 225, 265], "14": [0, 2, 7, 10, 77, 109, 117, 140, 166, 168, 169, 180, 186, 205, 225, 230, 247, 265, 271, 276, 289, 299], "60": [0, 10, 109, 140, 159, 165, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "82": [0, 10, 109, 140, 166, 171, 180, 205, 216, 225, 247, 257, 265, 289, 301, 324, 325], "106": [0, 10, 109, 180, 225, 265], "44": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "70": [0, 10, 109, 140, 171, 180, 205, 216, 225, 247, 257, 265, 289, 301, 324], "484": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "395": [0, 10, 109, 180, 225, 265], "305": [0, 10, 109, 180, 225, 265], "302": [0, 10, 109, 133, 140, 180, 199, 205, 225, 241, 247, 265, 283, 289, 324], "3398": [0, 10, 109, 180, 225, 265], "3172": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "7981": [0, 10, 109, 180, 225, 265], "6213": [0, 10, 109, 180, 225, 265], "8722": [0, 10, 109, 180, 225, 265], "100000": [0, 10, 109, 180, 225, 265], "7941": [0, 10, 109, 180, 225, 265], "16449": [0, 10, 109, 180, 225, 265], "12129": [0, 10, 109, 180, 225, 265], "900000": [0, 10, 109, 180, 225, 265], "keep": [0, 1, 10, 22, 23, 24, 30, 40, 51, 52, 53, 59, 64, 65, 66, 72, 110, 116, 117, 118, 119, 122, 123, 125, 126, 127, 134, 137, 138, 139, 140, 150, 172, 181, 183, 185, 186, 187, 188, 190, 191, 193, 194, 195, 196, 200, 202, 203, 204, 205, 206, 217, 226, 229, 230, 231, 232, 234, 236, 237, 238, 242, 244, 245, 246, 247, 248, 258, 266, 268, 270, 271, 272, 273, 275, 276, 279, 280, 284, 286, 287, 288, 289, 290, 292, 302, 323, 324, 325], "NOT": [0, 10, 18, 47, 110, 132, 170, 181, 215, 226, 256, 266, 300, 324, 325], "done": [0, 1, 2, 5, 10, 21, 22, 23, 37, 50, 51, 52, 69, 110, 117, 118, 119, 134, 165, 174, 181, 186, 187, 188, 200, 219, 226, 230, 231, 232, 242, 260, 266, 271, 272, 273, 284, 304, 323, 324, 325], "wbgene": [0, 5, 10, 110, 136, 170, 175, 181, 201, 215, 220, 226, 243, 256, 261, 266, 285, 300, 305, 315, 316, 317, 325], "deseqfilt": [0, 4, 5, 10, 110, 111, 112, 170, 226, 256, 266, 300, 306, 308], "a_set": [0, 10, 110, 134, 136, 181, 200, 201, 226, 242, 243, 266, 284, 285, 324], "wbgene00000001": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 110, 134, 136, 181, 200, 201, 226, 242, 243, 266, 284, 285, 324, 325], "wbgene00000002": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 110, 133, 134, 136, 170, 175, 181, 199, 200, 201, 215, 220, 226, 241, 242, 243, 256, 261, 266, 283, 284, 285, 300, 305, 324, 325], "wbgene00000003": [0, 10, 18, 25, 38, 47, 54, 70, 110, 133, 134, 136, 170, 175, 181, 199, 200, 201, 215, 220, 226, 241, 242, 243, 256, 261, 266, 283, 284, 285, 300, 305, 324, 325], "wbgene00007063": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007064": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007066": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007067": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007069": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007071": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007074": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007075": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007076": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007077": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007078": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007079": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00014997": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043987": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043988": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043989": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043990": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00044022": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00044951": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077502": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077503": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077504": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "leav": [0, 10, 110, 116, 117, 121, 123, 124, 125, 126, 134, 150, 161, 162, 164, 165, 166, 167, 168, 169, 172, 181, 183, 185, 186, 191, 192, 193, 194, 195, 200, 206, 212, 213, 214, 217, 226, 229, 230, 235, 236, 237, 242, 248, 254, 255, 258, 266, 268, 270, 271, 276, 279, 284, 290, 292, 297, 299, 302, 308, 323, 324, 325], "differential_expression_deseq2": [0, 5, 10], "design_matrix": [0, 10, 111, 112], "comparison": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 111, 112, 292, 323, 324, 325], "iter": [0, 10, 22, 24, 31, 40, 51, 53, 60, 64, 65, 72, 76, 111, 112, 118, 131, 132, 158, 168, 169, 187, 231, 272], "algorithm": [0, 1, 10, 111, 165, 166, 167, 168, 169, 323, 324, 325], "unnorm": [0, 5, 10, 111], "raw": [0, 2, 10, 103, 111, 151, 323, 325], "design": [0, 5, 10, 111, 112, 323, 325], "experiment": [0, 10, 22, 24, 51, 53, 65, 111, 112, 118, 141, 187, 231, 272, 323, 324, 325], "factor": [0, 1, 5, 10, 111, 112, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 205, 247, 289, 324, 325], "guid": [0, 1, 4, 5, 6, 7, 9, 10, 21, 22, 24, 50, 51, 53, 65, 111, 112, 117, 118, 166, 167, 169, 186, 187, 230, 231, 271, 272, 323], "tutori": [0, 2, 5, 6, 7, 9, 10, 111, 112], "formula": [0, 10, 111, 112, 323, 324, 325], "numerator_valu": [0, 10, 111, 112], "denominator_valu": [0, 10, 111, 112], "what": [0, 1, 5, 6, 8, 10, 111, 112, 136, 201, 243, 285, 323], "element": [0, 5, 10, 13, 16, 18, 19, 20, 25, 32, 33, 35, 38, 42, 45, 47, 48, 49, 54, 61, 62, 67, 70, 111, 112, 152, 323], "fold": [0, 2, 4, 5, 9, 10, 41, 73, 74, 75, 111, 112, 129, 177, 183, 191, 214, 221, 262, 268, 276, 292, 299, 323, 325], "chang": [0, 1, 2, 4, 9, 10, 15, 41, 44, 111, 112, 129, 177, 183, 191, 194, 214, 221, 262, 268, 276, 292, 299, 323, 325], "denomin": [0, 5, 10, 111, 112, 129, 262, 268, 276, 282, 292, 299, 323, 324, 325], "differential_expression_limma_voom": [0, 5, 10], "random_effect": [0, 10, 112], "limma": [0, 5, 9, 10, 112, 144, 324, 325], "voom": [0, 5, 9, 10, 112], "effect": [0, 5, 10, 13, 42, 112, 165, 323, 324, 325], "drop": [0, 10, 37, 69, 103, 113, 137, 138, 139, 140, 174, 177, 182, 202, 203, 204, 205, 219, 222, 227, 244, 245, 246, 247, 260, 267, 286, 287, 288, 289, 304, 323, 325], "fro": [0, 10, 113, 182, 227, 267], "mthe": [0, 10, 113, 182, 227, 267], "enhanced_box_plot": [0, 5, 10], "enhanc": [0, 5, 10, 114], "rpm": [0, 10, 114, 123, 132, 146, 147, 158, 164, 324, 325], "filter_biotype_from_gtf": [0, 10], "lincrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270, 324, 325], "ncrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "pirna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270, 324, 325], "rrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "snorna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "snrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "trna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "anyth": [0, 1, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 323], "BUT": [0, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302], "expect": [0, 5, 10, 21, 22, 23, 24, 30, 31, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 292, 302, 323, 324, 325], "filter_biotype_from_ref_t": [0, 4, 5, 10, 292, 324], "defin": [0, 4, 5, 9, 10, 11, 21, 24, 31, 40, 50, 53, 60, 64, 65, 72, 76, 77, 116, 117, 152, 185, 186, 229, 230, 270, 271, 321, 322], "whose": [0, 5, 10, 116, 121, 123, 124, 125, 135, 143, 152, 183, 185, 192, 193, 194, 229, 235, 236, 268, 270, 278, 323, 324, 325], "13": [0, 10, 116, 140, 159, 167, 185, 205, 211, 229, 247, 253, 270, 289, 292, 296, 323, 324, 325], "filter_by_attribut": [0, 4, 5, 10, 292, 324], "attribute1": [0, 10, 117, 161, 186, 212, 230, 254, 271, 292, 297, 324, 325], "attr_ref_table_for_exampl": [0, 10, 117, 161, 186, 212, 230, 254, 271, 292, 297, 324], "7": [0, 1, 2, 6, 9, 10, 117, 125, 133, 140, 161, 162, 165, 186, 193, 199, 205, 212, 213, 230, 236, 241, 247, 254, 255, 271, 283, 289, 292, 297, 323, 324, 325], "OR": [0, 10, 117, 170, 186, 215, 230, 256, 271, 300], "attribute3": [0, 10, 117, 186, 230, 271, 324, 325], "AND": [0, 10, 117, 186, 230, 271], "19": [0, 6, 9, 10, 117, 140, 165, 186, 205, 230, 247, 271, 289, 324, 325], "don": [0, 2, 5, 7, 8, 10, 117, 186, 230, 271, 323, 324, 325], "filter_by_go_annot": [0, 5, 10], "go_id": [0, 10, 22, 51, 118, 187, 231, 272], "arabodopsi": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 187, 188, 231, 232, 272, 273], "thaliana": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "caenorhabd": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324, 325], "elegan": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 325], "danio": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "rerio": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "drosophila": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "melanogast": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "escherichia": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "coli": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "homo": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "sapien": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "mu": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "musculu": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "saccharomyc": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "cerevisia": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "schizosaccharomyc": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "pomb": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "gene_id_typ": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "uniprotkb": [0, 8, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 324, 325], "ac": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniparc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref50": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref90": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref100": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "crc64": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ensembl": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 165, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 324, 325], "protein": [0, 4, 9, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 65, 66, 69, 72, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 324, 325], "geneid": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "kegg": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323], "patric": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ucsc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "wbparasit": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "arachnoserv": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "araport": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "conoserv": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "dictybas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "echobas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "euhcvdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "flybas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genecard": [0, 8, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genereview": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "hgnc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "legiolist": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "leproma": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "maizegdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "mgi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "mim": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "nextprot": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "opentarget": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "orphanet": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pharmgkb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pombas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pseudocap": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "rgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "sgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "tuberculist": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "veupathdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "vgnc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "wormbas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "xenbas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "zfin": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "eggnog": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genetre": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "hogenom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "oma": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323], "orthodb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "treefam": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ccd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "embl": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genbank": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ddbj": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cd": [0, 1, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "gi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pir": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "refseq": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "chitar": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genewiki": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genomernai": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "phi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "collectf": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "biocyc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "plantreactom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "reactom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "unipathwai": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cptac": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "proteomicsdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "propagate_annot": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "evidence_typ": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "phylogenet": [0, 9, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "author": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "curat": [0, 10, 22, 24, 30, 51, 53, 59, 65, 66, 118, 187, 231, 272, 323, 324, 325], "electron": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "excluded_evidence_typ": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "databas": [0, 5, 6, 9, 10, 22, 24, 51, 53, 65, 118, 127, 128, 137, 138, 139, 140, 187, 196, 197, 202, 203, 204, 205, 231, 238, 239, 244, 245, 246, 247, 272, 280, 281, 286, 287, 288, 289], "excluded_databas": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "qualifi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "contributes_to": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "colocalizes_with": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "excluded_qualifi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "go": [0, 1, 2, 5, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 74, 118, 119, 187, 188, 231, 232, 272, 273, 323], "term": [0, 4, 5, 9, 10, 22, 24, 51, 53, 65, 66, 118, 168, 169, 187, 231, 272, 323], "ncbi": [0, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "taxon": [0, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "fetch": [0, 1, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "featureset": [0, 4, 5, 10, 41, 43, 44, 47, 51, 52, 53, 54, 59, 60, 63, 65, 66, 67, 69, 70, 72, 76, 77, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 325], "rnacentr": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "entrez": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "server": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "full": [0, 2, 7, 8, 10, 22, 23, 24, 30, 31, 34, 40, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 103, 118, 119, 127, 128, 131, 132, 137, 138, 139, 140, 166, 167, 169, 177, 187, 188, 196, 197, 202, 203, 204, 205, 222, 231, 232, 238, 239, 244, 245, 246, 247, 262, 272, 273, 280, 281, 286, 287, 288, 289, 292, 320, 323, 324, 325], "legal": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "uniprot": [0, 5, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "help": [0, 1, 2, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 160, 163, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324, 325], "api_idmap": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "propag": [0, 2, 10, 22, 24, 30, 40, 51, 53, 59, 65, 72, 118, 187, 231, 272, 323], "classic": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "dag": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "tree": [0, 10, 22, 24, 51, 53, 65, 118, 166, 187, 231, 272, 323, 324, 325], "root": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "elim": [0, 2, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "node": [0, 2, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "signific": [0, 5, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 64, 65, 66, 72, 73, 118, 187, 194, 221, 231, 272, 292, 323, 324, 325], "manner": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "children": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "rel": [0, 5, 10, 22, 24, 51, 53, 65, 118, 142, 187, 231, 272, 323, 324, 325], "parent": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "allm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "proopag": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "alexa": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "pubm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "nlm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "nih": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "gov": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "16606683": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "m": [0, 1, 5, 7, 9, 10, 22, 24, 51, 53, 65, 118, 140, 143, 187, 205, 231, 247, 272, 289, 324, 325], "evid": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 323], "code": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 65, 72, 118, 187, 231, 272, 292, 323], "categori": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 323, 324, 325], "consortium": [0, 9, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "geneontologi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "doc": [0, 1, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "amigo": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "xref": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "spefici": [0, 5, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "filter_by_kegg_annot": [0, 5, 10], "kegg_id": [0, 10, 23, 52, 119, 188, 232, 273], "pathwai": [0, 5, 9, 10, 23, 30, 52, 59, 66, 75, 119, 188, 232, 273, 323], "would": [0, 1, 2, 4, 5, 10, 23, 52, 119, 188, 232, 273, 323, 324, 325], "cel04020": [0, 10, 23, 52, 119, 188, 232, 273], "calcium": [0, 10, 23, 52, 119, 188, 232, 273], "signal": [0, 10, 23, 52, 119, 188, 232, 273, 323, 324, 325], "filter_by_row_nam": [0, 5, 10], "row_nam": [0, 10, 120, 189, 233, 274], "filter_by_row_sum": [0, 10], "threshold": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 121, 123, 136, 164, 166, 167, 183, 194, 201, 221, 243, 268, 285, 292, 323, 324, 325], "sum": [0, 1, 10, 121, 324, 325], "belov": [0, 10, 121], "minim": [0, 5, 10, 121, 123, 164, 165, 167, 323, 324, 325], "18": [0, 10, 121, 140, 205, 247, 268, 289, 324, 325], "filter_duplicate_id": [0, 5, 10], "neither": [0, 10, 35, 67, 122, 190, 234, 275], "duplic": [0, 5, 10, 122, 190, 234, 275], "filter_low_read": [0, 10, 165, 166, 167, 168, 169, 324], "lowli": [0, 5, 10, 123, 164], "rpkm": [0, 5, 10, 123, 145, 148, 158, 164], "miss": [0, 5, 10, 20, 49, 124, 192, 235, 277, 323, 325], "check": [0, 1, 10, 124, 192, 235, 323], "filt": [0, 10, 124, 150, 172, 173, 192, 206, 217, 218, 235, 248, 258, 259, 290, 302], "test_deseq_with_nan": [0, 10, 124, 192, 235, 308, 324], "filt_no_nan": [0, 10, 124, 192, 235], "filt_no_nan_basemean": [0, 10, 124, 192, 235], "27": [0, 6, 10, 124, 140, 191, 192, 205, 235, 247, 289, 324], "filt_no_nan_basemean_pv": [0, 10, 124, 192, 235], "pval": [0, 10, 124, 192, 235, 292, 324, 325], "filter_percentil": [0, 5, 10, 324], "entri": [0, 1, 10, 76, 77, 125, 152, 193, 236, 278, 324], "abov": [0, 2, 10, 125, 162, 167, 193, 213, 236, 255, 278, 298, 323, 324, 325], "pvalu": [0, 10, 125, 133, 171, 193, 199, 216, 236, 241, 257, 283, 301, 324, 325], "log2foldchang": [0, 10, 125, 133, 162, 171, 177, 191, 193, 198, 199, 213, 214, 216, 236, 241, 255, 257, 276, 283, 301, 324, 325], "vuls": [0, 10, 125, 193, 236], "filter_top_n": [0, 5, 10, 308, 324], "mani": [0, 1, 2, 5, 8, 10, 24, 30, 40, 53, 59, 72, 126, 195, 237, 279, 292, 323, 324, 325], "highest": [0, 10, 126, 127, 137, 140, 195, 196, 202, 205, 237, 238, 244, 247, 279, 280, 286, 289, 323], "find_paralogs_ensembl": [0, 10], "acanthochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "polyacanthu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "accipit": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nisu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ailuropoda": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanoleuca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amazona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "collaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amphilophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "citrinellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amphiprion": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ocellari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "percula": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anaba": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "testudineu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "platyrhyncho": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zonorhyncha": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anoli": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "carolinensi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "anser": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "brachyrhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cygnoid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aotu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nancymaa": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "apteryx": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "haastii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "owenii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rowi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aquila": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysaeto": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "astatotilapia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calliptera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "astyanax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mexicanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pachon": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "athen": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cunicularia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "balaenoptera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "betta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "splenden": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bo": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "grunnien": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "indicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hybrid": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "mutu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tauru": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "bubo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "buteo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "japonicu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "cairina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "domestica": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "calidri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pugnax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pygmaea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "callithrix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "jacchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "callorhinchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "milii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "camarhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parvulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "camelu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dromedariu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cani": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "lupu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "dingo": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiari": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "familiarisbasenji": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisbox": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisgreatdan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisgsd": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "capra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hircu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "blackbeng": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "carassiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "auratu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carlito": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "syrichta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "castor": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "canadensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catagonu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "wagneri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catharu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ustulatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cavia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aperea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "porcellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cebu": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "imit": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "cercocebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ati": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cervu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hanglu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "yarkandensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chelonoidi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "abingdonii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chelydra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "serpentina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chinchilla": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lanigera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chlorocebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sabaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "choloepu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hoffmanni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysemi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "picta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bellii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysolophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pictu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ciona": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "intestinali": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "savignyi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "clupea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "harengu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "colobu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "angolensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "palliatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "corvu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moneduloid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cottoperca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gobio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coturnix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "japonica": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cricetulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "griseu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chok1gshd": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "crigri": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "picr": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "crocodylu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "porosu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyanist": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caeruleu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyclopteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lumpu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cynoglossu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "semilaevi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyprinodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "variegatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyprinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carpio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "germanmirror": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hebaor": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "huangh": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "dasypu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "novemcinctu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "delphinapteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leuca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "denticep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "clupeoid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dicentrarchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "labrax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dipodomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ordii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dromaiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "novaehollandia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "echenei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "naucrat": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "echinop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "telfairi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "electrophoru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "electricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "eptatretu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "burgeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "equu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "asinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caballu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "erinaceu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "europaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "erpetoichthi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calabaricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "erythrura": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gouldia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "esox": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "luciu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "falco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tinnunculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "feli": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "catu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "ficedula": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "albicolli": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fukomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "damarensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fundulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "heteroclitu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gadu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "morhua": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gallu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "gca000002315v5": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "gca016700215v2": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "gambusia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "affini": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gasterosteu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aculeatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "geospiza": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "forti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gopheru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "agassizii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "evgoodei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gorilla": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "gouania": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "willdenowi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "haplochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "burtoni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "heterocephalu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "glaber": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "femal": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "male": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286, 324, 325], "hippocampu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "come": [0, 5, 10, 127, 137, 140, 165, 196, 202, 205, 238, 244, 247, 280, 286, 289, 323, 324, 325], "hucho": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ictaluru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "punctatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ictidomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tridecemlineatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "jaculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "junco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hyemali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kryptolebia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marmoratu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "labru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bergylta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "larimichthi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "crocea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "late": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calcarif": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laticauda": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laticaudata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latimeria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chalumna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lepidothrix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coronata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lepisosteu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "oculatu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "leptobrachium": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leishanens": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lonchura": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "striata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "loxodonta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "africana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lynx": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "macaca": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "fasciculari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mulatta": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "nemestrina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maluru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyaneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "samu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "manacu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vitellinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mandrillu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leucophaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marmota": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mastacembelu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "armatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maylandia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zebra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "meleagri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gallopavo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melopsittacu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "undulatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "merion": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "unguiculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mesocricetu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "microcebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "microtu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ochrogast": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mola": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monodelphi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "monodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monocero": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monopteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "albu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschiferu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caroli": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "129s1svimj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "aj": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "akrj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "balbcj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "c3hhej": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "c57bl6nj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "casteij": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "cbaj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "dba2j": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "fvbnj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "lpj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "nodshiltj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "nzohlltj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pwkphj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "wsbeij": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pahari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spicilegu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spretu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mustela": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "putoriu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "furo": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "myoti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lucifugu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "myripristi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murdjan": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "naja": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nannospalax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "galili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neogobiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanostomu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neolamprologu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "brichardi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neovison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nomascu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leucogeni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "notamacropu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "eugenii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "notechi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scutatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nothobranchiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "furzeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nothoprocta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "perdicaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "numida": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ochotona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "princep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "octodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "degu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oncorhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kisutch": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mykiss": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tshawytscha": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oreochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aureu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "niloticu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ornithorhynchu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "anatinu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "oryctolagu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cuniculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oryzia": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "javanicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latip": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "hni": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hsok": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "melastigma": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinensi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "otolemur": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "garnettii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "otu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sunia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ovi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rambouillet": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pan": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "paniscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "troglodyt": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "panthera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pardu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tigri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "altaica": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "papio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anubi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parambassi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ranga": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paramormyrop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kingsleya": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "major": [0, 1, 10, 127, 128, 136, 137, 138, 139, 140, 196, 197, 201, 202, 203, 204, 205, 238, 239, 243, 244, 245, 246, 247, 280, 281, 285, 286, 287, 288, 289, 323, 325], "pavo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cristatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pelodiscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pelusio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "castaneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "periophthalmu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "magnuspinnatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "peromyscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maniculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bairdii": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "petromyzon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phascolarcto": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cinereu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phasianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "colchicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phocoena": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "physet": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "piliocolobu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tephroscel": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "podarci": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "poecilia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "formosa": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latipinna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mexicana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "reticulata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pogona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vitticep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pongo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "abelii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "procavia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "capensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "prolemur": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "simu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "propithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coquer": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pseudonaja": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "textili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pteropu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vampyru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pundamilia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nyererei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pygocentru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nattereri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rattu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "norvegicu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "shrspbbbutx": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "shrutx": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "wkybbb": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "rhinolophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ferrumequinum": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rhinopithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bieti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "roxellana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "saimiri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "boliviensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fasciatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salmo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salar": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "trutta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salvat": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "meriana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sander": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lucioperca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sarcophilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "harrisii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sciuru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vulgari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scleropag": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "formosu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scophthalmu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maximu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "serinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "canaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "seriola": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dumerili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lalandi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dorsali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinocyclocheilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anshuiensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "grahami": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rhinocer": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sorex": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "araneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sparu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aurata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spermophilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dauricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sphaeramia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "orbiculari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sphenodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "stachyri": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "ruficep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "stegast": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "partitu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "strigop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "habroptila": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "strix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "occidentali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caurina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "struthio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "australi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "suricata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "suricatta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "su": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "scrofa": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "bamei": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "berkshir": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hampshir": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "jinhua": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "landrac": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "largewhit": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "meishan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pietrain": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "rongchang": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "tibetan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "usmarc": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "wuzhishan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "taeniopygia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "guttata": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "takifugu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rubrip": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "terrapen": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carolina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "triungui": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tetraodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nigroviridi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "theropithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gelada": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tupaia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "belangeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tursiop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "truncatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "urocitellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parryii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ursu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "americanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maritimu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "thibetanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "varanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "komodoensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vicugna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vombatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ursinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vulp": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "xenopu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "tropicali": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "xiphophoru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "couchianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zalophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "californianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zonotrichia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zosterop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laterali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "filter_percent_ident": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "paralog": [0, 4, 5, 10, 127, 128, 196, 197, 238, 239, 280, 281, 323, 324, 325], "speci": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 324, 325], "encount": [0, 5, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ortholog": [0, 5, 10, 127, 137, 138, 139, 140, 196, 202, 203, 204, 205, 238, 244, 245, 246, 247, 280, 286, 287, 288, 289], "percent_ident": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "find_paralogs_panth": [0, 10], "amborella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichopoda": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "anophel": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gambia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aquifex": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aeolicu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "arabidopsi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 324, 325], "ashbya": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gossypii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bacillu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cereu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "subtili": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bacteroid": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thetaiotaomicron": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "batrachochytrium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dendrobatidi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brachypodium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "distachyon": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bradyrhizobium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "diazoefficien": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "branchiostoma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "florida": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brassica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "napu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "rapa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "subsp": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pekinensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "briggsa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "candida": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "albican": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "capsicum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "annuum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chlamydia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trachomati": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chlamydomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "reinhardtii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chloroflexu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aurantiacu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "citru": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "clostridium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "botulinum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "coxiella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "burnetii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cryptococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neoforman": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cucumi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sativu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "daphnia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pulex": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "deinococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "radioduran": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dictyoglomu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "turgidum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dictyostelium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "discoideum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "purpureum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "emericella": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "nidulan": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "entamoeba": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "histolytica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "erythranth": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "eucalyptu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "grandi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "fusobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nucleatum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "geobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sulfurreducen": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "giardia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gloeobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "violaceu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "glycin": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gossypium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "hirsutum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "haemophilu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "influenza": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "halobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "salinarum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helianthu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "annuu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helicobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pylori": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "hordeum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vulgar": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ixod": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "scapulari": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "juglan": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "regia": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "klebsormidium": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "niten": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "korarchaeum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cryptofilum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lactuca": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "sativa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "leishmania": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "leptospira": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "interrogan": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "listeria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "monocytogen": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "manihot": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "esculenta": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "marchantia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "polymorpha": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "medicago": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "truncatula": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "methanocaldococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "jannaschii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "methanosarcina": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "acetivoran": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "monosiga": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brevicolli": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "musa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "acuminata": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "malaccensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "mycobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tuberculosi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neisseria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "meningitidi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "serogroup": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "b": [0, 1, 2, 9, 10, 35, 67, 77, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 323, 325], "nelumbo": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nucifera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nematostella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vectensi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neosartorya": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "fumigata": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "neurospora": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "crassa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nicotiana": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tabacum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nitrosopumilu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "oryza": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "paramecium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tetraurelia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "phaeosphaeria": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "nodorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "physcomitrella": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "paten": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "phytophthora": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ramorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "plasmodium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "falciparum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "populu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichocarpa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pristionchu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pacificu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "prunu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "persica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pseudomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aeruginosa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "puccinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gramini": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pyrobaculum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aerophilum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "rhodopirellula": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "baltica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ricinu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "communi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "salmonella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "typhimurium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sclerotinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sclerotiorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "selaginella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "moellendorffii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "setaria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "italica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "shewanella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "oneidensi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "solanum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lycopersicum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tuberosum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sorghum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bicolor": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "spinacia": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "oleracea": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "staphylococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "streptococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pneumonia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "streptomyc": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "coelicolor": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "strongylocentrotu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "purpuratu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sulfolobu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "solfataricu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "synechocysti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thalassiosira": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pseudonana": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "theobroma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cacao": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thermococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "kodakaraensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "thermodesulfovibrio": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yellowstonii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thermotoga": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "maritima": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tribolium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "castaneum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vaginali": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichoplax": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "adhaeren": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "triticum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aestivum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trypanosoma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brucei": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ustilago": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "maydi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vibrio": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cholera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "viti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vinifera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "xanthomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "campestri": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yarrowia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lipolytica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yersinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pesti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "zea": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "zostera": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "marina": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helobdella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "robusta": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "mycoplasma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "genitalium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pantherdb": [0, 10, 128, 139, 197, 204, 239, 246, 281, 288], "fold_chang": [0, 5, 10, 324], "numer_nam": [0, 10, 129], "denom_nam": [0, 10, 129], "foldchangefilt": [0, 4, 10, 129, 306, 308], "generar": [0, 10, 129], "counted_fold_chang": [0, 10, 129, 324], "cond1_rep1": [0, 10, 129, 324], "cond1_rep2": [0, 10, 129, 324], "cond2_rep1": [0, 10, 129, 324], "cond_2rep2": [0, 10, 129], "f": [0, 9, 10, 24, 53, 65, 129, 140, 205, 247, 268, 276, 289, 292, 299, 324], "cond2_rep2": [0, 10, 129, 324], "from_fold": [0, 5, 10], "folder_path": [0, 10, 131, 132], "save_csv": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 131, 132, 292, 324], "input_format": [0, 10, 131, 132], "over": [0, 1, 5, 10, 24, 53, 131, 132, 164, 324, 325], "uncount": [0, 10, 131, 132, 147, 324], "htcount": [0, 10, 131, 132], "joint": [0, 10, 131, 132], "counted_fnam": [0, 10, 131, 132, 324], "uncounted_fnam": [0, 10, 131, 132, 324], "unalign": [0, 10, 131, 132, 324, 325], "under": [0, 5, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 131, 132, 153, 292, 323, 324, 325], "need": [0, 1, 7, 8, 10, 131, 132, 164, 323, 324, 325], "test_count_from_fold": [0, 10, 131, 132, 324], "from_folder_htseqcount": [0, 5, 10, 324], "norm_to_rpm": [0, 10, 132, 324], "htseq": [0, 9, 10, 132, 147], "regardless": [0, 10, 132, 323], "defualt": [0, 10, 132], "fill": [0, 10, 132], "name_for_reads_csv_fil": [0, 10, 132, 324], "name_for_uncounted_reads_csv_fil": [0, 10, 132, 324], "head": [0, 10, 159, 211, 253, 296, 324, 325], "6820": [0, 10, 133, 199, 241, 283, 324], "755327": [0, 10, 133, 199, 241, 283, 324], "567762": [0, 10, 133, 199, 241, 283, 324], "000000e": [0, 10, 133, 199, 241, 283, 324], "00": [0, 10, 133, 140, 165, 199, 205, 241, 247, 283, 289, 324], "3049": [0, 10, 133, 199, 241, 283, 324], "625670": [0, 10, 133, 199, 241, 283, 324], "138071": [0, 10, 133, 199, 241, 283, 324], "660000e": [0, 10, 133, 199, 241, 283, 324], "280000e": [0, 10, 133, 199, 241, 283, 324], "298": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "wbgene00000004": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 133, 136, 170, 175, 199, 201, 215, 220, 241, 243, 256, 261, 283, 285, 300, 305, 324, 325], "1432": [0, 10, 133, 199, 241, 283, 324], "911791": [0, 10, 133, 199, 241, 283, 324], "111737": [0, 10, 133, 199, 241, 283, 324], "400000e": [0, 10, 133, 171, 199, 216, 241, 257, 283, 301, 324], "237": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "920000e": [0, 10, 133, 199, 241, 283, 324], "233": [0, 10, 133, 199, 241, 283, 324], "wbgene00000005": [0, 10, 38, 70, 133, 170, 175, 199, 215, 220, 241, 256, 261, 283, 300, 305, 324, 325], "4028": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "154186": [0, 10, 133, 199, 241, 283, 324], "534112": [0, 10, 133, 199, 241, 283, 324], "700000e": [0, 10, 133, 171, 199, 216, 241, 257, 283, 301, 324], "228": [0, 10, 133, 199, 241, 283, 324], "225": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "wbgene00000006": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 133, 170, 175, 199, 215, 220, 241, 256, 261, 283, 300, 305, 324, 325], "1230": [0, 10, 133, 199, 241, 283, 324], "585240": [0, 10, 133, 199, 241, 283, 324], "157428": [0, 10, 133, 199, 241, 283, 324], "216": [0, 10, 133, 140, 167, 199, 205, 241, 247, 283, 289, 324], "590000e": [0, 10, 133, 199, 241, 283, 324], "213": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "appear": [0, 5, 10, 18, 24, 30, 35, 40, 47, 53, 59, 64, 65, 66, 67, 72, 73, 136, 201, 243, 285, 315, 316, 317, 323, 324, 325], "correspond": [0, 4, 10, 149, 152, 158, 161, 165, 166, 167, 168, 169, 212, 254, 297, 324, 325], "myset": [0, 10], "nwbgene00000003": [0, 10], "nwbgene12345678": [0, 10], "mystr": [0, 10], "ma_plot": [0, 5, 10], "ref_column": [0, 10, 135, 143], "split_plot": [0, 10, 135, 153, 165, 166, 167, 168, 169], "ma": [0, 5, 10, 135, 140, 205, 247, 289], "chosen": [0, 10, 135, 143, 324], "upper": [0, 10, 135, 143, 324, 325], "quartil": [0, 10, 135, 143], "closest": [0, 5, 10, 135, 143], "majority_vote_intersect": [0, 5, 10], "majority_threshold": [0, 10, 136, 201, 243, 285], "majority_threhold": [0, 5, 10, 136, 201, 243, 285], "vote": [0, 10, 136, 201, 243, 285, 323, 325], "equival": [0, 10, 35, 67, 136, 201, 243, 285], "uphold": [0, 10, 136, 201, 243, 285], "b_set": [0, 10, 136, 201, 243, 285], "map_orthologs_ensembl": [0, 10], "map_to_organ": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "map_from_organ": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "non_unique_mod": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "remove_unmapped_gen": [0, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304], "nearest": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 324, 325], "translat": [0, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304, 324, 325], "unmap": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 324], "could": [0, 1, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 262, 286, 287, 288, 289, 304, 323, 324, 325], "remain": [0, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304, 323, 324, 325], "map_orthologs_orthoinspector": [0, 10], "orthoinspector": [0, 5, 9, 10, 138, 203, 245, 287], "map_orthologs_panth": [0, 10], "filter_least_diverg": [0, 10, 139, 204, 246, 288], "diverg": [0, 10, 139, 204, 246, 288], "map_orthologs_phylomedb": [0, 10], "azorhizobium": [0, 10, 140, 205, 247, 289], "caulinodan": [0, 10, 140, 205, 247, 289], "ORS": [0, 10, 140, 205, 247, 289], "571": [0, 10, 140, 205, 247, 289], "buchnera": [0, 10, 140, 205, 247, 289], "aphidicola": [0, 10, 140, 205, 247, 289], "g002": [0, 10, 140, 205, 247, 289], "myzu": [0, 10, 140, 205, 247, 289], "cellulomona": [0, 10, 140, 205, 247, 289], "gilvu": [0, 10, 140, 205, 247, 289], "atcc": [0, 10, 140, 205, 247, 289], "13127": [0, 10, 140, 205, 247, 289], "thermophilum": [0, 10, 140, 205, 247, 289], "h": [0, 9, 10, 140, 205, 247, 289], "methylophilu": [0, 10, 140, 205, 247, 289], "methylotrophu": [0, 10, 140, 205, 247, 289], "dsm": [0, 10, 140, 205, 247, 289], "46235": [0, 10, 140, 205, 247, 289], "53528": [0, 10, 140, 205, 247, 289], "pelobact": [0, 10, 140, 205, 247, 289], "carbinolicu": [0, 10, 140, 205, 247, 289], "2380": [0, 10, 140, 205, 247, 289], "putrefacien": [0, 10, 140, 205, 247, 289], "cn": [0, 10, 140, 205, 247, 289], "32": [0, 2, 10, 140, 165, 205, 247, 289, 324, 325], "myxococcu": [0, 10, 140, 205, 247, 289], "fulvu": [0, 10, 140, 205, 247, 289], "hw": [0, 10, 140, 205, 247, 289], "xanthu": [0, 10, 140, 205, 247, 289], "dk": [0, 10, 140, 205, 247, 289], "1622": [0, 10, 140, 205, 247, 289], "stigmatella": [0, 10, 140, 205, 247, 289], "aurantiaca": [0, 10, 140, 205, 247, 289], "dw4": [0, 10, 140, 205, 247, 289], "cystobact": [0, 10, 140, 205, 247, 289], "fuscu": [0, 10, 140, 205, 247, 289], "2262": [0, 10, 140, 205, 247, 289], "chondromyc": [0, 10, 140, 205, 247, 289], "apiculatu": [0, 10, 140, 205, 247, 289], "436": [0, 10, 140, 205, 247, 289], "sorangium": [0, 10, 140, 205, 247, 289], "cellulosum": [0, 10, 140, 205, 247, 289], "so0157": [0, 10, 140, 205, 247, 289], "vitreoscilla": [0, 10, 140, 205, 247, 289], "stercoraria": [0, 10, 140, 205, 247, 289], "513": [0, 10, 140, 205, 247, 289], "herpetosiphon": [0, 10, 140, 205, 247, 289], "785": [0, 10, 140, 205, 247, 289], "simonsiella": [0, 10, 140, 205, 247, 289], "muelleri": [0, 10, 140, 205, 247, 289], "29453": [0, 10, 140, 205, 247, 289], "hyphomona": [0, 10, 140, 205, 247, 289], "jannaschiana": [0, 10, 140, 205, 247, 289], "vp2": [0, 10, 140, 205, 247, 289], "flectobacillu": [0, 10, 140, 205, 247, 289], "103": [0, 10, 140, 167, 205, 247, 289], "cyclobacterium": [0, 10, 140, 205, 247, 289], "marinum": [0, 10, 140, 205, 247, 289], "745": [0, 10, 140, 205, 247, 289], "runella": [0, 10, 140, 205, 247, 289], "slithyformi": [0, 10, 140, 205, 247, 289], "19594": [0, 10, 140, 205, 247, 289], "spirosoma": [0, 10, 140, 205, 247, 289], "lingual": [0, 10, 140, 205, 247, 289], "74": [0, 9, 10, 140, 167, 169, 171, 205, 216, 247, 257, 289, 301, 324, 325], "rubinisphaera": [0, 10, 140, 205, 247, 289], "brasiliensi": [0, 10, 140, 205, 247, 289], "5305": [0, 10, 140, 205, 247, 289], "planctopiru": [0, 10, 140, 205, 247, 289], "limnophila": [0, 10, 140, 205, 247, 289], "3776": [0, 10, 140, 205, 247, 289], "gimesia": [0, 10, 140, 205, 247, 289], "mari": [0, 10, 140, 205, 247, 289], "8797": [0, 10, 140, 205, 247, 289], "blastopirellula": [0, 10, 140, 205, 247, 289], "3645": [0, 10, 140, 205, 247, 289], "pirellula": [0, 10, 140, 205, 247, 289], "staleyi": [0, 10, 140, 205, 247, 289], "6068": [0, 10, 140, 205, 247, 289], "isosphaera": [0, 10, 140, 205, 247, 289], "pallida": [0, 10, 140, 205, 247, 289], "43644": [0, 10, 140, 205, 247, 289], "methylocysti": [0, 10, 140, 205, 247, 289], "parvu": [0, 10, 140, 205, 247, 289], "obbp": [0, 10, 140, 205, 247, 289], "borreliella": [0, 10, 140, 205, 247, 289], "burgdorferi": [0, 10, 140, 205, 247, 289], "b31": [0, 10, 140, 205, 247, 289], "borrelia": [0, 10, 140, 205, 247, 289], "hermsii": [0, 10, 140, 205, 247, 289], "dah": [0, 10, 140, 205, 247, 289], "parkeri": [0, 10, 140, 205, 247, 289], "slo": [0, 10, 140, 205, 247, 289], "turicata": [0, 10, 140, 205, 247, 289], "91e135": [0, 10, 140, 205, 247, 289], "anserina": [0, 10, 140, 205, 247, 289], "ba2": [0, 10, 140, 205, 247, 289], "sediminispirochaeta": [0, 10, 140, 205, 247, 289], "bajacaliforniensi": [0, 10, 140, 205, 247, 289], "16054": [0, 10, 140, 205, 247, 289], "spirochaeta": [0, 10, 140, 205, 247, 289], "thermophila": [0, 10, 140, 205, 247, 289], "6192": [0, 10, 140, 205, 247, 289], "treponema": [0, 10, 140, 205, 247, 289], "denticola": [0, 10, 140, 205, 247, 289], "35405": [0, 10, 140, 205, 247, 289], "brachyspira": [0, 10, 140, 205, 247, 289], "hyodysenteria": [0, 10, 140, 205, 247, 289], "wa1": [0, 10, 140, 205, 247, 289], "pallidum": [0, 10, 140, 205, 247, 289], "nichol": [0, 10, 140, 205, 247, 289], "phagedeni": [0, 10, 140, 205, 247, 289], "f0421": [0, 10, 140, 205, 247, 289], "bryantii": [0, 10, 140, 205, 247, 289], "nk4a124": [0, 10, 140, 205, 247, 289], "saccharophilum": [0, 10, 140, 205, 247, 289], "2985": [0, 10, 140, 205, 247, 289], "succinifacien": [0, 10, 140, 205, 247, 289], "2489": [0, 10, 140, 205, 247, 289], "biflexa": [0, 10, 140, 205, 247, 289], "serovar": [0, 10, 140, 205, 247, 289], "patoc": [0, 10, 140, 205, 247, 289], "strain": [0, 10, 140, 205, 247, 289], "pari": [0, 10, 140, 205, 247, 289], "lai": [0, 10, 140, 205, 247, 289], "56601": [0, 10, 140, 205, 247, 289], "borgpetersenii": [0, 10, 140, 205, 247, 289], "hardjo": [0, 10, 140, 205, 247, 289], "bovi": [0, 10, 140, 205, 247, 289], "l550": [0, 10, 140, 205, 247, 289], "leptospirillum": [0, 10, 140, 205, 247, 289], "ferrooxidan": [0, 10, 140, 205, 247, 289], "c2": [0, 10, 140, 205, 247, 289], "leptonema": [0, 10, 140, 205, 247, 289], "illini": [0, 10, 140, 205, 247, 289], "21528": [0, 10, 140, 205, 247, 289], "novispirillum": [0, 10, 140, 205, 247, 289], "itersonii": [0, 10, 140, 205, 247, 289], "12639": [0, 10, 140, 205, 247, 289], "aquaspirillum": [0, 10, 140, 205, 247, 289], "serpen": [0, 10, 140, 205, 247, 289], "azospirillum": [0, 10, 140, 205, 247, 289], "sp": [0, 10, 140, 205, 247, 289], "b510": [0, 10, 140, 205, 247, 289], "campylobact": [0, 10, 140, 205, 247, 289], "76339": [0, 10, 140, 205, 247, 289], "fetu": [0, 10, 140, 205, 247, 289], "venereali": [0, 10, 140, 205, 247, 289], "nctc": [0, 10, 140, 205, 247, 289], "10354": [0, 10, 140, 205, 247, 289], "jejuni": [0, 10, 140, 205, 247, 289], "414": [0, 10, 140, 205, 247, 289], "concisu": [0, 10, 140, 205, 247, 289], "13826": [0, 10, 140, 205, 247, 289], "curvu": [0, 10, 140, 205, 247, 289], "525": [0, 9, 10, 140, 168, 205, 247, 289], "92": [0, 10, 140, 165, 166, 205, 247, 289], "lari": [0, 10, 140, 205, 247, 289], "rm2100": [0, 10, 140, 205, 247, 289], "rectu": [0, 10, 140, 205, 247, 289], "rm3267": [0, 10, 140, 205, 247, 289], "showa": [0, 10, 140, 205, 247, 289], "csunswcd": [0, 10, 140, 205, 247, 289], "sputorum": [0, 10, 140, 205, 247, 289], "biovar": [0, 10, 140, 205, 247, 289], "26695": [0, 10, 140, 205, 247, 289], "acinonychi": [0, 10, 140, 205, 247, 289], "sheeba": [0, 10, 140, 205, 247, 289], "cinaedi": [0, 10, 140, 205, 247, 289], "ccug": [0, 10, 140, 205, 247, 289], "18818": [0, 10, 140, 205, 247, 289], "baa": [0, 10, 140, 205, 247, 289], "847": [0, 10, 140, 205, 247, 289], "49179": [0, 10, 140, 205, 247, 289], "fennellia": [0, 10, 140, 205, 247, 289], "mry12": [0, 10, 140, 205, 247, 289], "0050": [0, 10, 140, 205, 247, 289], "12198": [0, 10, 140, 205, 247, 289], "pseudoalteromona": [0, 10, 140, 205, 247, 289], "haloplankti": [0, 10, 140, 205, 247, 289], "14393": [0, 10, 140, 205, 247, 289], "brucella": [0, 10, 140, 205, 247, 289], "abortu": [0, 10, 140, 205, 247, 289], "2308": [0, 10, 140, 205, 247, 289], "25840": [0, 10, 140, 205, 247, 289], "elizabethkingia": [0, 10, 140, 205, 247, 289], "meningoseptica": [0, 10, 140, 205, 247, 289], "13253": [0, 10, 140, 205, 247, 289], "nbrc": [0, 10, 140, 205, 247, 289], "12535": [0, 10, 140, 205, 247, 289], "flavobacterium": [0, 10, 140, 205, 247, 289], "aquatil": [0, 10, 140, 205, 247, 289], "lmg": [0, 10, 140, 205, 247, 289], "4008": [0, 10, 140, 205, 247, 289], "11947": [0, 10, 140, 205, 247, 289], "empedobact": [0, 10, 140, 205, 247, 289], "brevi": [0, 10, 140, 205, 247, 289], "14943": [0, 10, 140, 205, 247, 289], "43319": [0, 10, 140, 205, 247, 289], "chryseobacterium": [0, 10, 140, 205, 247, 289], "gleum": [0, 10, 140, 205, 247, 289], "35910": [0, 10, 140, 205, 247, 289], "psychroflexu": [0, 10, 140, 205, 247, 289], "gondwanensi": [0, 10, 140, 205, 247, 289], "acam": [0, 10, 140, 205, 247, 289], "indologen": [0, 10, 140, 205, 247, 289], "14944": [0, 10, 140, 205, 247, 289], "myroid": [0, 10, 140, 205, 247, 289], "odoratu": [0, 10, 140, 205, 247, 289], "2801": [0, 10, 140, 205, 247, 289], "sphingobacterium": [0, 10, 140, 205, 247, 289], "spiritivorum": [0, 10, 140, 205, 247, 289], "33861": [0, 10, 140, 205, 247, 289], "francisella": [0, 10, 140, 205, 247, 289], "cf": [0, 10, 140, 205, 247, 289], "tularensi": [0, 10, 140, 205, 247, 289], "novicida": [0, 10, 140, 205, 247, 289], "3523": [0, 10, 140, 205, 247, 289], "paracoccu": [0, 10, 140, 205, 247, 289], "denitrifican": [0, 10, 140, 205, 247, 289], "pd1222": [0, 10, 140, 205, 247, 289], "thermu": [0, 10, 140, 205, 247, 289], "aquaticu": [0, 10, 140, 205, 247, 289], "y51mc23": [0, 10, 140, 205, 247, 289], "thermophilu": [0, 10, 140, 205, 247, 289], "hb8": [0, 10, 140, 205, 247, 289], "meiothermu": [0, 10, 140, 205, 247, 289], "ruber": [0, 10, 140, 205, 247, 289], "1279": [0, 10, 140, 205, 247, 289], "xanthobact": [0, 10, 140, 205, 247, 289], "autotrophicu": [0, 10, 140, 205, 247, 289], "py2": [0, 10, 140, 205, 247, 289], "comamona": [0, 10, 140, 205, 247, 289], "testosteroni": [0, 10, 140, 205, 247, 289], "kf": [0, 10, 140, 205, 247, 289], "pao1": [0, 10, 140, 205, 247, 289], "atlantica": [0, 10, 140, 205, 247, 289], "t6c": [0, 10, 140, 205, 247, 289], "burkholderia": [0, 10, 140, 205, 247, 289], "cepacia": [0, 10, 140, 205, 247, 289], "brevundimona": [0, 10, 140, 205, 247, 289], "diminuta": [0, 10, 140, 205, 247, 289], "470": [0, 10, 140, 205, 247, 289], "fluorescen": [0, 10, 140, 205, 247, 289], "ncimb": [0, 10, 140, 205, 247, 289], "11764": [0, 10, 140, 205, 247, 289], "fragi": [0, 10, 140, 205, 247, 289], "b25": [0, 10, 140, 205, 247, 289], "mendocina": [0, 10, 140, 205, 247, 289], "nk": [0, 10, 140, 205, 247, 289], "pseudoalcaligen": [0, 10, 140, 205, 247, 289], "ad6": [0, 10, 140, 205, 247, 289], "putida": [0, 10, 140, 205, 247, 289], "kt2440": [0, 10, 140, 205, 247, 289], "ralstonia": [0, 10, 140, 205, 247, 289], "solanacearum": [0, 10, 140, 205, 247, 289], "gmi1000": [0, 10, 140, 205, 247, 289], "stutzeri": [0, 10, 140, 205, 247, 289], "mf28": [0, 10, 140, 205, 247, 289], "syringa": [0, 10, 140, 205, 247, 289], "pv": [0, 10, 140, 205, 247, 289], "b728a": [0, 10, 140, 205, 247, 289], "pickettii": [0, 10, 140, 205, 247, 289], "dtp0602": [0, 10, 140, 205, 247, 289], "gluma": [0, 10, 140, 205, 247, 289], "bgr1": [0, 10, 140, 205, 247, 289], "translucen": [0, 10, 140, 205, 247, 289], "dar61454": [0, 10, 140, 205, 247, 289], "citri": [0, 10, 140, 205, 247, 289], "306": [0, 10, 140, 169, 205, 247, 289], "pxo99a": [0, 10, 140, 205, 247, 289], "azotobact": [0, 10, 140, 205, 247, 289], "chroococcum": [0, 10, 140, 205, 247, 289], "8003": [0, 10, 140, 205, 247, 289], "vinelandii": [0, 10, 140, 205, 247, 289], "dj": [0, 10, 140, 205, 247, 289], "agrobacterium": [0, 10, 140, 205, 247, 289], "radiobact": [0, 10, 140, 205, 247, 289], "k84": [0, 10, 140, 205, 247, 289], "rhizogen": [0, 10, 140, 205, 247, 289], "s4": [0, 10, 140, 205, 247, 289], "japonicum": [0, 10, 140, 205, 247, 289], "sinorhizobium": [0, 10, 140, 205, 247, 289], "fredii": [0, 10, 140, 205, 247, 289], "usda": [0, 10, 140, 205, 247, 289], "257": [0, 10, 140, 205, 247, 289], "mesorhizobium": [0, 10, 140, 205, 247, 289], "loti": [0, 10, 140, 205, 247, 289], "cj3sym": [0, 10, 140, 205, 247, 289], "meliloti": [0, 10, 140, 205, 247, 289], "1021": [0, 10, 140, 205, 247, 289], "rhizobium": [0, 10, 140, 205, 247, 289], "leguminosarum": [0, 10, 140, 205, 247, 289], "bv": [0, 10, 140, 205, 247, 289], "vicia": [0, 10, 140, 205, 247, 289], "gb30": [0, 10, 140, 205, 247, 289], "tropici": [0, 10, 140, 205, 247, 289], "ciat": [0, 10, 140, 205, 247, 289], "899": [0, 10, 140, 205, 247, 289], "neorhizobium": [0, 10, 140, 205, 247, 289], "galega": [0, 10, 140, 205, 247, 289], "orientali": [0, 10, 140, 205, 247, 289], "hambi": [0, 10, 140, 205, 247, 289], "540": [0, 10, 140, 205, 247, 289], "methylobacillu": [0, 10, 140, 205, 247, 289], "flagellatu": [0, 10, 140, 205, 247, 289], "kt": [0, 10, 140, 205, 247, 289], "glycogen": [0, 10, 140, 205, 247, 289], "jcm": [0, 10, 140, 205, 247, 289], "2850": [0, 10, 140, 205, 247, 289], "methylorubrum": [0, 10, 140, 205, 247, 289], "extorquen": [0, 10, 140, 205, 247, 289], "am1": [0, 10, 140, 205, 247, 289], "methylococcu": [0, 10, 140, 205, 247, 289], "capsulatu": [0, 10, 140, 205, 247, 289], "bath": [0, 10, 140, 205, 247, 289], "methylomona": [0, 10, 140, 205, 247, 289], "methanica": [0, 10, 140, 205, 247, 289], "mc09": [0, 10, 140, 205, 247, 289], "methylosinu": [0, 10, 140, 205, 247, 289], "trichosporium": [0, 10, 140, 205, 247, 289], "ob3b": [0, 10, 140, 205, 247, 289], "acetobact": [0, 10, 140, 205, 247, 289], "aceti": [0, 10, 140, 205, 247, 289], "23746": [0, 10, 140, 205, 247, 289], "komagataeibact": [0, 10, 140, 205, 247, 289], "hansenii": [0, 10, 140, 205, 247, 289], "23769": [0, 10, 140, 205, 247, 289], "pasteurianu": [0, 10, 140, 205, 247, 289], "3p3": [0, 10, 140, 205, 247, 289], "gluconobact": [0, 10, 140, 205, 247, 289], "oxydan": [0, 10, 140, 205, 247, 289], "h24": [0, 10, 140, 205, 247, 289], "legionella": [0, 10, 140, 205, 247, 289], "pneumophila": [0, 10, 140, 205, 247, 289], "hackelia": [0, 10, 140, 205, 247, 289], "longbeacha": [0, 10, 140, 205, 247, 289], "nsw150": [0, 10, 140, 205, 247, 289], "tatlockia": [0, 10, 140, 205, 247, 289], "micdadei": [0, 10, 140, 205, 247, 289], "fluoribact": [0, 10, 140, 205, 247, 289], "dumoffii": [0, 10, 140, 205, 247, 289], "ny": [0, 10, 140, 205, 247, 289], "acinetobact": [0, 10, 140, 205, 247, 289], "baumannii": [0, 10, 140, 205, 247, 289], "calcoaceticu": [0, 10, 140, 205, 247, 289], "anc": [0, 10, 140, 205, 247, 289], "3680": [0, 10, 140, 205, 247, 289], "moraxella": [0, 10, 140, 205, 247, 289], "catarrhali": [0, 10, 140, 205, 247, 289], "o35": [0, 10, 140, 205, 247, 289], "cinerea": [0, 10, 140, 205, 247, 289], "14685": [0, 10, 140, 205, 247, 289], "flavescen": [0, 10, 140, 205, 247, 289], "nrl30031": [0, 10, 140, 205, 247, 289], "h210": [0, 10, 140, 205, 247, 289], "gonorrhoea": [0, 10, 140, 205, 247, 289], "nccp11945": [0, 10, 140, 205, 247, 289], "lactamica": [0, 10, 140, 205, 247, 289], "020": [0, 10, 140, 205, 247, 289], "06": [0, 6, 10, 140, 205, 247, 289], "mc58": [0, 10, 140, 205, 247, 289], "mucosa": [0, 10, 140, 205, 247, 289], "25996": [0, 10, 140, 205, 247, 289], "polysaccharea": [0, 10, 140, 205, 247, 289], "43768": [0, 10, 140, 205, 247, 289], "sicca": [0, 10, 140, 205, 247, 289], "29256": [0, 10, 140, 205, 247, 289], "elongata": [0, 10, 140, 205, 247, 289], "glycolytica": [0, 10, 140, 205, 247, 289], "29315": [0, 10, 140, 205, 247, 289], "33926": [0, 10, 140, 205, 247, 289], "thermomicrobium": [0, 10, 140, 205, 247, 289], "roseum": [0, 10, 140, 205, 247, 289], "5159": [0, 10, 140, 205, 247, 289], "kingella": [0, 10, 140, 205, 247, 289], "33394": [0, 10, 140, 205, 247, 289], "kinga": [0, 10, 140, 205, 247, 289], "23330": [0, 10, 140, 205, 247, 289], "orali": [0, 10, 140, 205, 247, 289], "51147": [0, 10, 140, 205, 247, 289], "alcaligen": [0, 10, 140, 205, 247, 289], "faecali": [0, 10, 140, 205, 247, 289], "bordetella": [0, 10, 140, 205, 247, 289], "bronchiseptica": [0, 10, 140, 205, 247, 289], "rb50": [0, 10, 140, 205, 247, 289], "parapertussi": [0, 10, 140, 205, 247, 289], "bpp5": [0, 10, 140, 205, 247, 289], "pertussi": [0, 10, 140, 205, 247, 289], "tohama": [0, 10, 140, 205, 247, 289], "avium": [0, 10, 140, 205, 247, 289], "197n": [0, 10, 140, 205, 247, 289], "acidiphilium": [0, 10, 140, 205, 247, 289], "angustum": [0, 10, 140, 205, 247, 289], "35903": [0, 10, 140, 205, 247, 289], "cryptum": [0, 10, 140, 205, 247, 289], "jf": [0, 10, 140, 205, 247, 289], "acidocella": [0, 10, 140, 205, 247, 289], "facili": [0, 10, 140, 205, 247, 289], "35904": [0, 10, 140, 205, 247, 289], "ochrobactrum": [0, 10, 140, 205, 247, 289], "anthropi": [0, 10, 140, 205, 247, 289], "49188": [0, 10, 140, 205, 247, 289], "polaribact": [0, 10, 140, 205, 247, 289], "irgensii": [0, 10, 140, 205, 247, 289], "p": [0, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 140, 177, 194, 205, 221, 247, 289, 292, 323, 324, 325], "beijerinckia": [0, 10, 140, 205, 247, 289], "indica": [0, 10, 140, 205, 247, 289], "9039": [0, 10, 140, 205, 247, 289], "chromobacterium": [0, 10, 140, 205, 247, 289], "violaceum": [0, 10, 140, 205, 247, 289], "12472": [0, 10, 140, 205, 247, 289], "eikenella": [0, 10, 140, 205, 247, 289], "corroden": [0, 10, 140, 205, 247, 289], "23834": [0, 10, 140, 205, 247, 289], "zymomona": [0, 10, 140, 205, 247, 289], "mobili": [0, 10, 140, 205, 247, 289], "zm4": [0, 10, 140, 205, 247, 289], "31821": [0, 10, 140, 205, 247, 289], "citrobact": [0, 10, 140, 205, 247, 289], "koseri": [0, 10, 140, 205, 247, 289], "895": [0, 10, 140, 205, 247, 289], "freundii": [0, 10, 140, 205, 247, 289], "mgh": [0, 10, 140, 205, 247, 289], "56": [0, 10, 140, 205, 247, 289], "klebsiella": [0, 10, 140, 205, 247, 289], "aerogen": [0, 10, 140, 205, 247, 289], "kctc": [0, 10, 140, 205, 247, 289], "2190": [0, 10, 140, 169, 205, 247, 289], "pantoea": [0, 10, 140, 205, 247, 289], "agglomeran": [0, 10, 140, 205, 247, 289], "enterobact": [0, 10, 140, 205, 247, 289], "cloaca": [0, 10, 140, 205, 247, 289], "13047": [0, 10, 140, 205, 247, 289], "erwinia": [0, 10, 140, 205, 247, 289], "amylovora": [0, 10, 140, 205, 247, 289], "cfbp1430": [0, 10, 140, 205, 247, 289], "ananati": [0, 10, 140, 205, 247, 289], "20103": [0, 10, 140, 205, 247, 289], "pectobacterium": [0, 10, 140, 205, 247, 289], "carotovorum": [0, 10, 140, 205, 247, 289], "pc1": [0, 10, 140, 205, 247, 289, 323], "dickeya": [0, 10, 140, 205, 247, 289], "chrysanthemi": [0, 10, 140, 205, 247, 289], "ech1591": [0, 10, 140, 205, 247, 289], "shimwellia": [0, 10, 140, 205, 247, 289], "blatta": [0, 10, 140, 205, 247, 289], "4481": [0, 10, 140, 205, 247, 289], "105725": [0, 10, 140, 205, 247, 289], "fergusonii": [0, 10, 140, 205, 247, 289], "b253": [0, 10, 140, 205, 247, 289], "atlantibact": [0, 10, 140, 205, 247, 289], "hermannii": [0, 10, 140, 205, 247, 289], "105704": [0, 10, 140, 205, 247, 289], "pseudescherichia": [0, 10, 140, 205, 247, 289], "vulneri": [0, 10, 140, 205, 247, 289], "102420": [0, 10, 140, 205, 247, 289], "hafnia": [0, 10, 140, 205, 247, 289], "alvei": [0, 10, 140, 205, 247, 289], "fb1": [0, 10, 140, 205, 247, 289], "oxytoca": [0, 10, 140, 205, 247, 289], "morganella": [0, 10, 140, 205, 247, 289], "morganii": [0, 10, 140, 205, 247, 289], "proteu": [0, 10, 140, 205, 247, 289], "mirabili": [0, 10, 140, 205, 247, 289], "hi4320": [0, 10, 140, 205, 247, 289], "providencia": [0, 10, 140, 205, 247, 289], "rettgeri": [0, 10, 140, 205, 247, 289], "1131": [0, 10, 140, 205, 247, 289], "stuartii": [0, 10, 140, 205, 247, 289], "25827": [0, 10, 140, 205, 247, 289], "serratia": [0, 10, 140, 205, 247, 289], "liquefacien": [0, 10, 140, 205, 247, 289], "27592": [0, 10, 140, 205, 247, 289], "marcescen": [0, 10, 140, 205, 247, 289], "db11": [0, 10, 140, 205, 247, 289], "odorifera": [0, 10, 140, 205, 247, 289], "4582": [0, 10, 140, 205, 247, 289], "shigella": [0, 10, 140, 205, 247, 289], "boydii": [0, 10, 140, 205, 247, 289], "cdc": [0, 10, 140, 205, 247, 289], "3083": [0, 10, 140, 205, 247, 289], "dysenteria": [0, 10, 140, 205, 247, 289], "1617": [0, 10, 140, 205, 247, 289], "flexneri": [0, 10, 140, 205, 247, 289], "2a": [0, 10, 140, 205, 247, 289], "301": [0, 10, 140, 205, 247, 289], "sonnei": [0, 10, 140, 205, 247, 289], "ss046": [0, 10, 140, 205, 247, 289], "xenorhabdu": [0, 10, 140, 205, 247, 289], "nematophila": [0, 10, 140, 205, 247, 289], "19061": [0, 10, 140, 205, 247, 289], "enterocolitica": [0, 10, 140, 205, 247, 289], "lc20": [0, 10, 140, 205, 247, 289], "intermedia": [0, 10, 140, 205, 247, 289], "29909": [0, 10, 140, 205, 247, 289], "co92": [0, 10, 140, 205, 247, 289], "pseudotuberculosi": [0, 10, 140, 205, 247, 289], "edwardsiella": [0, 10, 140, 205, 247, 289], "tarda": [0, 10, 140, 205, 247, 289], "15947": [0, 10, 140, 205, 247, 289], "105688": [0, 10, 140, 205, 247, 289], "aeromona": [0, 10, 140, 205, 247, 289], "hydrophila": [0, 10, 140, 205, 247, 289], "7966": [0, 10, 140, 205, 247, 289], "salmonicida": [0, 10, 140, 205, 247, 289], "a449": [0, 10, 140, 205, 247, 289], "media": [0, 10, 140, 205, 247, 289], "w": [0, 9, 10, 140, 205, 247, 289], "veronii": [0, 10, 140, 205, 247, 289], "b565": [0, 10, 140, 205, 247, 289], "photobacterium": [0, 10, 140, 205, 247, 289], "phosphoreum": [0, 10, 140, 205, 247, 289], "ant": [0, 10, 140, 205, 247, 289], "2200": [0, 10, 140, 165, 166, 168, 205, 247, 289], "s14": [0, 10, 140, 205, 247, 289], "alginolyticu": [0, 10, 140, 205, 247, 289], "15630": [0, 10, 140, 205, 247, 289], "17749": [0, 10, 140, 205, 247, 289], "o395": [0, 10, 140, 205, 247, 289], "aliivibrio": [0, 10, 140, 205, 247, 289], "fischeri": [0, 10, 140, 205, 247, 289], "es114": [0, 10, 140, 205, 247, 289], "parahaemolyticu": [0, 10, 140, 205, 247, 289], "rimd": [0, 10, 140, 205, 247, 289], "2210633": [0, 10, 140, 205, 247, 289], "proteolyticu": [0, 10, 140, 205, 247, 289], "13287": [0, 10, 140, 205, 247, 289], "vulnificu": [0, 10, 140, 205, 247, 289], "grimontia": [0, 10, 140, 205, 247, 289], "hollisa": [0, 10, 140, 205, 247, 289], "cip": [0, 10, 140, 205, 247, 289], "101886": [0, 10, 140, 205, 247, 289], "mimicu": [0, 10, 140, 205, 247, 289], "mb451": [0, 10, 140, 205, 247, 289], "campbellii": [0, 10, 140, 205, 247, 289], "1116": [0, 10, 140, 205, 247, 289], "diazotrophicu": [0, 10, 140, 205, 247, 289], "103148": [0, 10, 140, 205, 247, 289], "plesiomona": [0, 10, 140, 205, 247, 289], "shigelloid": [0, 10, 140, 205, 247, 289], "73": [0, 10, 140, 205, 247, 289], "aggregatibact": [0, 10, 140, 205, 247, 289], "actinomycetemcomitan": [0, 10, 140, 205, 247, 289], "hk1651": [0, 10, 140, 205, 247, 289], "actinobacillu": [0, 10, 140, 205, 247, 289], "pleuropneumonia": [0, 10, 140, 205, 247, 289], "4074": [0, 10, 140, 205, 247, 289], "sui": [0, 10, 140, 205, 247, 289], "h91": [0, 10, 140, 205, 247, 289], "0380": [0, 10, 140, 205, 247, 289], "19761": [0, 10, 140, 205, 247, 289], "equuli": [0, 10, 140, 205, 247, 289], "urea": [0, 10, 140, 205, 247, 289], "25976": [0, 10, 140, 205, 247, 289], "haemolyticu": [0, 10, 140, 205, 247, 289], "m21639": [0, 10, 140, 205, 247, 289], "rd": [0, 10, 140, 205, 247, 289], "kw20": [0, 10, 140, 205, 247, 289], "avibacterium": [0, 10, 140, 205, 247, 289], "paragallinarum": [0, 10, 140, 205, 247, 289], "221": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "parainfluenza": [0, 10, 140, 205, 247, 289], "t3t1": [0, 10, 140, 205, 247, 289], "histophilu": [0, 10, 140, 205, 247, 289], "somni": [0, 10, 140, 205, 247, 289], "129pt": [0, 10, 140, 205, 247, 289], "aphrophilu": [0, 10, 140, 205, 247, 289], "nj8700": [0, 10, 140, 205, 247, 289], "paraphrohaemolyticu": [0, 10, 140, 205, 247, 289], "hk411": [0, 10, 140, 205, 247, 289], "glaesserella": [0, 10, 140, 205, 247, 289], "parasui": [0, 10, 140, 205, 247, 289], "zj0906": [0, 10, 140, 205, 247, 289], "segni": [0, 10, 140, 205, 247, 289], "33393": [0, 10, 140, 205, 247, 289], "pasteurella": [0, 10, 140, 205, 247, 289], "multocida": [0, 10, 140, 205, 247, 289], "gallibacterium": [0, 10, 140, 205, 247, 289], "anati": [0, 10, 140, 205, 247, 289], "umn179": [0, 10, 140, 205, 247, 289], "bettya": [0, 10, 140, 205, 247, 289], "2042": [0, 10, 140, 205, 247, 289], "dagmati": [0, 10, 140, 205, 247, 289], "43325": [0, 10, 140, 205, 247, 289], "rodentibact": [0, 10, 140, 205, 247, 289], "pneumotropicu": [0, 10, 140, 205, 247, 289], "anaplasma": [0, 10, 140, 205, 247, 289], "israel": [0, 10, 140, 205, 247, 289], "marginal": [0, 10, 140, 205, 247, 289], "st": [0, 10, 140, 205, 247, 289], "bartonella": [0, 10, 140, 205, 247, 289], "bacilliformi": [0, 10, 140, 205, 247, 289], "kc583": [0, 10, 140, 205, 247, 289], "rsa": [0, 10, 140, 205, 247, 289], "493": [0, 10, 140, 205, 247, 289], "ehrlichia": [0, 10, 140, 205, 247, 289], "ruminantium": [0, 10, 140, 205, 247, 289], "welgevonden": [0, 10, 140, 205, 247, 289], "rickettsia": [0, 10, 140, 205, 247, 289], "conorii": [0, 10, 140, 205, 247, 289], "malish": [0, 10, 140, 205, 247, 289], "prowazekii": [0, 10, 140, 205, 247, 289], "madrid": [0, 10, 140, 205, 247, 289], "rickettsii": [0, 10, 140, 205, 247, 289], "iowa": [0, 10, 140, 205, 247, 289], "orientia": [0, 10, 140, 205, 247, 289], "tsutsugamushi": [0, 10, 140, 205, 247, 289], "boryong": [0, 10, 140, 205, 247, 289], "typhi": [0, 10, 140, 205, 247, 289], "wilmington": [0, 10, 140, 205, 247, 289], "akari": [0, 10, 140, 205, 247, 289], "hartford": [0, 10, 140, 205, 247, 289], "cutlack": [0, 10, 140, 205, 247, 289], "mckiel": [0, 10, 140, 205, 247, 289], "quintana": [0, 10, 140, 205, 247, 289], "toulous": [0, 10, 140, 205, 247, 289], "elizabetha": [0, 10, 140, 205, 247, 289], "f9251": [0, 10, 140, 205, 247, 289], "49927": [0, 10, 140, 205, 247, 289], "uw": [0, 10, 140, 205, 247, 289], "cx": [0, 10, 140, 205, 247, 289], "fragili": [0, 10, 140, 205, 247, 289], "3_1_12": [0, 10, 140, 205, 247, 289], "vpi": [0, 10, 140, 205, 247, 289], "5482": [0, 10, 140, 205, 247, 289], "uniformi": [0, 10, 140, 205, 247, 289], "8492": [0, 10, 140, 205, 247, 289], "vulgatu": [0, 10, 140, 205, 247, 289], "8482": [0, 10, 140, 205, 247, 289], "parabacteroid": [0, 10, 140, 205, 247, 289], "distasoni": [0, 10, 140, 205, 247, 289], "8503": [0, 10, 140, 205, 247, 289], "gracili": [0, 10, 140, 205, 247, 289], "rm3268": [0, 10, 140, 205, 247, 289], "sebaldella": [0, 10, 140, 205, 247, 289], "termitidi": [0, 10, 140, 205, 247, 289], "33386": [0, 10, 140, 205, 247, 289], "ureolyticu": [0, 10, 140, 205, 247, 289], "butyrivibrio": [0, 10, 140, 205, 247, 289], "fibrisolven": [0, 10, 140, 205, 247, 289], "nd3005": [0, 10, 140, 205, 247, 289], "fibrobact": [0, 10, 140, 205, 247, 289], "succinogen": [0, 10, 140, 205, 247, 289], "s85": [0, 10, 140, 205, 247, 289], "porphyromona": [0, 10, 140, 205, 247, 289], "gingivali": [0, 10, 140, 205, 247, 289], "33277": [0, 10, 140, 205, 247, 289], "prevotella": [0, 10, 140, 205, 247, 289], "ruminicola": [0, 10, 140, 205, 247, 289], "loescheii": [0, 10, 140, 205, 247, 289], "19665": [0, 10, 140, 205, 247, 289], "12249": [0, 10, 140, 205, 247, 289], "15930": [0, 10, 140, 205, 247, 289], "wolinella": [0, 10, 140, 205, 247, 289], "1740": [0, 10, 140, 205, 247, 289], "oxalobact": [0, 10, 140, 205, 247, 289], "formigen": [0, 10, 140, 205, 247, 289], "hoxbl": [0, 10, 140, 205, 247, 289], "gonidiaforman": [0, 10, 140, 205, 247, 289], "25563": [0, 10, 140, 205, 247, 289], "mortiferum": [0, 10, 140, 205, 247, 289], "9817": [0, 10, 140, 205, 247, 289], "25586": [0, 10, 140, 205, 247, 289], "perfoeten": [0, 10, 140, 205, 247, 289], "29250": [0, 10, 140, 205, 247, 289], "faecalibacterium": [0, 10, 140, 205, 247, 289], "prausnitzii": [0, 10, 140, 205, 247, 289], "a2": [0, 10, 140, 205, 247, 289], "165": [0, 10, 140, 205, 247, 289], "russii": [0, 10, 140, 205, 247, 289], "25533": [0, 10, 140, 205, 247, 289], "varium": [0, 10, 140, 205, 247, 289], "27725": [0, 10, 140, 205, 247, 289], "necrophorum": [0, 10, 140, 205, 247, 289], "funduliform": [0, 10, 140, 205, 247, 289], "51357": [0, 10, 140, 205, 247, 289], "periodonticum": [0, 10, 140, 205, 247, 289], "33693": [0, 10, 140, 205, 247, 289], "ulceran": [0, 10, 140, 205, 247, 289], "49185": [0, 10, 140, 205, 247, 289], "syntrophomona": [0, 10, 140, 205, 247, 289], "wolfei": [0, 10, 140, 205, 247, 289], "goettingen": [0, 10, 140, 205, 247, 289], "g311": [0, 10, 140, 205, 247, 289], "dichelobact": [0, 10, 140, 205, 247, 289], "nodosu": [0, 10, 140, 205, 247, 289], "vcs1703a": [0, 10, 140, 205, 247, 289], "desulfocurvibact": [0, 10, 140, 205, 247, 289], "africanu": [0, 10, 140, 205, 247, 289], "walvi": [0, 10, 140, 205, 247, 289], "bai": [0, 10, 140, 205, 247, 289], "desulfovibrio": [0, 10, 140, 205, 247, 289], "desulfurican": [0, 10, 140, 205, 247, 289], "nd132": [0, 10, 140, 205, 247, 289], "fructosivoran": [0, 10, 140, 205, 247, 289], "jj": [0, 10, 140, 205, 247, 289], "giga": [0, 10, 140, 205, 247, 289], "1382": [0, 10, 140, 205, 247, 289], "19364": [0, 10, 140, 205, 247, 289], "salexigen": [0, 10, 140, 205, 247, 289], "2638": [0, 10, 140, 205, 247, 289], "hildenborough": [0, 10, 140, 205, 247, 289], "thermodesulfobacterium": [0, 10, 140, 205, 247, 289], "1276": [0, 10, 140, 205, 247, 289], "longu": [0, 10, 140, 205, 247, 289], "6739": [0, 10, 140, 205, 247, 289], "desulfobulbu": [0, 10, 140, 205, 247, 289], "propionicu": [0, 10, 140, 205, 247, 289], "2032": [0, 10, 140, 205, 247, 289], "desulfococcu": [0, 10, 140, 205, 247, 289], "multivoran": [0, 10, 140, 205, 247, 289], "2059": [0, 10, 140, 168, 205, 247, 289], "desulfomicrobium": [0, 10, 140, 205, 247, 289], "baculatum": [0, 10, 140, 205, 247, 289], "piger": [0, 10, 140, 205, 247, 289], "29098": [0, 10, 140, 205, 247, 289], "acidaminococcu": [0, 10, 140, 205, 247, 289], "fermentan": [0, 10, 140, 205, 247, 289], "20731": [0, 10, 140, 205, 247, 289], "megasphaera": [0, 10, 140, 205, 247, 289], "elsdenii": [0, 10, 140, 205, 247, 289], "20460": [0, 10, 140, 205, 247, 289], "nitrobact": [0, 10, 140, 205, 247, 289], "hamburgensi": [0, 10, 140, 205, 247, 289], "x14": [0, 10, 140, 205, 247, 289], "winogradskyi": [0, 10, 140, 205, 247, 289], "nb": [0, 10, 140, 205, 247, 289], "255": [0, 10, 140, 169, 205, 247, 289], "nitrosomona": [0, 10, 140, 205, 247, 289], "europaea": [0, 10, 140, 205, 247, 289], "19718": [0, 10, 140, 205, 247, 289], "eutropha": [0, 10, 140, 205, 247, 289], "c91": [0, 10, 140, 205, 247, 289], "acidithiobacillu": [0, 10, 140, 205, 247, 289], "23270": [0, 10, 140, 205, 247, 289], "starkeya": [0, 10, 140, 205, 247, 289], "novella": [0, 10, 140, 205, 247, 289], "506": [0, 10, 140, 205, 247, 289], "thiomona": [0, 10, 140, 205, 247, 289], "k12": [0, 10, 140, 205, 247, 289], "halothiobacillu": [0, 10, 140, 205, 247, 289], "neapolitanu": [0, 10, 140, 205, 247, 289], "thermithiobacillu": [0, 10, 140, 205, 247, 289], "tepidariu": [0, 10, 140, 205, 247, 289], "3134": [0, 10, 140, 205, 247, 289], "thiooxidan": [0, 10, 140, 205, 247, 289], "19377": [0, 10, 140, 205, 247, 289], "thiobacillu": [0, 10, 140, 205, 247, 289], "thioparu": [0, 10, 140, 205, 247, 289], "505": [0, 10, 140, 205, 247, 289], "thiomicrospira": [0, 10, 140, 205, 247, 289], "pelophila": [0, 10, 140, 205, 247, 289], "1534": [0, 10, 140, 205, 247, 289], "hydrogenobact": [0, 10, 140, 205, 247, 289], "tk": [0, 10, 140, 205, 247, 289], "jake": [0, 10, 140, 205, 247, 289], "chaffeensi": [0, 10, 140, 205, 247, 289], "arkansa": [0, 10, 140, 205, 247, 289], "phagocytophilum": [0, 10, 140, 205, 247, 289], "hz": [0, 10, 140, 205, 247, 289], "neorickettsia": [0, 10, 140, 205, 247, 289], "risticii": [0, 10, 140, 205, 247, 289], "illinoi": [0, 10, 140, 205, 247, 289], "sennetsu": [0, 10, 140, 205, 247, 289], "miyayama": [0, 10, 140, 205, 247, 289], "bdellovibrio": [0, 10, 140, 205, 247, 289], "bacteriovoru": [0, 10, 140, 205, 247, 289], "hd100": [0, 10, 140, 205, 247, 289], "herbaspirillum": [0, 10, 140, 205, 247, 289], "seropedica": [0, 10, 140, 205, 247, 289], "smr1": [0, 10, 140, 205, 247, 289], "selenomona": [0, 10, 140, 205, 247, 289], "ab3002": [0, 10, 140, 205, 247, 289], "cellulophaga": [0, 10, 140, 205, 247, 289], "lytica": [0, 10, 140, 205, 247, 289], "7489": [0, 10, 140, 205, 247, 289], "saccharicrini": [0, 10, 140, 205, 247, 289], "9555": [0, 10, 140, 205, 247, 289], "21142": [0, 10, 140, 205, 247, 289], "pedobact": [0, 10, 140, 205, 247, 289], "heparinu": [0, 10, 140, 205, 247, 289], "2366": [0, 10, 140, 205, 247, 289], "cytophaga": [0, 10, 140, 205, 247, 289], "hutchinsonii": [0, 10, 140, 205, 247, 289], "33406": [0, 10, 140, 205, 247, 289], "johnsonia": [0, 10, 140, 205, 247, 289], "uw101": [0, 10, 140, 205, 247, 289], "marinilabilia": [0, 10, 140, 205, 247, 289], "salmonicolor": [0, 10, 140, 205, 247, 289], "21150": [0, 10, 140, 205, 247, 289], "hydati": [0, 10, 140, 205, 247, 289], "solitalea": [0, 10, 140, 205, 247, 289], "3403": [0, 10, 140, 205, 247, 289], "columnar": [0, 10, 140, 205, 247, 289], "49512": [0, 10, 140, 205, 247, 289], "bernardetia": [0, 10, 140, 205, 247, 289], "litorali": [0, 10, 140, 205, 247, 289], "6794": [0, 10, 140, 205, 247, 289], "marivirga": [0, 10, 140, 205, 247, 289], "tractuosa": [0, 10, 140, 205, 247, 289], "4126": [0, 10, 140, 205, 247, 289], "saprospira": [0, 10, 140, 205, 247, 289], "lewin": [0, 10, 140, 205, 247, 289], "weeksella": [0, 10, 140, 205, 247, 289], "virosa": [0, 10, 140, 205, 247, 289], "16922": [0, 10, 140, 205, 247, 289], "bergeyella": [0, 10, 140, 205, 247, 289], "zoohelcum": [0, 10, 140, 205, 247, 289], "43767": [0, 10, 140, 205, 247, 289], "capnocytophaga": [0, 10, 140, 205, 247, 289], "33624": [0, 10, 140, 205, 247, 289], "ochracea": [0, 10, 140, 205, 247, 289], "f0287": [0, 10, 140, 205, 247, 289], "sputigena": [0, 10, 140, 205, 247, 289], "33612": [0, 10, 140, 205, 247, 289], "beggiatoa": [0, 10, 140, 205, 247, 289], "alba": [0, 10, 140, 205, 247, 289], "b18ld": [0, 10, 140, 205, 247, 289], "microscilla": [0, 10, 140, 205, 247, 289], "23134": [0, 10, 140, 205, 247, 289], "thiothrix": [0, 10, 140, 205, 247, 289], "nivea": [0, 10, 140, 205, 247, 289], "5205": [0, 10, 140, 205, 247, 289], "afipia": [0, 10, 140, 205, 247, 289], "clevelandensi": [0, 10, 140, 205, 247, 289], "49720": [0, 10, 140, 205, 247, 289], "53690": [0, 10, 140, 205, 247, 289], "erythrobact": [0, 10, 140, 205, 247, 289], "allochromatium": [0, 10, 140, 205, 247, 289], "vinosum": [0, 10, 140, 205, 247, 289], "halorhodospira": [0, 10, 140, 205, 247, 289], "halochlori": [0, 10, 140, 205, 247, 289], "halophila": [0, 10, 140, 205, 247, 289], "sl1": [0, 10, 140, 205, 247, 289], "rhodobact": [0, 10, 140, 205, 247, 289], "sb": [0, 10, 140, 205, 247, 289], "1003": [0, 10, 140, 205, 247, 289], "sphaeroid": [0, 10, 140, 205, 247, 289], "rhodomicrobium": [0, 10, 140, 205, 247, 289], "vannielii": [0, 10, 140, 205, 247, 289], "17100": [0, 10, 140, 205, 247, 289], "rhodopseudomona": [0, 10, 140, 205, 247, 289], "palustri": [0, 10, 140, 205, 247, 289], "cga009": [0, 10, 140, 205, 247, 289], "phaeospirillum": [0, 10, 140, 205, 247, 289], "fulvum": [0, 10, 140, 205, 247, 289], "mgu": [0, 10, 140, 205, 247, 289], "k5": [0, 10, 140, 205, 247, 289], "molischianum": [0, 10, 140, 205, 247, 289], "120": [0, 10, 140, 205, 247, 289], "pararhodospirillum": [0, 10, 140, 205, 247, 289], "photometricum": [0, 10, 140, 205, 247, 289], "122": [0, 10, 140, 165, 205, 247, 289], "rhodospirillum": [0, 10, 140, 205, 247, 289], "rubrum": [0, 10, 140, 205, 247, 289], "11170": [0, 10, 140, 205, 247, 289], "rhodovibrio": [0, 10, 140, 205, 247, 289], "9154": [0, 10, 140, 205, 247, 289], "chlorobium": [0, 10, 140, 205, 247, 289], "limicola": [0, 10, 140, 205, 247, 289], "245": [0, 10, 140, 205, 247, 289], "phaeovibrioid": [0, 10, 140, 205, 247, 289], "265": [0, 10, 140, 205, 247, 289], "phaeobacteroid": [0, 10, 140, 205, 247, 289], "266": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "chlorobaculum": [0, 10, 140, 205, 247, 289], "tepidum": [0, 10, 140, 205, 247, 289], "tl": [0, 10, 140, 205, 247, 289], "pelodictyon": [0, 10, 140, 205, 247, 289], "luteolum": [0, 10, 140, 205, 247, 289], "273": [0, 10, 140, 205, 247, 289], "prosthecochlori": [0, 10, 140, 205, 247, 289], "aestuarii": [0, 10, 140, 205, 247, 289], "271": [0, 10, 140, 205, 247, 289], "j": [0, 9, 10, 140, 205, 247, 289, 324, 325], "fl": [0, 10, 140, 205, 247, 289], "chlorogloeopsi": [0, 10, 140, 205, 247, 289], "fritschii": [0, 10, 140, 205, 247, 289], "pcc": [0, 10, 140, 205, 247, 289], "6912": [0, 10, 140, 205, 247, 289], "microcysti": [0, 10, 140, 205, 247, 289], "ni": [0, 10, 140, 205, 247, 289], "843": [0, 10, 140, 205, 247, 289], "6714": [0, 10, 140, 205, 247, 289], "6803": [0, 10, 140, 205, 247, 289], "substr": [0, 10, 140, 205, 247, 289], "kazusa": [0, 10, 140, 205, 247, 289], "planktothrix": [0, 10, 140, 205, 247, 289], "agardhii": [0, 10, 140, 205, 247, 289], "niva": [0, 10, 140, 205, 247, 289], "cya": [0, 10, 140, 205, 247, 289], "126": [0, 10, 140, 165, 166, 168, 205, 247, 289], "anabaena": [0, 10, 140, 205, 247, 289], "cylindrica": [0, 10, 140, 205, 247, 289], "7122": [0, 10, 140, 205, 247, 289], "leptolyngbya": [0, 10, 140, 205, 247, 289], "boryana": [0, 10, 140, 205, 247, 289], "6306": [0, 10, 140, 205, 247, 289], "tolypothrix": [0, 10, 140, 205, 247, 289], "7601": [0, 10, 140, 205, 247, 289], "trichodesmium": [0, 10, 140, 205, 247, 289], "erythraeum": [0, 10, 140, 205, 247, 289], "ims101": [0, 10, 140, 205, 247, 289], "prochlorococcu": [0, 10, 140, 205, 247, 289], "as9601": [0, 10, 140, 205, 247, 289], "prochlorothrix": [0, 10, 140, 205, 247, 289], "hollandica": [0, 10, 140, 205, 247, 289], "9006": [0, 10, 140, 205, 247, 289], "calu": [0, 10, 140, 205, 247, 289], "1027": [0, 10, 140, 205, 247, 289], "nitrosococcu": [0, 10, 140, 205, 247, 289], "oceani": [0, 10, 140, 205, 247, 289], "19707": [0, 10, 140, 205, 247, 289], "nitrosospira": [0, 10, 140, 205, 247, 289], "multiformi": [0, 10, 140, 205, 247, 289], "25196": [0, 10, 140, 205, 247, 289], "leuconostoc": [0, 10, 140, 205, 247, 289], "gelidum": [0, 10, 140, 205, 247, 289], "gasicomitatum": [0, 10, 140, 205, 247, 289], "18811": [0, 10, 140, 205, 247, 289], "mesenteroid": [0, 10, 140, 205, 247, 289], "8293": [0, 10, 140, 205, 247, 289], "lacti": [0, 10, 140, 205, 247, 289], "oenococcu": [0, 10, 140, 205, 247, 289], "oeni": [0, 10, 140, 205, 247, 289], "psu": [0, 10, 140, 205, 247, 289], "weissella": [0, 10, 140, 205, 247, 289], "paramesenteroid": [0, 10, 140, 205, 247, 289], "33313": [0, 10, 140, 205, 247, 289], "fallax": [0, 10, 140, 205, 247, 289], "3537": [0, 10, 140, 205, 247, 289], "carnosum": [0, 10, 140, 205, 247, 289], "jb16": [0, 10, 140, 205, 247, 289], "pediococcu": [0, 10, 140, 205, 247, 289], "acidilactici": [0, 10, 140, 205, 247, 289], "20284": [0, 10, 140, 205, 247, 289], "pentosaceu": [0, 10, 140, 205, 247, 289], "25745": [0, 10, 140, 205, 247, 289], "finegoldia": [0, 10, 140, 205, 247, 289], "magna": [0, 10, 140, 205, 247, 289], "53516": [0, 10, 140, 205, 247, 289], "peptostreptococcu": [0, 10, 140, 205, 247, 289], "anaerobiu": [0, 10, 140, 205, 247, 289], "4330": [0, 10, 140, 205, 247, 289], "2949": [0, 10, 140, 205, 247, 289], "ruminococcu": [0, 10, 140, 205, 247, 289], "flavefacien": [0, 10, 140, 205, 247, 289], "fd": [0, 10, 140, 205, 247, 289], "micrococcu": [0, 10, 140, 205, 247, 289], "luteu": [0, 10, 140, 205, 247, 289], "2665": [0, 10, 140, 205, 247, 289], "dermacoccu": [0, 10, 140, 205, 247, 289], "nishinomiyaensi": [0, 10, 140, 205, 247, 289], "kytococcu": [0, 10, 140, 205, 247, 289], "sedentariu": [0, 10, 140, 205, 247, 289], "20547": [0, 10, 140, 205, 247, 289], "mu50": [0, 10, 140, 205, 247, 289], "carnosu": [0, 10, 140, 205, 247, 289], "tm300": [0, 10, 140, 205, 247, 289], "epidermidi": [0, 10, 140, 205, 247, 289], "rp62a": [0, 10, 140, 205, 247, 289], "jcsc1435": [0, 10, 140, 205, 247, 289], "hyicu": [0, 10, 140, 205, 247, 289], "intermediu": [0, 10, 140, 205, 247, 289], "11048": [0, 10, 140, 205, 247, 289], "simulan": [0, 10, 140, 205, 247, 289], "umc": [0, 10, 140, 205, 247, 289], "990": [0, 10, 140, 205, 247, 289], "xylosu": [0, 10, 140, 205, 247, 289], "homini": [0, 10, 140, 205, 247, 289], "sk119": [0, 10, 140, 205, 247, 289], "warneri": [0, 10, 140, 205, 247, 289], "l37603": [0, 10, 140, 205, 247, 289], "sciuri": [0, 10, 140, 205, 247, 289], "z8": [0, 10, 140, 205, 247, 289], "gordonii": [0, 10, 140, 205, 247, 289], "challi": [0, 10, 140, 205, 247, 289], "ch1": [0, 10, 140, 205, 247, 289], "tigurinu": [0, 10, 140, 205, 247, 289], "az_3a": [0, 10, 140, 205, 247, 289], "salivariu": [0, 10, 140, 205, 247, 289], "sanguini": [0, 10, 140, 205, 247, 289], "sk1057": [0, 10, 140, 205, 247, 289], "r61": [0, 10, 140, 205, 247, 289], "18311": [0, 10, 140, 205, 247, 289], "mutan": [0, 10, 140, 205, 247, 289], "ua159": [0, 10, 140, 205, 247, 289], "sobrinu": [0, 10, 140, 205, 247, 289], "w1703": [0, 10, 140, 205, 247, 289], "agalactia": [0, 10, 140, 205, 247, 289], "14747": [0, 10, 140, 205, 247, 289], "r6": [0, 10, 140, 205, 247, 289], "pyogen": [0, 10, 140, 205, 247, 289], "downei": [0, 10, 140, 205, 247, 289], "f0415": [0, 10, 140, 205, 247, 289], "parasanguini": [0, 10, 140, 205, 247, 289], "903": [0, 10, 140, 205, 247, 289], "blautia": [0, 10, 140, 205, 247, 289], "20583": [0, 10, 140, 205, 247, 289], "faecalicoccu": [0, 10, 140, 205, 247, 289], "pleomorphu": [0, 10, 140, 205, 247, 289], "20574": [0, 10, 140, 205, 247, 289], "anginosu": [0, 10, 140, 205, 247, 289], "dora_7": [0, 10, 140, 205, 247, 289], "fsl": [0, 10, 140, 205, 247, 289], "z3": [0, 10, 140, 205, 247, 289], "227": [0, 10, 140, 205, 247, 289], "criceti": [0, 10, 140, 205, 247, 289], "dysgalactia": [0, 10, 140, 205, 247, 289], "equisimili": [0, 10, 140, 205, 247, 289], "2713": [0, 10, 140, 205, 247, 289], "equinu": [0, 10, 140, 205, 247, 289], "9812": [0, 10, 140, 205, 247, 289], "equi": [0, 10, 140, 205, 247, 289], "zooepidemicu": [0, 10, 140, 205, 247, 289], "b196": [0, 10, 140, 205, 247, 289], "11558": [0, 10, 140, 205, 247, 289], "porcinu": [0, 10, 140, 205, 247, 289], "jelinkova": [0, 10, 140, 205, 247, 289], "176": [0, 10, 140, 205, 247, 289], "ratti": [0, 10, 140, 205, 247, 289], "20564": [0, 10, 140, 205, 247, 289], "vestibulari": [0, 10, 140, 205, 247, 289], "f0396": [0, 10, 140, 205, 247, 289], "feru": [0, 10, 140, 205, 247, 289], "20646": [0, 10, 140, 205, 247, 289], "inia": [0, 10, 140, 205, 247, 289], "parauberi": [0, 10, 140, 205, 247, 289], "ncfd": [0, 10, 140, 205, 247, 289], "2020": [0, 6, 10, 140, 169, 205, 247, 289], "uberi": [0, 10, 140, 205, 247, 289], "0140j": [0, 10, 140, 205, 247, 289], "enterococcu": [0, 10, 140, 205, 247, 289], "v583": [0, 10, 140, 205, 247, 289], "faecium": [0, 10, 140, 205, 247, 289], "c68": [0, 10, 140, 205, 247, 289], "gallinarum": [0, 10, 140, 205, 247, 289], "eg2": [0, 10, 140, 205, 247, 289], "hira": [0, 10, 140, 205, 247, 289], "9790": [0, 10, 140, 205, 247, 289], "columba": [0, 10, 140, 205, 247, 289], "7374": [0, 10, 140, 205, 247, 289], "51263": [0, 10, 140, 205, 247, 289], "sulfureu": [0, 10, 140, 205, 247, 289], "49903": [0, 10, 140, 205, 247, 289], "lactococcu": [0, 10, 140, 205, 247, 289], "cremori": [0, 10, 140, 205, 247, 289], "sk11": [0, 10, 140, 205, 247, 289], "garviea": [0, 10, 140, 205, 247, 289], "dcc43": [0, 10, 140, 205, 247, 289], "piscium": [0, 10, 140, 205, 247, 289], "mkfs47": [0, 10, 140, 205, 247, 289], "raffinolacti": [0, 10, 140, 205, 247, 289], "4877": [0, 10, 140, 205, 247, 289], "aerococcu": [0, 10, 140, 205, 247, 289], "urina": [0, 10, 140, 205, 247, 289], "col10a": [0, 10, 140, 205, 247, 289], "viridan": [0, 10, 140, 205, 247, 289], "11563": [0, 10, 140, 205, 247, 289], "4311": [0, 10, 140, 205, 247, 289], "gemella": [0, 10, 140, 205, 247, 289], "haemolysan": [0, 10, 140, 205, 247, 289], "m341": [0, 10, 140, 205, 247, 289], "atopobium": [0, 10, 140, 205, 247, 289], "minutum": [0, 10, 140, 205, 247, 289], "10063974": [0, 10, 140, 205, 247, 289], "parvulum": [0, 10, 140, 205, 247, 289], "20469": [0, 10, 140, 205, 247, 289], "rima": [0, 10, 140, 205, 247, 289], "49626": [0, 10, 140, 205, 247, 289], "amyloliquefacien": [0, 10, 140, 205, 247, 289], "y2": [0, 10, 140, 205, 247, 289], "aneurinibacillu": [0, 10, 140, 205, 247, 289], "aneurinilyticu": [0, 10, 140, 205, 247, 289], "12856": [0, 10, 140, 205, 247, 289], "anthraci": [0, 10, 140, 205, 247, 289], "am": [0, 10, 140, 205, 247, 289], "brevibacillu": [0, 10, 140, 205, 247, 289], "x23": [0, 10, 140, 205, 247, 289], "coagulan": [0, 10, 140, 205, 247, 289], "36d1": [0, 10, 140, 205, 247, 289], "firmu": [0, 10, 140, 205, 247, 289], "ds1": [0, 10, 140, 205, 247, 289], "licheniformi": [0, 10, 140, 205, 247, 289], "14580": [0, 10, 140, 205, 247, 289], "megaterium": [0, 10, 140, 205, 247, 289], "qm": [0, 10, 140, 205, 247, 289], "b1551": [0, 10, 140, 205, 247, 289], "mycoid": [0, 10, 140, 205, 247, 289], "kbab4": [0, 10, 140, 205, 247, 289], "paenibacillu": [0, 10, 140, 205, 247, 289], "polymyxa": [0, 10, 140, 205, 247, 289], "sc2": [0, 10, 140, 205, 247, 289], "psychrosaccharolyticu": [0, 10, 140, 205, 247, 289], "23296": [0, 10, 140, 205, 247, 289], "pumilu": [0, 10, 140, 205, 247, 289], "safr": [0, 10, 140, 205, 247, 289], "032": [0, 10, 140, 205, 247, 289], "bacteria": [0, 10, 140, 205, 247, 289], "akibai": [0, 10, 140, 205, 247, 289], "9157": [0, 10, 140, 205, 247, 289], "cellulosilyticu": [0, 10, 140, 205, 247, 289], "2522": [0, 10, 140, 205, 247, 289], "lysinibacillu": [0, 10, 140, 205, 247, 289], "sphaericu": [0, 10, 140, 205, 247, 289], "ot4b": [0, 10, 140, 205, 247, 289], "168": [0, 10, 140, 205, 247, 289], "parageobacillu": [0, 10, 140, 205, 247, 289], "thermoglucosidasiu": [0, 10, 140, 205, 247, 289], "c56": [0, 10, 140, 205, 247, 289], "ys93": [0, 10, 140, 205, 247, 289], "thuringiensi": [0, 10, 140, 205, 247, 289], "kurstaki": [0, 10, 140, 205, 247, 289], "alcalophilu": [0, 10, 140, 205, 247, 289], "27647": [0, 10, 140, 205, 247, 289], "cgmcc": [0, 10, 140, 205, 247, 289], "3604": [0, 10, 140, 205, 247, 289], "amphibacillu": [0, 10, 140, 205, 247, 289], "xylanu": [0, 10, 140, 205, 247, 289], "15112": [0, 10, 140, 205, 247, 289], "alicyclobacillu": [0, 10, 140, 205, 247, 289], "acidoterrestri": [0, 10, 140, 205, 247, 289], "49025": [0, 10, 140, 205, 247, 289], "atrophaeu": [0, 10, 140, 205, 247, 289], "1942": [0, 10, 140, 205, 247, 289], "geobacillu": [0, 10, 140, 205, 247, 289], "kaustophilu": [0, 10, 140, 205, 247, 289], "hta426": [0, 10, 140, 205, 247, 289], "larva": [0, 10, 140, 205, 247, 289, 323], "25430": [0, 10, 140, 205, 247, 289], "laterosporu": [0, 10, 140, 205, 247, 289], "methanolicu": [0, 10, 140, 205, 247, 289], "pb1": [0, 10, 140, 205, 247, 289], "peribacillu": [0, 10, 140, 205, 247, 289], "simplex": [0, 10, 140, 205, 247, 289], "ba2h3": [0, 10, 140, 205, 247, 289], "smithii": [0, 10, 140, 205, 247, 289], "7_3_47faa": [0, 10, 140, 205, 247, 289], "virgibacillu": [0, 10, 140, 205, 247, 289], "halodenitrifican": [0, 10, 140, 205, 247, 289], "1806": [0, 10, 140, 205, 247, 289], "acetobutylicum": [0, 10, 140, 205, 247, 289], "824": [0, 10, 140, 205, 247, 289], "paraclostridium": [0, 10, 140, 205, 247, 289], "bifermentan": [0, 10, 140, 205, 247, 289], "wym": [0, 10, 140, 205, 247, 289], "kyoto": [0, 10, 30, 59, 66, 140, 205, 247, 289, 325], "butyricum": [0, 10, 140, 205, 247, 289], "e4": [0, 10, 140, 205, 247, 289], "bont": [0, 10, 140, 205, 247, 289], "bl5262": [0, 10, 140, 205, 247, 289], "cellulovoran": [0, 10, 140, 205, 247, 289], "743b": [0, 10, 140, 205, 247, 289], "clostridioid": [0, 10, 140, 205, 247, 289], "difficil": [0, 10, 140, 205, 247, 289], "ruminiclostridium": [0, 10, 140, 205, 247, 289], "josui": [0, 10, 140, 205, 247, 289], "17888": [0, 10, 140, 205, 247, 289], "pasteurianum": [0, 10, 140, 205, 247, 289], "bc1": [0, 10, 140, 205, 247, 289], "perfringen": [0, 10, 140, 205, 247, 289], "13124": [0, 10, 140, 205, 247, 289], "paeniclostridium": [0, 10, 140, 205, 247, 289], "sordellii": [0, 10, 140, 205, 247, 289], "9048": [0, 10, 140, 205, 247, 289], "29733": [0, 10, 140, 205, 247, 289], "sporogen": [0, 10, 140, 205, 247, 289], "pa": [0, 10, 140, 205, 247, 289], "3679": [0, 10, 140, 205, 247, 289], "thermoclostridium": [0, 10, 140, 205, 247, 289], "stercorarium": [0, 10, 140, 205, 247, 289], "8532": [0, 10, 140, 205, 247, 289], "acetoanaerobium": [0, 10, 140, 205, 247, 289], "sticklandii": [0, 10, 140, 205, 247, 289], "tetani": [0, 10, 140, 205, 247, 289], "12124569": [0, 10, 140, 205, 247, 289], "hungateiclostridium": [0, 10, 140, 205, 247, 289], "thermocellum": [0, 10, 140, 205, 247, 289], "27405": [0, 10, 140, 205, 247, 289], "thermoanaerobact": [0, 10, 140, 205, 247, 289], "thermohydrosulfuricu": [0, 10, 140, 205, 247, 289], "wc1": [0, 10, 140, 205, 247, 289], "thermoanaerobacterium": [0, 10, 140, 205, 247, 289], "thermosaccharolyticum": [0, 10, 140, 205, 247, 289], "tyrobutyricum": [0, 10, 140, 205, 247, 289], "25755": [0, 10, 140, 205, 247, 289], "11008": [0, 10, 140, 205, 247, 289], "beijerinckii": [0, 10, 140, 205, 247, 289], "8052": [0, 10, 140, 205, 247, 289], "cellulolyticum": [0, 10, 140, 205, 247, 289], "h10": [0, 10, 140, 205, 247, 289], "moorella": [0, 10, 140, 205, 247, 289], "thermoacetica": [0, 10, 140, 205, 247, 289], "39073": [0, 10, 140, 205, 247, 289], "cadaveri": [0, 10, 140, 205, 247, 289], "agr2141": [0, 10, 140, 205, 247, 289], "kluyveri": [0, 10, 140, 205, 247, 289], "555": [0, 10, 140, 205, 247, 289], "ljungdahlii": [0, 10, 140, 205, 247, 289], "13528": [0, 10, 140, 205, 247, 289], "mangenotii": [0, 10, 140, 205, 247, 289], "tr": [0, 10, 140, 205, 247, 289], "novyi": [0, 10, 140, 205, 247, 289], "9691": [0, 10, 140, 205, 247, 289], "erysipelatoclostridium": [0, 10, 140, 205, 247, 289], "ramosum": [0, 10, 140, 205, 247, 289], "1402": [0, 10, 140, 205, 247, 289], "scatologen": [0, 10, 140, 205, 247, 289], "tetanomorphum": [0, 10, 140, 205, 247, 289], "665": [0, 10, 140, 205, 247, 289], "gottschalkia": [0, 10, 140, 205, 247, 289], "acidurici": [0, 10, 140, 205, 247, 289], "9a": [0, 10, 140, 205, 247, 289], "peptoclostridium": [0, 10, 140, 205, 247, 289], "litoral": [0, 10, 140, 205, 247, 289], "5388": [0, 10, 140, 205, 247, 289], "baratii": [0, 10, 140, 205, 247, 289], "sullivan": [0, 10, 140, 205, 247, 289], "desulfosporosinu": [0, 10, 140, 205, 247, 289], "orienti": [0, 10, 140, 205, 247, 289], "765": [0, 10, 140, 205, 247, 289], "desulfotomaculum": [0, 10, 140, 205, 247, 289], "rumini": [0, 10, 140, 205, 247, 289], "2154": [0, 10, 140, 205, 247, 289], "nigrifican": [0, 10, 140, 205, 247, 289], "574": [0, 10, 140, 205, 247, 289], "halobacillu": [0, 10, 140, 205, 247, 289], "halophilu": [0, 10, 140, 205, 247, 289], "2266": [0, 10, 140, 205, 247, 289], "sporosarcina": [0, 10, 140, 205, 247, 289], "2281": [0, 10, 140, 205, 247, 289], "leifsonia": [0, 10, 140, 205, 247, 289], "xyli": [0, 10, 140, 205, 247, 289], "cynodonti": [0, 10, 140, 205, 247, 289], "46306": [0, 10, 140, 205, 247, 289], "lactobacillu": [0, 10, 140, 205, 247, 289], "acidophilu": [0, 10, 140, 205, 247, 289], "30sc": [0, 10, 140, 205, 247, 289], "367": [0, 10, 140, 205, 247, 289], "buchneri": [0, 10, 140, 205, 247, 289], "11577": [0, 10, 140, 205, 247, 289], "casei": [0, 10, 140, 205, 247, 289], "bl23": [0, 10, 140, 205, 247, 289], "confusa": [0, 10, 140, 205, 247, 289], "lbae": [0, 10, 140, 205, 247, 289], "c39": [0, 10, 140, 205, 247, 289], "delbrueckii": [0, 10, 140, 205, 247, 289], "bulgaricu": [0, 10, 140, 205, 247, 289], "2038": [0, 10, 140, 205, 247, 289], "helveticu": [0, 10, 140, 205, 247, 289], "cnrz32": [0, 10, 140, 205, 247, 289], "hilgardii": [0, 10, 140, 205, 247, 289], "20176": [0, 10, 140, 205, 247, 289], "8290": [0, 10, 140, 205, 247, 289], "pentosu": [0, 10, 140, 205, 247, 289], "kca1": [0, 10, 140, 205, 247, 289], "plantarum": [0, 10, 140, 205, 247, 289], "wcfs1": [0, 10, 140, 205, 247, 289], "gasseri": [0, 10, 140, 205, 247, 289], "33323": [0, 10, 140, 205, 247, 289], "paracasei": [0, 10, 140, 205, 247, 289], "25302": [0, 10, 140, 205, 247, 289], "reuteri": [0, 10, 140, 205, 247, 289], "sakei": [0, 10, 140, 205, 247, 289], "23k": [0, 10, 140, 205, 247, 289], "amylovoru": [0, 10, 140, 205, 247, 289], "grl": [0, 10, 140, 205, 247, 289], "1112": [0, 10, 140, 205, 247, 289], "animali": [0, 10, 140, 205, 247, 289], "coryniformi": [0, 10, 140, 205, 247, 289], "3167": [0, 10, 140, 205, 247, 289], "20001": [0, 10, 140, 205, 247, 289], "farcimini": [0, 10, 140, 205, 247, 289], "3681": [0, 10, 140, 205, 247, 289], "20184": [0, 10, 140, 205, 247, 289], "fermentum": [0, 10, 140, 205, 247, 289], "ifo": [0, 10, 140, 205, 247, 289], "3956": [0, 10, 140, 205, 247, 289], "fructivoran": [0, 10, 140, 205, 247, 289], "3543": [0, 10, 140, 205, 247, 289], "20203": [0, 10, 140, 205, 247, 289], "halotoleran": [0, 10, 140, 205, 247, 289], "20190": [0, 10, 140, 205, 247, 289], "asf361": [0, 10, 140, 205, 247, 289], "27782": [0, 10, 140, 205, 247, 289], "ucc118": [0, 10, 140, 205, 247, 289], "sanfranciscensi": [0, 10, 140, 205, 247, 289], "tmw": [0, 10, 140, 205, 247, 289], "1304": [0, 10, 140, 205, 247, 289], "kandleria": [0, 10, 140, 205, 247, 289], "vitulina": [0, 10, 140, 205, 247, 289], "mc3001": [0, 10, 140, 205, 247, 289], "fructobacillu": [0, 10, 140, 205, 247, 289], "fructosu": [0, 10, 140, 205, 247, 289], "3544": [0, 10, 140, 205, 247, 289], "ori": [0, 10, 140, 205, 247, 289], "f0423": [0, 10, 140, 205, 247, 289], "5837": [0, 10, 140, 205, 247, 289], "49540": [0, 10, 140, 205, 247, 289], "ivanovii": [0, 10, 140, 205, 247, 289], "londoniensi": [0, 10, 140, 205, 247, 289], "egd": [0, 10, 140, 205, 247, 289], "seeligeri": [0, 10, 140, 205, 247, 289], "2b": [0, 10, 140, 205, 247, 289], "slcc3954": [0, 10, 140, 205, 247, 289], "grayi": [0, 10, 140, 205, 247, 289], "20601": [0, 10, 140, 205, 247, 289], "innocua": [0, 10, 140, 205, 247, 289], "clip11262": [0, 10, 140, 205, 247, 289], "welshimeri": [0, 10, 140, 205, 247, 289], "6b": [0, 10, 140, 205, 247, 289], "slcc5334": [0, 10, 140, 205, 247, 289], "renibacterium": [0, 10, 140, 205, 247, 289], "salmoninarum": [0, 10, 140, 205, 247, 289], "33209": [0, 10, 140, 205, 247, 289], "erysipelothrix": [0, 10, 140, 205, 247, 289], "rhusiopathia": [0, 10, 140, 205, 247, 289], "fujisawa": [0, 10, 140, 205, 247, 289], "alloiococcu": [0, 10, 140, 205, 247, 289], "otiti": [0, 10, 140, 205, 247, 289], "51267": [0, 10, 140, 205, 247, 289], "actinomyc": [0, 10, 140, 205, 247, 289], "naeslundii": [0, 10, 140, 205, 247, 289], "howel": [0, 10, 140, 205, 247, 289], "279": [0, 10, 140, 205, 247, 289], "viscosu": [0, 10, 140, 205, 247, 289], "c505": [0, 10, 140, 205, 247, 289], "israelii": [0, 10, 140, 205, 247, 289], "43320": [0, 10, 140, 205, 247, 289], "schaalia": [0, 10, 140, 205, 247, 289], "odontolytica": [0, 10, 140, 205, 247, 289], "17982": [0, 10, 140, 205, 247, 289], "trueperella": [0, 10, 140, 205, 247, 289], "tp8": [0, 10, 140, 205, 247, 289], "arthrobact": [0, 10, 140, 205, 247, 289], "globiformi": [0, 10, 140, 205, 247, 289], "12137": [0, 10, 140, 205, 247, 289], "bifidobacterium": [0, 10, 140, 205, 247, 289], "adolescenti": [0, 10, 140, 205, 247, 289], "bifidum": [0, 10, 140, 205, 247, 289], "41171": [0, 10, 140, 205, 247, 289], "angulatum": [0, 10, 140, 205, 247, 289], "20098": [0, 10, 140, 205, 247, 289], "7096": [0, 10, 140, 205, 247, 289], "asteroid": [0, 10, 140, 205, 247, 289], "prl2011": [0, 10, 140, 205, 247, 289], "breve": [0, 10, 140, 205, 247, 289], "ucc2003": [0, 10, 140, 205, 247, 289], "catenulatum": [0, 10, 140, 205, 247, 289], "16992": [0, 10, 140, 205, 247, 289], "1194": [0, 10, 140, 205, 247, 289], "11043": [0, 10, 140, 205, 247, 289], "coryneform": [0, 10, 140, 205, 247, 289], "cuniculi": [0, 10, 140, 205, 247, 289], "dentium": [0, 10, 140, 205, 247, 289], "bd1": [0, 10, 140, 205, 247, 289], "indicum": [0, 10, 140, 205, 247, 289], "11587": [0, 10, 140, 205, 247, 289], "20214": [0, 10, 140, 205, 247, 289], "magnum": [0, 10, 140, 205, 247, 289], "pseudolongum": [0, 10, 140, 205, 247, 289], "globosum": [0, 10, 140, 205, 247, 289], "corynebacterium": [0, 10, 140, 205, 247, 289], "ammoniagen": [0, 10, 140, 205, 247, 289], "20306": [0, 10, 140, 205, 247, 289], "brevibacterium": [0, 10, 140, 205, 247, 289], "linen": [0, 10, 140, 205, 247, 289], "bl2": [0, 10, 140, 205, 247, 289], "fimi": [0, 10, 140, 205, 247, 289], "cellulosimicrobium": [0, 10, 140, 205, 247, 289], "cellulan": [0, 10, 140, 205, 247, 289], "j36": [0, 10, 140, 205, 247, 289], "flavigena": [0, 10, 140, 205, 247, 289], "20109": [0, 10, 140, 205, 247, 289], "oerskovia": [0, 10, 140, 205, 247, 289], "turbata": [0, 10, 140, 205, 247, 289], "diphtheria": [0, 10, 140, 205, 247, 289], "pw8": [0, 10, 140, 205, 247, 289], "glutamicum": [0, 10, 140, 205, 247, 289], "calluna": [0, 10, 140, 205, 247, 289], "20147": [0, 10, 140, 205, 247, 289], "variabil": [0, 10, 140, 205, 247, 289], "44702": [0, 10, 140, 205, 247, 289], "acidaminophilum": [0, 10, 140, 205, 247, 289], "3953": [0, 10, 140, 205, 247, 289], "holdemanella": [0, 10, 140, 205, 247, 289], "biformi": [0, 10, 140, 205, 247, 289], "3989": [0, 10, 140, 205, 247, 289], "eubacterium": [0, 10, 140, 205, 247, 289], "limosum": [0, 10, 140, 205, 247, 289], "kist612": [0, 10, 140, 205, 247, 289], "commun": [0, 5, 10, 140, 205, 247, 289, 325], "2178": [0, 10, 140, 205, 247, 289], "propionibacterium": [0, 10, 140, 205, 247, 289], "freudenreichii": [0, 10, 140, 205, 247, 289], "shermanii": [0, 10, 140, 205, 247, 289], "cirm": [0, 10, 140, 205, 247, 289], "bia1": [0, 10, 140, 205, 247, 289], "cutibacterium": [0, 10, 140, 205, 247, 289], "acn": [0, 10, 140, 205, 247, 289], "kpa171202": [0, 10, 140, 205, 247, 289], "acidipropionibacterium": [0, 10, 140, 205, 247, 289], "acidipropionici": [0, 10, 140, 205, 247, 289], "4875": [0, 10, 140, 205, 247, 289], "jensenii": [0, 10, 140, 205, 247, 289], "20535": [0, 10, 140, 205, 247, 289], "pseudopropionibacterium": [0, 10, 140, 205, 247, 289], "propionicum": [0, 10, 140, 205, 247, 289], "f0230a": [0, 10, 140, 205, 247, 289], "thoenii": [0, 10, 140, 205, 247, 289], "20276": [0, 10, 140, 205, 247, 289], "mycolicibacterium": [0, 10, 140, 205, 247, 289], "fortuitum": [0, 10, 140, 205, 247, 289], "46621": [0, 10, 140, 205, 247, 289], "6841": [0, 10, 140, 205, 247, 289], "intracellular": [0, 10, 140, 205, 247, 289], "13950": [0, 10, 140, 205, 247, 289], "kansasii": [0, 10, 140, 205, 247, 289], "732": [0, 10, 140, 205, 247, 289], "lepra": [0, 10, 140, 205, 247, 289], "tn": [0, 10, 140, 205, 247, 289], "phlei": [0, 10, 140, 205, 247, 289], "rivm601174": [0, 10, 140, 205, 247, 289], "smegmati": [0, 10, 140, 205, 247, 289], "mc2": [0, 10, 140, 205, 247, 289], "155": [0, 10, 140, 205, 247, 289], "h37rv": [0, 10, 140, 205, 247, 289], "mycobacteroid": [0, 10, 140, 205, 247, 289], "chelona": [0, 10, 140, 205, 247, 289], "asiaticum": [0, 10, 140, 205, 247, 289], "44297": [0, 10, 140, 205, 247, 289], "neoaurum": [0, 10, 140, 205, 247, 289], "vkm": [0, 10, 140, 205, 247, 289], "1815d": [0, 10, 140, 205, 247, 289], "thermoresistibil": [0, 10, 140, 205, 247, 289], "19527": [0, 10, 140, 205, 247, 289], "chubuens": [0, 10, 140, 205, 247, 289], "nbb4": [0, 10, 140, 205, 247, 289], "farcinogen": [0, 10, 140, 205, 247, 289], "gilvum": [0, 10, 140, 205, 247, 289], "pyr": [0, 10, 140, 205, 247, 289], "gck": [0, 10, 140, 205, 247, 289], "agy99": [0, 10, 140, 205, 247, 289], "vacca": [0, 10, 140, 205, 247, 289], "25954": [0, 10, 140, 205, 247, 289], "amycolatopsi": [0, 10, 140, 205, 247, 289], "methanolica": [0, 10, 140, 205, 247, 289], "239": [0, 10, 140, 205, 247, 289], "nocardia": [0, 10, 140, 205, 247, 289], "otitidiscaviarum": [0, 10, 140, 205, 247, 289], "14405": [0, 10, 140, 205, 247, 289], "15531": [0, 10, 140, 205, 247, 289], "rhodococcu": [0, 10, 140, 205, 247, 289], "fascian": [0, 10, 140, 205, 247, 289], "rhodochr": [0, 10, 140, 205, 247, 289], "21198": [0, 10, 140, 205, 247, 289], "chol": [0, 10, 140, 205, 247, 289], "erythropoli": [0, 10, 140, 205, 247, 289], "pr4": [0, 10, 140, 205, 247, 289], "saccharopolyspora": [0, 10, 140, 205, 247, 289], "erythraea": [0, 10, 140, 205, 247, 289], "nrrl": [0, 10, 140, 205, 247, 289], "2338": [0, 10, 140, 205, 247, 289], "actinopolyspora": [0, 10, 140, 205, 247, 289], "43834": [0, 10, 140, 205, 247, 289], "saccharomonospora": [0, 10, 140, 205, 247, 289], "viridi": [0, 10, 140, 205, 247, 289], "43017": [0, 10, 140, 205, 247, 289], "frankia": [0, 10, 140, 205, 247, 289], "alni": [0, 10, 140, 205, 247, 289], "acn14a": [0, 10, 140, 205, 247, 289], "geodermatophilu": [0, 10, 140, 205, 247, 289], "obscuru": [0, 10, 140, 205, 247, 289], "43160": [0, 10, 140, 205, 247, 289], "actinoplan": [0, 10, 140, 205, 247, 289], "missouriensi": [0, 10, 140, 205, 247, 289], "431": [0, 10, 140, 205, 247, 289], "utahensi": [0, 10, 140, 205, 247, 289], "kitasatospora": [0, 10, 140, 205, 247, 289], "aureofacien": [0, 10, 140, 205, 247, 289], "bikiniensi": [0, 10, 140, 205, 247, 289], "a3": [0, 10, 140, 205, 247, 289], "fradia": [0, 10, 140, 205, 247, 289], "glaucescen": [0, 10, 140, 205, 247, 289], "13350": [0, 10, 140, 205, 247, 289], "hygroscopicu": [0, 10, 140, 205, 247, 289], "jinggangensi": [0, 10, 140, 205, 247, 289], "5008": [0, 10, 140, 205, 247, 289], "lividan": [0, 10, 140, 205, 247, 289], "1326": [0, 10, 140, 205, 247, 289], "scabiei": [0, 10, 140, 205, 247, 289], "87": [0, 10, 140, 205, 247, 289, 324, 325], "viridochromogen": [0, 10, 140, 205, 247, 289], "40736": [0, 10, 140, 205, 247, 289], "halstedii": [0, 10, 140, 205, 247, 289], "purpureu": [0, 10, 140, 205, 247, 289], "ka281": [0, 10, 140, 205, 247, 289], "sclerotialu": [0, 10, 140, 205, 247, 289], "virginia": [0, 10, 140, 205, 247, 289], "cellulosa": [0, 10, 140, 205, 247, 289], "chartreusi": [0, 10, 140, 205, 247, 289], "12338": [0, 10, 140, 205, 247, 289], "actinomadura": [0, 10, 140, 205, 247, 289], "atramentaria": [0, 10, 140, 205, 247, 289], "43919": [0, 10, 140, 205, 247, 289], "madura": [0, 10, 140, 205, 247, 289], "liid": [0, 10, 140, 205, 247, 289], "aj290": [0, 10, 140, 205, 247, 289], "microtetraspora": [0, 10, 140, 205, 247, 289], "glauca": [0, 10, 140, 205, 247, 289], "streptosporangium": [0, 10, 140, 205, 247, 289], "43021": [0, 10, 140, 205, 247, 289], "amethystogen": [0, 10, 140, 205, 247, 289], "thermobispora": [0, 10, 140, 205, 247, 289], "bispora": [0, 10, 140, 205, 247, 289], "43833": [0, 10, 140, 205, 247, 289], "nocardiopsi": [0, 10, 140, 205, 247, 289], "dassonvillei": [0, 10, 140, 205, 247, 289], "43111": [0, 10, 140, 205, 247, 289], "prasina": [0, 10, 140, 205, 247, 289], "43845": [0, 10, 140, 205, 247, 289], "thermomonospora": [0, 10, 140, 205, 247, 289], "curvata": [0, 10, 140, 205, 247, 289], "43183": [0, 10, 140, 205, 247, 289], "thermobifida": [0, 10, 140, 205, 247, 289], "fusca": [0, 10, 140, 205, 247, 289], "yx": [0, 10, 140, 205, 247, 289], "microbacterium": [0, 10, 140, 205, 247, 289], "testaceum": [0, 10, 140, 205, 247, 289], "stlb037": [0, 10, 140, 205, 247, 289], "curtobacterium": [0, 10, 140, 205, 247, 289], "flaccumfacien": [0, 10, 140, 205, 247, 289], "ucd": [0, 10, 140, 205, 247, 289], "aku": [0, 10, 140, 205, 247, 289], "tropheryma": [0, 10, 140, 205, 247, 289], "whipplei": [0, 10, 140, 205, 247, 289], "twist": [0, 10, 140, 205, 247, 289], "pimelobact": [0, 10, 140, 205, 247, 289], "rothia": [0, 10, 140, 205, 247, 289], "dentocariosa": [0, 10, 140, 205, 247, 289], "17931": [0, 10, 140, 205, 247, 289], "mobiluncu": [0, 10, 140, 205, 247, 289], "curtisii": [0, 10, 140, 205, 247, 289], "43063": [0, 10, 140, 205, 247, 289], "mulieri": [0, 10, 140, 205, 247, 289], "gordonia": [0, 10, 140, 205, 247, 289], "bronchiali": [0, 10, 140, 205, 247, 289], "43247": [0, 10, 140, 205, 247, 289], "terra": [0, 10, 140, 205, 247, 289], "sphaerobact": [0, 10, 140, 205, 247, 289], "20745": [0, 10, 140, 205, 247, 289], "tsukamurella": [0, 10, 140, 205, 247, 289], "paurometabola": [0, 10, 140, 205, 247, 289], "20162": [0, 10, 140, 205, 247, 289], "seta": [0, 10, 140, 205, 247, 289], "km": [0, 10, 140, 205, 247, 289], "6054": [0, 10, 140, 205, 247, 289], "pseudonocardia": [0, 10, 140, 205, 247, 289], "autotrophica": [0, 10, 140, 205, 247, 289], "arginini": [0, 10, 140, 205, 247, 289], "7264": [0, 10, 140, 205, 247, 289], "capricolum": [0, 10, 140, 205, 247, 289], "27343": [0, 10, 140, 205, 247, 289], "gallisepticum": [0, 10, 140, 205, 247, 289], "g37": [0, 10, 140, 205, 247, 289], "hyopneumonia": [0, 10, 140, 205, 247, 289], "hyorhini": [0, 10, 140, 205, 247, 289], "sk76": [0, 10, 140, 205, 247, 289], "sc": [0, 10, 140, 205, 247, 289], "pg1": [0, 10, 140, 205, 247, 289], "leachii": [0, 10, 140, 205, 247, 289], "pg50": [0, 10, 140, 205, 247, 289], "pulmoni": [0, 10, 140, 205, 247, 289], "synovia": [0, 10, 140, 205, 247, 289], "53": [0, 10, 140, 205, 247, 289], "pg2": [0, 10, 140, 205, 247, 289], "arthritidi": [0, 10, 140, 205, 247, 289], "158l3": [0, 10, 140, 205, 247, 289], "bovigenitalium": [0, 10, 140, 205, 247, 289], "51080": [0, 10, 140, 205, 247, 289], "mycoplasmopsi": [0, 10, 140, 205, 247, 289], "californica": [0, 10, 140, 205, 247, 289], "pg18": [0, 10, 140, 205, 247, 289], "695": [0, 10, 140, 205, 247, 289], "mobil": [0, 10, 140, 205, 247, 289], "mput9231": [0, 10, 140, 205, 247, 289], "floccular": [0, 10, 140, 205, 247, 289], "27399": [0, 10, 140, 205, 247, 289], "ureaplasma": [0, 10, 140, 205, 247, 289], "urealyticum": [0, 10, 140, 205, 247, 289], "27819": [0, 10, 140, 205, 247, 289], "spiroplasma": [0, 10, 140, 205, 247, 289], "melliferum": [0, 10, 140, 205, 247, 289], "ipmb4a": [0, 10, 140, 205, 247, 289], "mirum": [0, 10, 140, 205, 247, 289], "29335": [0, 10, 140, 205, 247, 289], "taiwanens": [0, 10, 140, 205, 247, 289], "ct": [0, 10, 140, 172, 205, 217, 247, 258, 289, 302], "acholeplasma": [0, 10, 140, 205, 247, 289], "laidlawii": [0, 10, 140, 205, 247, 289], "pg": [0, 10, 140, 205, 247, 289], "8a": [0, 10, 140, 205, 247, 289], "modicum": [0, 10, 140, 205, 247, 289], "29102": [0, 10, 140, 205, 247, 289], "mesoplasma": [0, 10, 140, 205, 247, 289], "florum": [0, 10, 140, 205, 247, 289], "l1": [0, 10, 140, 166, 167, 169, 205, 247, 289, 323, 324, 325], "methanobrevibact": [0, 10, 140, 205, 247, 289], "35061": [0, 10, 140, 205, 247, 289], "methanohalophilu": [0, 10, 140, 205, 247, 289], "mahii": [0, 10, 140, 205, 247, 289], "5219": [0, 10, 140, 205, 247, 289], "methanothermu": [0, 10, 140, 205, 247, 289], "fervidu": [0, 10, 140, 205, 247, 289], "2088": [0, 10, 140, 205, 247, 289], "methanothermococcu": [0, 10, 140, 205, 247, 289], "thermolithotrophicu": [0, 10, 140, 205, 247, 289], "2095": [0, 10, 140, 205, 247, 289], "methanococcu": [0, 10, 140, 205, 247, 289], "volta": [0, 10, 140, 205, 247, 289], "methanotorri": [0, 10, 140, 205, 247, 289], "igneu": [0, 10, 140, 205, 247, 289], "kol": [0, 10, 140, 205, 247, 289], "2661": [0, 10, 140, 205, 247, 289], "methanoculleu": [0, 10, 140, 205, 247, 289], "marisnigri": [0, 10, 140, 205, 247, 289], "jr1": [0, 10, 140, 205, 247, 289], "methanofolli": [0, 10, 140, 205, 247, 289], "liminatan": [0, 10, 140, 205, 247, 289], "4140": [0, 10, 140, 205, 247, 289], "methanospirillum": [0, 10, 140, 205, 247, 289], "hungatei": [0, 10, 140, 205, 247, 289], "methanomicrobium": [0, 10, 140, 205, 247, 289], "bp": [0, 10, 140, 205, 247, 289], "barkeri": [0, 10, 140, 205, 247, 289], "fusaro": [0, 10, 140, 205, 247, 289], "mazei": [0, 10, 140, 205, 247, 289], "go1": [0, 10, 140, 205, 247, 289], "tm": [0, 10, 140, 205, 247, 289], "c2a": [0, 10, 140, 205, 247, 289], "vacuolata": [0, 10, 140, 205, 247, 289], "z": [0, 2, 6, 9, 10, 140, 205, 247, 289, 315, 316], "761": [0, 10, 140, 205, 247, 289], "methanothrix": [0, 10, 140, 205, 247, 289], "soehngenii": [0, 10, 140, 205, 247, 289], "gp6": [0, 10, 140, 205, 247, 289], "thermoacetophila": [0, 10, 140, 205, 247, 289], "pt": [0, 10, 140, 205, 247, 289], "methanococcoid": [0, 10, 140, 205, 247, 289], "methyluten": [0, 10, 140, 205, 247, 289], "mm1": [0, 10, 140, 205, 247, 289], "archaeoglobu": [0, 10, 140, 205, 247, 289], "fulgidu": [0, 10, 140, 205, 247, 289], "4304": [0, 10, 140, 205, 247, 289], "haloarcula": [0, 10, 140, 205, 247, 289], "marismortui": [0, 10, 140, 205, 247, 289], "43049": [0, 10, 140, 205, 247, 289], "nrc": [0, 10, 140, 205, 247, 289], "haloferax": [0, 10, 140, 205, 247, 289], "volcanii": [0, 10, 140, 205, 247, 289], "ds2": [0, 10, 140, 205, 247, 289], "halorubrum": [0, 10, 140, 205, 247, 289], "lacusprofundi": [0, 10, 140, 205, 247, 289], "49239": [0, 10, 140, 205, 247, 289], "saccharovorum": [0, 10, 140, 205, 247, 289], "1137": [0, 10, 140, 205, 247, 289], "halococcu": [0, 10, 140, 205, 247, 289], "morrhua": [0, 10, 140, 205, 247, 289], "1307": [0, 10, 140, 205, 247, 289], "mediterranei": [0, 10, 140, 205, 247, 289], "33500": [0, 10, 140, 205, 247, 289], "natronomona": [0, 10, 140, 205, 247, 289], "pharaoni": [0, 10, 140, 205, 247, 289], "2160": [0, 10, 140, 205, 247, 289], "pyrococcu": [0, 10, 140, 205, 247, 289], "furiosu": [0, 10, 140, 205, 247, 289], "3638": [0, 10, 140, 205, 247, 289], "5473": [0, 10, 140, 205, 247, 289], "thermofilum": [0, 10, 140, 205, 247, 289], "penden": [0, 10, 140, 205, 247, 289], "hrk": [0, 10, 140, 205, 247, 289], "thermoproteu": [0, 10, 140, 205, 247, 289], "tenax": [0, 10, 140, 205, 247, 289], "kra": [0, 10, 140, 205, 247, 289], "desulfurococcu": [0, 10, 140, 205, 247, 289], "mucosu": [0, 10, 140, 205, 247, 289], "2162": [0, 10, 140, 205, 247, 289], "islandicum": [0, 10, 140, 205, 247, 289], "4184": [0, 10, 140, 205, 247, 289], "staphylothermu": [0, 10, 140, 205, 247, 289], "f1": [0, 10, 140, 205, 247, 289], "acidocaldariu": [0, 10, 140, 205, 247, 289], "639": [0, 10, 140, 205, 247, 289], "saccharolobu": [0, 10, 140, 205, 247, 289], "p2": [0, 10, 140, 205, 247, 289], "desulfobact": [0, 10, 140, 205, 247, 289], "curvatu": [0, 10, 140, 205, 247, 289], "3379": [0, 10, 140, 205, 247, 289], "postgatei": [0, 10, 140, 205, 247, 289], "2ac9": [0, 10, 140, 205, 247, 289], "desulfobacterium": [0, 10, 140, 205, 247, 289], "autotrophicum": [0, 10, 140, 205, 247, 289], "hrm2": [0, 10, 140, 205, 247, 289], "thermoplasma": [0, 10, 140, 205, 247, 289], "acidophilum": [0, 10, 140, 205, 247, 289], "1728": [0, 10, 140, 205, 247, 289], "methanoplanu": [0, 10, 140, 205, 247, 289], "2279": [0, 10, 140, 165, 205, 247, 289], "methanosphaera": [0, 10, 140, 205, 247, 289], "stadtmana": [0, 10, 140, 205, 247, 289], "3091": [0, 10, 140, 205, 247, 289], "methanopyru": [0, 10, 140, 205, 247, 289], "kandleri": [0, 10, 140, 205, 247, 289], "av19": [0, 10, 140, 205, 247, 289], "methanohalobium": [0, 10, 140, 205, 247, 289], "evestigatum": [0, 10, 140, 205, 247, 289], "7303": [0, 10, 140, 205, 247, 289], "kivui": [0, 10, 140, 205, 247, 289], "halanaerobium": [0, 10, 140, 205, 247, 289], "praevalen": [0, 10, 140, 205, 247, 289], "2228": [0, 10, 140, 205, 247, 289], "msb8": [0, 10, 140, 205, 247, 289], "neapolitana": [0, 10, 140, 205, 247, 289], "4359": [0, 10, 140, 205, 247, 289], "solemya": [0, 10, 140, 205, 247, 289], "velum": [0, 10, 140, 205, 247, 289], "gill": [0, 10, 140, 205, 247, 289], "symbiont": [0, 10, 140, 205, 247, 289], "haliscomenobact": [0, 10, 140, 205, 247, 289], "hydrossi": [0, 10, 140, 205, 247, 289], "1100": [0, 10, 140, 205, 247, 289], "flexistip": [0, 10, 140, 205, 247, 289], "sinusarabici": [0, 10, 140, 205, 247, 289], "4947": [0, 10, 140, 205, 247, 289], "desulfomonil": [0, 10, 140, 205, 247, 289], "tiedjei": [0, 10, 140, 205, 247, 289], "6799": [0, 10, 140, 205, 247, 289], "xylella": [0, 10, 140, 205, 247, 289], "fastidiosa": [0, 10, 140, 205, 247, 289], "9a5c": [0, 10, 140, 205, 247, 289], "acetonema": [0, 10, 140, 205, 247, 289], "longum": [0, 10, 140, 205, 247, 289], "6540": [0, 10, 140, 205, 247, 289], "sporomusa": [0, 10, 140, 205, 247, 289], "ovata": [0, 10, 140, 205, 247, 289], "2662": [0, 10, 140, 205, 247, 289], "thermosipho": [0, 10, 140, 205, 247, 289], "tcf52b": [0, 10, 140, 205, 247, 289], "fervidobacterium": [0, 10, 140, 205, 247, 289], "nodosum": [0, 10, 140, 205, 247, 289], "rt17": [0, 10, 140, 205, 247, 289], "b1": [0, 10, 140, 205, 247, 289], "teredinibact": [0, 10, 140, 205, 247, 289], "turnera": [0, 10, 140, 205, 247, 289], "t7901": [0, 10, 140, 205, 247, 289], "roseobact": [0, 10, 140, 205, 247, 289], "och": [0, 10, 140, 205, 247, 289], "114": [0, 2, 10, 140, 205, 247, 289], "gardnerella": [0, 10, 140, 205, 247, 289], "6119v5": [0, 10, 140, 205, 247, 289], "cardiobacterium": [0, 10, 140, 205, 247, 289], "15826": [0, 10, 140, 205, 247, 289], "hirschia": [0, 10, 140, 205, 247, 289], "49814": [0, 10, 140, 205, 247, 289], "symbiobacterium": [0, 10, 140, 205, 247, 289], "iam": [0, 10, 140, 205, 247, 289], "14863": [0, 10, 140, 205, 247, 289], "verrucomicrobium": [0, 10, 140, 205, 247, 289], "spinosum": [0, 10, 140, 205, 247, 289], "4136": [0, 10, 140, 205, 247, 289], "18804": [0, 10, 140, 205, 247, 289], "marinobact": [0, 10, 140, 205, 247, 289], "hydrocarbonoclasticu": [0, 10, 140, 205, 247, 289], "vt8": [0, 10, 140, 205, 247, 289], "halomona": [0, 10, 140, 205, 247, 289], "2581": [0, 10, 140, 205, 247, 289], "carnobacterium": [0, 10, 140, 205, 247, 289], "divergen": [0, 10, 140, 205, 247, 289], "20623": [0, 10, 140, 205, 247, 289], "4847": [0, 10, 140, 205, 247, 289], "4848": [0, 10, 140, 205, 247, 289], "maltaromaticum": [0, 10, 140, 205, 247, 289], "lma28": [0, 10, 140, 205, 247, 289], "funditum": [0, 10, 140, 205, 247, 289], "5970": [0, 10, 140, 205, 247, 289], "synergist": [0, 10, 140, 205, 247, 289], "jonesii": [0, 10, 140, 205, 247, 289], "chondru": [0, 10, 140, 205, 247, 289], "crispu": [0, 10, 140, 205, 247, 289], "phaeodactylum": [0, 10, 140, 205, 247, 289], "tricornutum": [0, 10, 140, 205, 247, 289], "ectocarpu": [0, 10, 140, 205, 247, 289], "siliculosu": [0, 10, 140, 205, 247, 289], "cryptomona": [0, 10, 140, 205, 247, 289], "emiliania": [0, 10, 140, 205, 247, 289], "huxleyi": [0, 10, 140, 205, 247, 289], "symbiodinium": [0, 10, 140, 205, 247, 289], "microadriaticum": [0, 10, 140, 205, 247, 289], "volvox": [0, 10, 140, 205, 247, 289], "carteri": [0, 10, 140, 205, 247, 289], "auxenochlorella": [0, 10, 140, 205, 247, 289], "protothecoid": [0, 10, 140, 205, 247, 289], "physcomitrium": [0, 10, 140, 205, 247, 289], "cannabi": [0, 10, 140, 205, 247, 289], "actinidia": [0, 10, 140, 205, 247, 289], "chinensi": [0, 10, 140, 205, 247, 289], "var": [0, 10, 140, 205, 247, 289], "carica": [0, 10, 140, 205, 247, 289], "papaya": [0, 10, 140, 205, 247, 289], "citrullu": [0, 10, 140, 205, 247, 289], "lanatu": [0, 10, 140, 205, 247, 289], "melo": [0, 10, 140, 205, 247, 289], "malu": [0, 10, 140, 205, 247, 289], "dulci": [0, 10, 140, 205, 247, 289], "cajanu": [0, 10, 140, 205, 247, 289], "cajan": [0, 10, 140, 205, 247, 289], "cicer": [0, 10, 140, 205, 247, 289], "arietinum": [0, 10, 140, 205, 247, 289], "soja": [0, 10, 140, 205, 247, 289], "lupinu": [0, 10, 140, 205, 247, 289], "angustifoliu": [0, 10, 140, 205, 247, 289], "phaseolu": [0, 10, 140, 205, 247, 289], "vigna": [0, 10, 140, 205, 247, 289], "angulari": [0, 10, 140, 205, 247, 289], "linum": [0, 10, 140, 205, 247, 289], "usitatissimum": [0, 10, 140, 205, 247, 289], "daucu": [0, 10, 140, 205, 247, 289], "carota": [0, 10, 140, 205, 247, 289], "sylvestri": [0, 10, 140, 205, 247, 289], "tomentosiformi": [0, 10, 140, 205, 247, 289], "benthamiana": [0, 10, 140, 205, 247, 289], "commersonii": [0, 10, 140, 205, 247, 289], "olea": [0, 10, 140, 205, 247, 289], "sesamum": [0, 10, 140, 205, 247, 289], "cynara": [0, 10, 140, 205, 247, 289], "cardunculu": [0, 10, 140, 205, 247, 289], "scolymu": [0, 10, 140, 205, 247, 289], "longistaminata": [0, 10, 140, 205, 247, 289], "rufipogon": [0, 10, 140, 205, 247, 289], "brachyantha": [0, 10, 140, 205, 247, 289], "nivara": [0, 10, 140, 205, 247, 289], "punctata": [0, 10, 140, 205, 247, 289], "glaberrima": [0, 10, 140, 205, 247, 289], "durum": [0, 10, 140, 205, 247, 289], "urartu": [0, 10, 140, 205, 247, 289], "anana": [0, 10, 140, 205, 247, 289], "comosu": [0, 10, 140, 205, 247, 289], "pneumocysti": [0, 10, 140, 205, 247, 289], "carinii": [0, 10, 140, 205, 247, 289], "plasmopara": [0, 10, 140, 205, 247, 289], "infestan": [0, 10, 140, 205, 247, 289], "parasitica": [0, 10, 140, 205, 247, 289], "megakarya": [0, 10, 140, 205, 247, 289], "palmivora": [0, 10, 140, 205, 247, 289], "phycomyc": [0, 10, 140, 205, 247, 289], "blakesleeanu": [0, 10, 140, 205, 247, 289], "972h": [0, 10, 140, 205, 247, 289], "octosporu": [0, 10, 140, 205, 247, 289], "cyberlindnera": [0, 10, 140, 205, 247, 289], "jadinii": [0, 10, 140, 205, 247, 289], "pichia": [0, 10, 140, 205, 247, 289], "kudriavzevii": [0, 10, 140, 205, 247, 289], "kluyveromyc": [0, 10, 140, 205, 247, 289], "marxianu": [0, 10, 140, 205, 247, 289], "dmku3": [0, 10, 140, 205, 247, 289], "1042": [0, 10, 140, 205, 247, 289], "lachancea": [0, 10, 140, 205, 247, 289], "waltii": [0, 10, 140, 205, 247, 289], "pachysolen": [0, 10, 140, 205, 247, 289], "tannophilu": [0, 10, 140, 205, 247, 289], "2460": [0, 10, 140, 205, 247, 289], "millerozyma": [0, 10, 140, 205, 247, 289], "farinosa": [0, 10, 140, 205, 247, 289], "komagataella": [0, 10, 140, 205, 247, 289], "pastori": [0, 10, 140, 205, 247, 289], "scheffersomyc": [0, 10, 140, 205, 247, 289], "stipiti": [0, 10, 140, 205, 247, 289], "membranifacien": [0, 10, 140, 205, 247, 289], "2026": [0, 10, 140, 205, 247, 289], "wickerhamomyc": [0, 10, 140, 205, 247, 289], "anomalu": [0, 10, 140, 205, 247, 289], "meyerozyma": [0, 10, 140, 205, 247, 289], "guilliermondii": [0, 10, 140, 205, 247, 289], "bayanu": [0, 10, 140, 205, 247, 289], "s288c": [0, 10, 140, 205, 247, 289], "torulaspora": [0, 10, 140, 205, 247, 289], "cb": [0, 10, 140, 205, 247, 289], "1146": [0, 10, 140, 205, 247, 289], "clib122": [0, 10, 140, 205, 247, 289], "zygosaccharomyc": [0, 10, 140, 205, 247, 289], "bailii": [0, 10, 140, 205, 247, 289], "clib": [0, 10, 140, 205, 247, 289], "fermentati": [0, 10, 140, 205, 247, 289], "rouxii": [0, 10, 140, 205, 247, 289], "debaryomyc": [0, 10, 140, 205, 247, 289], "kockovaella": [0, 10, 140, 205, 247, 289], "imperata": [0, 10, 140, 205, 247, 289], "brettanomyc": [0, 10, 140, 205, 247, 289], "bruxellensi": [0, 10, 140, 205, 247, 289], "taphrina": [0, 10, 140, 205, 247, 289], "deforman": [0, 10, 140, 205, 247, 289], "pycc": [0, 10, 140, 205, 247, 289], "5710": [0, 10, 140, 205, 247, 289], "bipolari": [0, 10, 140, 205, 247, 289], "zeicola": [0, 10, 140, 205, 247, 289], "leptosphaeria": [0, 10, 140, 205, 247, 289], "maculan": [0, 10, 140, 205, 247, 289], "histoplasma": [0, 10, 140, 205, 247, 289], "capsulatum": [0, 10, 140, 205, 247, 289], "blastomyc": [0, 10, 140, 205, 247, 289], "dermatitidi": [0, 10, 140, 205, 247, 289], "acremonium": [0, 10, 140, 205, 247, 289], "chrysogenum": [0, 10, 140, 205, 247, 289], "11550": [0, 10, 140, 205, 247, 289], "aspergillu": [0, 10, 140, 205, 247, 289], "clavatu": [0, 10, 140, 205, 247, 289], "flavu": [0, 10, 140, 205, 247, 289], "niger": [0, 10, 140, 205, 247, 289], "penicillium": [0, 10, 140, 205, 247, 289], "camemberti": [0, 10, 140, 205, 247, 289], "roqueforti": [0, 10, 140, 205, 247, 289], "amorphotheca": [0, 10, 140, 205, 247, 289], "resina": [0, 10, 140, 205, 247, 289], "22711": [0, 10, 140, 205, 247, 289], "ascosphaera": [0, 10, 140, 205, 247, 289], "arsef": [0, 10, 140, 205, 247, 289], "7405": [0, 10, 140, 205, 247, 289], "clavicep": [0, 10, 140, 205, 247, 289], "purpurea": [0, 10, 140, 205, 247, 289], "epichlo": [0, 10, 140, 205, 247, 289], "typhina": [0, 10, 140, 205, 247, 289], "e8": [0, 10, 140, 205, 247, 289], "cryphonectria": [0, 10, 140, 205, 247, 289], "fusarium": [0, 10, 140, 205, 247, 289], "fujikuroi": [0, 10, 140, 205, 247, 289], "or74a": [0, 10, 140, 205, 247, 289], "sordaria": [0, 10, 140, 205, 247, 289], "macrospora": [0, 10, 140, 205, 247, 289], "hell": [0, 10, 140, 205, 247, 289], "ophiostoma": [0, 10, 140, 205, 247, 289], "ulmi": [0, 10, 140, 205, 247, 289], "1980": [0, 10, 140, 205, 247, 289], "uf": [0, 10, 140, 205, 247, 289], "jec21": [0, 10, 140, 205, 247, 289], "depauperatu": [0, 10, 140, 205, 247, 289], "7841": [0, 10, 140, 205, 247, 289], "tremella": [0, 10, 140, 205, 247, 289], "mesenterica": [0, 10, 140, 205, 247, 289], "exidia": [0, 10, 140, 205, 247, 289], "glandulosa": [0, 10, 140, 205, 247, 289], "hhb12029": [0, 10, 140, 205, 247, 289], "521": [0, 10, 140, 205, 247, 289], "microbotryum": [0, 10, 140, 205, 247, 289], "tilletiaria": [0, 10, 140, 205, 247, 289], "anomala": [0, 10, 140, 205, 247, 289], "ubc": [0, 10, 140, 205, 247, 289], "951": [0, 10, 140, 205, 247, 289], "rhodotorula": [0, 10, 140, 205, 247, 289], "toruloid": [0, 10, 140, 205, 247, 289], "tritici": [0, 10, 140, 205, 247, 289], "crl": [0, 10, 140, 205, 247, 289], "36": [0, 10, 140, 205, 247, 289], "700": [0, 10, 140, 205, 247, 289], "phanerochaet": [0, 10, 140, 205, 247, 289], "chrysosporium": [0, 10, 140, 205, 247, 289], "pleurotu": [0, 10, 140, 205, 247, 289], "ostreatu": [0, 10, 140, 205, 247, 289], "tramet": [0, 10, 140, 205, 247, 289], "versicolor": [0, 10, 140, 205, 247, 289], "fp": [0, 10, 140, 205, 247, 289], "101664": [0, 10, 140, 205, 247, 289], "ss1": [0, 10, 140, 205, 247, 289], "schizophyllum": [0, 10, 140, 205, 247, 289], "agaricu": [0, 10, 140, 205, 247, 289], "bisporu": [0, 10, 140, 205, 247, 289], "coprinopsi": [0, 10, 140, 205, 247, 289], "lentinula": [0, 10, 140, 205, 247, 289], "edod": [0, 10, 140, 205, 247, 289], "suillu": [0, 10, 140, 205, 247, 289], "uh": [0, 10, 140, 205, 247, 289], "slu": [0, 10, 140, 205, 247, 289], "lm8": [0, 10, 140, 205, 247, 289], "n1": [0, 10, 140, 205, 247, 289], "ascochyta": [0, 10, 140, 205, 247, 289], "rabiei": [0, 10, 140, 205, 247, 289], "colletotrichum": [0, 10, 140, 205, 247, 289], "orbicular": [0, 10, 140, 205, 247, 289], "sc5314": [0, 10, 140, 205, 247, 289], "maltosa": [0, 10, 140, 205, 247, 289], "parapsilosi": [0, 10, 140, 205, 247, 289], "diutina": [0, 10, 140, 205, 247, 289], "rugosa": [0, 10, 140, 205, 247, 289], "coccidioid": [0, 10, 140, 205, 247, 289], "immiti": [0, 10, 140, 205, 247, 289], "oxysporum": [0, 10, 140, 205, 247, 289], "culmorum": [0, 10, 140, 205, 247, 289], "cs7071": [0, 10, 140, 205, 247, 289], "graminearum": [0, 10, 140, 205, 247, 289], "metarhizium": [0, 10, 140, 205, 247, 289], "anisoplia": [0, 10, 140, 205, 247, 289], "549": [0, 10, 140, 205, 247, 289], "glutini": [0, 10, 140, 205, 247, 289], "trichoderma": [0, 10, 140, 205, 247, 289], "harzianum": [0, 10, 140, 205, 247, 289], "longibrachiatum": [0, 10, 140, 205, 247, 289], "18648": [0, 10, 140, 205, 247, 289], "trichophyton": [0, 10, 140, 205, 247, 289], "aureobasidium": [0, 10, 140, 205, 247, 289], "pullulan": [0, 10, 140, 205, 247, 289], "exf": [0, 10, 140, 205, 247, 289], "150": [0, 10, 140, 166, 205, 247, 289, 323], "alternaria": [0, 10, 140, 205, 247, 289], "alternata": [0, 10, 140, 205, 247, 289], "phialophora": [0, 10, 140, 205, 247, 289], "americana": [0, 10, 140, 205, 247, 289], "saitoella": [0, 10, 140, 205, 247, 289], "complicata": [0, 10, 140, 205, 247, 289], "17804": [0, 10, 140, 205, 247, 289], "wingfieldii": [0, 10, 140, 205, 247, 289], "7118": [0, 10, 140, 205, 247, 289], "grifola": [0, 10, 140, 205, 247, 289], "frondosa": [0, 10, 140, 205, 247, 289], "laetiporu": [0, 10, 140, 205, 247, 289], "sulphureu": [0, 10, 140, 205, 247, 289], "93": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "cinnabarina": [0, 10, 140, 205, 247, 289], "braziliensi": [0, 10, 140, 205, 247, 289], "mhom": [0, 10, 140, 205, 247, 289], "br": [0, 10, 140, 205, 247, 289], "m2904": [0, 10, 140, 205, 247, 289], "donovani": [0, 10, 140, 205, 247, 289], "bpk282a1": [0, 10, 140, 205, 247, 289], "gt": [0, 10, 140, 150, 205, 206, 247, 248, 289, 290, 324], "2001": [0, 10, 140, 205, 247, 289], "u1103": [0, 10, 140, 205, 247, 289], "infantum": [0, 10, 140, 205, 247, 289], "jpcm5": [0, 10, 140, 205, 247, 289], "panamensi": [0, 10, 140, 205, 247, 289], "leptomona": [0, 10, 140, 205, 247, 289], "seymouri": [0, 10, 140, 205, 247, 289], "tarentola": [0, 10, 140, 205, 247, 289], "cruzi": [0, 10, 140, 205, 247, 289], "equiperdum": [0, 10, 140, 205, 247, 289], "sc58": [0, 10, 140, 205, 247, 289], "lamblia": [0, 10, 140, 205, 247, 289], "50803": [0, 10, 140, 205, 247, 289], "acanthamoeba": [0, 10, 140, 205, 247, 289], "castellanii": [0, 10, 140, 205, 247, 289], "neff": [0, 10, 140, 205, 247, 289], "naegleria": [0, 10, 140, 205, 247, 289], "gruberi": [0, 10, 140, 205, 247, 289], "eimeria": [0, 10, 140, 205, 247, 289], "acervulina": [0, 10, 140, 205, 247, 289], "tenella": [0, 10, 140, 205, 247, 289], "maxima": [0, 10, 140, 205, 247, 289], "cryptosporidium": [0, 10, 140, 205, 247, 289], "parvum": [0, 10, 140, 205, 247, 289], "ii": [0, 10, 140, 205, 247, 289], "muri": [0, 10, 140, 205, 247, 289], "toxoplasma": [0, 10, 140, 205, 247, 289], "gondii": [0, 10, 140, 205, 247, 289], "me49": [0, 10, 140, 205, 247, 289], "berghei": [0, 10, 140, 205, 247, 289], "chabaudi": [0, 10, 140, 205, 247, 289], "cynomolgi": [0, 10, 140, 205, 247, 289], "3d7": [0, 10, 140, 205, 247, 289], "gallinaceum": [0, 10, 140, 205, 247, 289], "knowlesi": [0, 10, 140, 205, 247, 289], "reichenowi": [0, 10, 140, 205, 247, 289], "vivax": [0, 10, 140, 205, 247, 289], "sal": [0, 10, 140, 205, 247, 289], "fragil": [0, 10, 140, 205, 247, 289], "malaria": [0, 10, 140, 205, 247, 289], "vinckei": [0, 10, 140, 205, 247, 289], "yoelii": [0, 10, 140, 205, 247, 289], "babesia": [0, 10, 140, 205, 247, 289], "t2bo": [0, 10, 140, 205, 247, 289], "bigemina": [0, 10, 140, 205, 247, 289], "theileria": [0, 10, 140, 205, 247, 289], "annulata": [0, 10, 140, 205, 247, 289], "parva": [0, 10, 140, 205, 247, 289], "tetrahymena": [0, 10, 140, 205, 247, 289], "ichthyophthiriu": [0, 10, 140, 205, 247, 289], "multifilii": [0, 10, 140, 205, 247, 289], "stylonychia": [0, 10, 140, 205, 247, 289], "lemna": [0, 10, 140, 205, 247, 289], "stentor": [0, 10, 140, 205, 247, 289], "coeruleu": [0, 10, 140, 205, 247, 289], "exophiala": [0, 10, 140, 205, 247, 289], "encephalitozoon": [0, 10, 140, 205, 247, 289], "hydra": [0, 10, 140, 205, 247, 289], "schistosoma": [0, 10, 140, 205, 247, 289], "mansoni": [0, 10, 140, 205, 247, 289], "haematobium": [0, 10, 140, 205, 247, 289], "echinococcu": [0, 10, 140, 205, 247, 289], "multiloculari": [0, 10, 140, 205, 247, 289], "ascari": [0, 10, 140, 205, 247, 289], "suum": [0, 10, 140, 205, 247, 289], "brugia": [0, 10, 140, 205, 247, 289], "malayi": [0, 10, 140, 205, 247, 289], "onchocerca": [0, 10, 140, 205, 247, 289], "volvulu": [0, 10, 140, 205, 247, 289], "meloidogyn": [0, 10, 140, 205, 247, 289], "hapla": [0, 10, 140, 205, 247, 289], "bursaphelenchu": [0, 10, 140, 205, 247, 289], "xylophilu": [0, 10, 140, 205, 247, 289], "trichinella": [0, 10, 140, 205, 247, 289], "spirali": [0, 10, 140, 205, 247, 289], "aplysia": [0, 10, 140, 205, 247, 289], "biomphalaria": [0, 10, 140, 205, 247, 289], "glabrata": [0, 10, 140, 205, 247, 289], "crassostrea": [0, 10, 140, 205, 247, 289], "virginica": [0, 10, 140, 205, 247, 289], "mizuhopecten": [0, 10, 140, 205, 247, 289], "yessoensi": [0, 10, 140, 205, 247, 289], "tigriopu": [0, 10, 140, 205, 247, 289], "californicu": [0, 10, 140, 205, 247, 289], "blattella": [0, 10, 140, 205, 247, 289], "germanica": [0, 10, 140, 205, 247, 289], "acyrthosiphon": [0, 10, 140, 205, 247, 289], "pisum": [0, 10, 140, 205, 247, 289], "bemisia": [0, 10, 140, 205, 247, 289], "tabaci": [0, 10, 140, 205, 247, 289], "bombyx": [0, 10, 140, 205, 247, 289], "mori": [0, 10, 140, 205, 247, 289], "aed": [0, 10, 140, 205, 247, 289], "aegypti": [0, 10, 140, 205, 247, 289], "albopictu": [0, 10, 140, 205, 247, 289], "albimanu": [0, 10, 140, 205, 247, 289], "diru": [0, 10, 140, 205, 247, 289], "arabiensi": [0, 10, 140, 205, 247, 289], "culex": [0, 10, 140, 205, 247, 289], "pipien": [0, 10, 140, 205, 247, 289], "quinquefasciatu": [0, 10, 140, 205, 247, 289], "lutzomyia": [0, 10, 140, 205, 247, 289], "longipalpi": [0, 10, 140, 205, 247, 289], "loa": [0, 10, 140, 205, 247, 289], "cerat": [0, 10, 140, 205, 247, 289], "capitata": [0, 10, 140, 205, 247, 289], "ananassa": [0, 10, 140, 205, 247, 289], "erecta": [0, 10, 140, 205, 247, 289], "grimshawi": [0, 10, 140, 205, 247, 289], "mojavensi": [0, 10, 140, 205, 247, 289], "persimili": [0, 10, 140, 205, 247, 289], "pseudoobscura": [0, 10, 140, 205, 247, 289], "sechellia": [0, 10, 140, 205, 247, 289], "virili": [0, 10, 140, 205, 247, 289], "yakuba": [0, 10, 140, 205, 247, 289], "willistoni": [0, 10, 140, 205, 247, 289], "saltan": [0, 10, 140, 205, 247, 289], "musca": [0, 10, 140, 205, 247, 289], "lucilia": [0, 10, 140, 205, 247, 289], "cuprina": [0, 10, 140, 205, 247, 289], "glossina": [0, 10, 140, 205, 247, 289], "morsitan": [0, 10, 140, 205, 247, 289], "austeni": [0, 10, 140, 205, 247, 289], "fuscip": [0, 10, 140, 205, 247, 289], "palpali": [0, 10, 140, 205, 247, 289], "gambiensi": [0, 10, 140, 205, 247, 289], "pallidip": [0, 10, 140, 205, 247, 289], "nasonia": [0, 10, 140, 205, 247, 289], "vitripenni": [0, 10, 140, 205, 247, 289], "mellifera": [0, 10, 140, 205, 247, 289], "lingula": [0, 10, 140, 205, 247, 289], "anatina": [0, 10, 140, 205, 247, 289], "lanceolatum": [0, 10, 140, 205, 247, 289], "chelonia": [0, 10, 140, 205, 247, 289], "myda": [0, 10, 140, 205, 247, 289], "allig": [0, 10, 140, 205, 247, 289], "mississippiensi": [0, 10, 140, 205, 247, 289], "chaetura": [0, 10, 140, 205, 247, 289], "pelagica": [0, 10, 140, 205, 247, 289], "livia": [0, 10, 140, 205, 247, 289], "peregrinu": [0, 10, 140, 205, 247, 289], "haliaeetu": [0, 10, 140, 205, 247, 289], "albicilla": [0, 10, 140, 205, 247, 289], "phalacrocorax": [0, 10, 140, 205, 247, 289], "carbo": [0, 10, 140, 205, 247, 289], "phoenicopteru": [0, 10, 140, 205, 247, 289], "aptenodyt": [0, 10, 140, 205, 247, 289], "forsteri": [0, 10, 140, 205, 247, 289], "pygosc": [0, 10, 140, 205, 247, 289], "adelia": [0, 10, 140, 205, 247, 289], "calypt": [0, 10, 140, 205, 247, 289], "anna": [0, 10, 140, 205, 247, 289], "alecto": [0, 10, 140, 205, 247, 289], "onca": [0, 10, 140, 205, 247, 289], "odobenu": [0, 10, 140, 205, 247, 289], "rosmaru": [0, 10, 140, 205, 247, 289], "leptonychot": [0, 10, 140, 205, 247, 289], "weddellii": [0, 10, 140, 205, 247, 289], "orcinu": [0, 10, 140, 205, 247, 289], "orca": [0, 10, 140, 205, 247, 289], "acutorostrata": [0, 10, 140, 205, 247, 289], "trichechu": [0, 10, 140, 205, 247, 289], "manatu": [0, 10, 140, 205, 247, 289], "orycteropu": [0, 10, 140, 205, 247, 289], "afer": [0, 10, 140, 205, 247, 289], "saccoglossu": [0, 10, 140, 205, 247, 289], "kowalevskii": [0, 10, 140, 205, 247, 289], "sagitta": [0, 10, 140, 205, 247, 289], "atta": [0, 10, 140, 205, 247, 289], "cephalot": [0, 10, 140, 205, 247, 289], "blastocysti": [0, 10, 140, 205, 247, 289], "danau": [0, 10, 140, 205, 247, 289], "plexippu": [0, 10, 140, 205, 247, 289], "rhodniu": [0, 10, 140, 205, 247, 289], "prolixu": [0, 10, 140, 205, 247, 289], "tilletia": [0, 10, 140, 205, 247, 289], "cari": [0, 10, 140, 205, 247, 289], "controversa": [0, 10, 140, 205, 247, 289], "anaerobiospirillum": [0, 10, 140, 205, 247, 289], "succiniciproducen": [0, 10, 140, 205, 247, 289], "6400": [0, 10, 140, 205, 247, 289], "arthrobotri": [0, 10, 140, 205, 247, 289], "oligospora": [0, 10, 140, 205, 247, 289], "24927": [0, 10, 140, 205, 247, 289], "mallei": [0, 10, 140, 205, 247, 289], "23344": [0, 10, 140, 205, 247, 289], "parastagonospora": [0, 10, 140, 205, 247, 289], "sn15": [0, 10, 140, 205, 247, 289], "solenopsi": [0, 10, 140, 205, 247, 289], "invicta": [0, 10, 140, 205, 247, 289], "sphingomona": [0, 10, 140, 205, 247, 289], "paucimobili": [0, 10, 140, 205, 247, 289], "sphingobium": [0, 10, 140, 205, 247, 289], "yanoikuya": [0, 10, 140, 205, 247, 289], "syncephalastrum": [0, 10, 140, 205, 247, 289], "racemosum": [0, 10, 140, 205, 247, 289], "utricularia": [0, 10, 140, 205, 247, 289], "gibba": [0, 10, 140, 205, 247, 289], "natrialba": [0, 10, 140, 205, 247, 289], "magadii": [0, 10, 140, 205, 247, 289], "43099": [0, 10, 140, 205, 247, 289], "im2": [0, 10, 140, 205, 247, 289], "naumovozyma": [0, 10, 140, 205, 247, 289], "castellii": [0, 10, 140, 205, 247, 289], "dairenensi": [0, 10, 140, 205, 247, 289], "421": [0, 10, 140, 205, 247, 289], "paradoxu": [0, 10, 140, 205, 247, 289], "pastorianu": [0, 10, 140, 205, 247, 289], "weihenstephan": [0, 10, 140, 205, 247, 289], "34": [0, 9, 10, 140, 205, 247, 289], "metschnikowia": [0, 10, 140, 205, 247, 289], "bicuspidata": [0, 10, 140, 205, 247, 289], "yb": [0, 10, 140, 205, 247, 289], "4993": [0, 10, 140, 205, 247, 289], "expansum": [0, 10, 140, 205, 247, 289], "verticillium": [0, 10, 140, 205, 247, 289], "dahlia": [0, 10, 140, 205, 247, 289], "vdl": [0, 10, 140, 205, 247, 289], "17": [0, 2, 9, 10, 140, 172, 205, 217, 247, 258, 289, 302, 324, 325], "schizopora": [0, 10, 140, 205, 247, 289], "paradoxa": [0, 10, 140, 205, 247, 289], "avena": [0, 10, 140, 205, 247, 289], "sorghi": [0, 10, 140, 205, 247, 289], "striiformi": [0, 10, 140, 205, 247, 289], "mnemiopsi": [0, 10, 140, 205, 247, 289], "leidyi": [0, 10, 140, 205, 247, 289], "hellem": [0, 10, 140, 205, 247, 289], "50504": [0, 10, 140, 205, 247, 289], "nosema": [0, 10, 140, 205, 247, 289], "bombyci": [0, 10, 140, 205, 247, 289], "cq1": [0, 10, 140, 205, 247, 289], "strigomona": [0, 10, 140, 205, 247, 289], "culici": [0, 10, 140, 205, 247, 289], "bb": [0, 10, 140, 205, 247, 289], "pseudocatenulatum": [0, 10, 140, 205, 247, 289], "20438": [0, 10, 140, 205, 247, 289], "1200": [0, 10, 140, 205, 247, 289], "10505": [0, 10, 140, 205, 247, 289], "fusiformi": [0, 10, 140, 205, 247, 289], "zc1": [0, 10, 140, 205, 247, 289], "lugdunensi": [0, 10, 140, 205, 247, 289], "hku09": [0, 10, 140, 205, 247, 289], "miti": [0, 10, 140, 205, 247, 289], "b6": [0, 10, 140, 205, 247, 289], "705": [0, 10, 140, 205, 247, 289], "rectivirgula": [0, 10, 140, 205, 247, 289], "acidothermu": [0, 10, 140, 205, 247, 289], "cellulolyticu": [0, 10, 140, 205, 247, 289], "11b": [0, 10, 140, 205, 247, 289], "lachnospira": [0, 10, 140, 205, 247, 289], "multipara": [0, 10, 140, 205, 247, 289], "19207": [0, 10, 140, 205, 247, 289], "rubrivivax": [0, 10, 140, 205, 247, 289], "gelatinosu": [0, 10, 140, 205, 247, 289], "il144": [0, 10, 140, 205, 247, 289], "nostoc": [0, 10, 140, 205, 247, 289], "7524": [0, 10, 140, 205, 247, 289], "upsaliensi": [0, 10, 140, 205, 247, 289], "rm3195": [0, 10, 140, 205, 247, 289], "anisa": [0, 10, 140, 205, 247, 289], "linanisett": [0, 10, 140, 205, 247, 289], "sainthelensi": [0, 10, 140, 205, 247, 289], "35248": [0, 10, 140, 205, 247, 289], "19231": [0, 10, 140, 205, 247, 289], "lwoffii": [0, 10, 140, 205, 247, 289], "sh145": [0, 10, 140, 205, 247, 289], "weaveri": [0, 10, 140, 205, 247, 289], "5135": [0, 10, 140, 205, 247, 289], "gladioli": [0, 10, 140, 205, 247, 289], "bsr3": [0, 10, 140, 205, 247, 289], "huakuii": [0, 10, 140, 205, 247, 289], "7653r": [0, 10, 140, 205, 247, 289], "alteromona": [0, 10, 140, 205, 247, 289], "macleodii": [0, 10, 140, 205, 247, 289], "black": [0, 10, 76, 77, 140, 205, 247, 289], "sea": [0, 10, 140, 205, 247, 289], "11": [0, 6, 9, 10, 140, 205, 247, 289, 323, 325], "philomiragia": [0, 10, 140, 205, 247, 289], "25017": [0, 10, 140, 205, 247, 289], "eggerthii": [0, 10, 140, 205, 247, 289], "20697": [0, 10, 140, 205, 247, 289], "tannerella": [0, 10, 140, 205, 247, 289], "forsythia": [0, 10, 140, 205, 247, 289], "92a2": [0, 10, 140, 205, 247, 289], "levii": [0, 10, 140, 205, 247, 289], "23370": [0, 10, 140, 205, 247, 289], "ovatu": [0, 10, 140, 205, 247, 289], "8483": [0, 10, 140, 205, 247, 289], "alistip": [0, 10, 140, 205, 247, 289], "putredini": [0, 10, 140, 205, 247, 289], "17216": [0, 10, 140, 205, 247, 289], "odoribact": [0, 10, 140, 205, 247, 289], "splanchnicu": [0, 10, 140, 205, 247, 289], "20712": [0, 10, 140, 205, 247, 289], "asaccharolytica": [0, 10, 140, 205, 247, 289], "20707": [0, 10, 140, 205, 247, 289], "endodontali": [0, 10, 140, 205, 247, 289], "35406": [0, 10, 140, 205, 247, 289], "bivia": [0, 10, 140, 205, 247, 289], "dnf00188": [0, 10, 140, 205, 247, 289], "bucca": [0, 10, 140, 205, 247, 289], "33574": [0, 10, 140, 205, 247, 289], "buccali": [0, 10, 140, 205, 247, 289], "35310": [0, 10, 140, 205, 247, 289], "corpori": [0, 10, 140, 205, 247, 289], "18810": [0, 10, 140, 205, 247, 289], "8529": [0, 10, 140, 205, 247, 289], "f0289": [0, 10, 140, 205, 247, 289], "disien": [0, 10, 140, 205, 247, 289], "6334": [0, 10, 140, 205, 247, 289], "29426": [0, 10, 140, 205, 247, 289], "melaninogenica": [0, 10, 140, 205, 247, 289], "25845": [0, 10, 140, 205, 247, 289], "nigrescen": [0, 10, 140, 205, 247, 289], "33563": [0, 10, 140, 205, 247, 289], "33269": [0, 10, 140, 205, 247, 289], "c735": [0, 10, 140, 205, 247, 289], "oulorum": [0, 10, 140, 205, 247, 289], "14966": [0, 10, 140, 205, 247, 289], "verorali": [0, 10, 140, 205, 247, 289], "f0319": [0, 10, 140, 205, 247, 289], "rikenella": [0, 10, 140, 205, 247, 289], "microfusu": [0, 10, 140, 205, 247, 289], "15922": [0, 10, 140, 205, 247, 289], "cronobact": [0, 10, 140, 205, 247, 289], "sakazakii": [0, 10, 140, 205, 247, 289], "894": [0, 10, 140, 205, 247, 289], "proteamaculan": [0, 10, 140, 205, 247, 289], "568": [0, 10, 140, 205, 247, 289], "kristensenii": [0, 10, 140, 205, 247, 289], "metschnikovii": [0, 10, 140, 205, 247, 289], "69": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "nigripulchritudo": [0, 10, 140, 205, 247, 289], "son1": [0, 10, 140, 205, 247, 289], "102891": [0, 10, 140, 205, 247, 289], "33934": [0, 10, 140, 205, 247, 289], "candidatu": [0, 10, 140, 205, 247, 289], "photodesmu": [0, 10, 140, 205, 247, 289], "katoptron": [0, 10, 140, 205, 247, 289], "acetohalobium": [0, 10, 140, 205, 247, 289], "arabaticum": [0, 10, 140, 205, 247, 289], "5501": [0, 10, 140, 205, 247, 289], "canimorsu": [0, 10, 140, 205, 247, 289], "cc5": [0, 10, 140, 205, 247, 289], "cynodegmi": [0, 10, 140, 205, 247, 289], "19736": [0, 10, 140, 205, 247, 289], "arcobact": [0, 10, 140, 205, 247, 289], "butzleri": [0, 10, 140, 205, 247, 289], "rm4018": [0, 10, 140, 205, 247, 289], "nitrofigili": [0, 10, 140, 205, 247, 289], "7299": [0, 10, 140, 205, 247, 289], "parapaucimobili": [0, 10, 140, 205, 247, 289], "15100": [0, 10, 140, 205, 247, 289], "desulfobacula": [0, 10, 140, 205, 247, 289], "toluolica": [0, 10, 140, 205, 247, 289], "tol2": [0, 10, 140, 205, 247, 289], "penetran": [0, 10, 140, 205, 247, 289], "colwellia": [0, 10, 140, 205, 247, 289], "psychrerythraea": [0, 10, 140, 205, 247, 289], "alterfunditum": [0, 10, 140, 205, 247, 289], "5972": [0, 10, 140, 205, 247, 289], "metallireducen": [0, 10, 140, 205, 247, 289], "ornithobacterium": [0, 10, 140, 205, 247, 289], "rhinotracheal": [0, 10, 140, 205, 247, 289], "15997": [0, 10, 140, 205, 247, 289], "cobetia": [0, 10, 140, 205, 247, 289], "11347": [0, 10, 140, 205, 247, 289], "arcanobacterium": [0, 10, 140, 205, 247, 289], "haemolyticum": [0, 10, 140, 205, 247, 289], "20595": [0, 10, 140, 205, 247, 289], "herbidospora": [0, 10, 140, 205, 247, 289], "cretacea": [0, 10, 140, 205, 247, 289], "clavibact": [0, 10, 140, 205, 247, 289], "michiganensi": [0, 10, 140, 205, 247, 289], "sepedonicu": [0, 10, 140, 205, 247, 289], "xylinu": [0, 10, 140, 205, 247, 289], "e25": [0, 10, 140, 205, 247, 289], "subflava": [0, 10, 140, 205, 247, 289], "nj9703": [0, 10, 140, 205, 247, 289], "pseudomallei": [0, 10, 140, 205, 247, 289], "k96243": [0, 10, 140, 205, 247, 289], "tarenaya": [0, 10, 140, 205, 247, 289], "hassleriana": [0, 10, 140, 205, 247, 289], "talaromyc": [0, 10, 140, 205, 247, 289], "stipitatu": [0, 10, 140, 205, 247, 289], "10500": [0, 10, 140, 205, 247, 289], "islandicu": [0, 10, 140, 205, 247, 289], "allomyc": [0, 10, 140, 205, 247, 289], "macrogynu": [0, 10, 140, 205, 247, 289], "elephantulu": [0, 10, 140, 205, 247, 289], "edwardii": [0, 10, 140, 205, 247, 289], "saccharolyticum": [0, 10, 140, 205, 247, 289], "jw": [0, 10, 140, 205, 247, 289], "sl": [0, 10, 140, 205, 247, 289], "ys485": [0, 10, 140, 205, 247, 289], "enterica": [0, 10, 140, 205, 247, 289], "lt2": [0, 10, 140, 205, 247, 289], "pg45": [0, 10, 140, 205, 247, 289], "brassicicola": [0, 10, 140, 205, 247, 289], "eugracili": [0, 10, 140, 205, 247, 289], "takahashii": [0, 10, 140, 205, 247, 289], "phlebotomu": [0, 10, 140, 205, 247, 289], "papatasi": [0, 10, 140, 205, 247, 289], "uncia": [0, 10, 140, 205, 247, 289], "eptesicu": [0, 10, 140, 205, 247, 289], "mytilu": [0, 10, 140, 205, 247, 289], "galloprovinciali": [0, 10, 140, 205, 247, 289], "neospora": [0, 10, 140, 205, 247, 289], "caninum": [0, 10, 140, 205, 247, 289], "6131": [0, 10, 140, 205, 247, 289], "natronococcu": [0, 10, 140, 205, 247, 289], "occultu": [0, 10, 140, 205, 247, 289], "sp4": [0, 10, 140, 205, 247, 289], "burtonii": [0, 10, 140, 205, 247, 289], "6242": [0, 10, 140, 205, 247, 289], "abyssi": [0, 10, 140, 205, 247, 289], "ge5": [0, 10, 140, 205, 247, 289], "cattleya": [0, 10, 140, 205, 247, 289], "8057": [0, 10, 140, 205, 247, 289], "46488": [0, 10, 140, 205, 247, 289], "griseoluteu": [0, 10, 140, 205, 247, 289], "paenarthrobact": [0, 10, 140, 205, 247, 289], "nicotinovoran": [0, 10, 140, 205, 247, 289], "231sha2": [0, 10, 140, 205, 247, 289], "1m6": [0, 10, 140, 205, 247, 289], "otitidi": [0, 10, 140, 205, 247, 289], "51513": [0, 10, 140, 205, 247, 289], "brockii": [0, 10, 140, 205, 247, 289], "finnii": [0, 10, 140, 205, 247, 289], "ako": [0, 10, 140, 205, 247, 289], "xylanolyticum": [0, 10, 140, 205, 247, 289], "lx": [0, 10, 140, 205, 247, 289], "cellobioparum": [0, 10, 140, 205, 247, 289], "ct1112": [0, 10, 140, 205, 247, 289], "cellulosilyticum": [0, 10, 140, 205, 247, 289], "lentocellum": [0, 10, 140, 205, 247, 289], "5427": [0, 10, 140, 205, 247, 289], "tyzzerella": [0, 10, 140, 205, 247, 289], "nexili": [0, 10, 140, 205, 247, 289], "1787": [0, 10, 140, 205, 247, 289], "papyrosolven": [0, 10, 140, 205, 247, 289], "2782": [0, 10, 140, 205, 247, 289], "paraputrificum": [0, 10, 140, 205, 247, 289], "agr2156": [0, 10, 140, 205, 247, 289], "m23864": [0, 10, 140, 205, 247, 289], "w1": [0, 10, 140, 205, 247, 289], "saprophyticu": [0, 10, 140, 205, 247, 289], "15305": [0, 10, 140, 205, 247, 289], "7292": [0, 10, 140, 205, 247, 289], "capiti": [0, 10, 140, 205, 247, 289], "c87": [0, 10, 140, 205, 247, 289], "morbillorum": [0, 10, 140, 205, 247, 289], "m424": [0, 10, 140, 205, 247, 289], "dolosigranulum": [0, 10, 140, 205, 247, 289], "pigrum": [0, 10, 140, 205, 247, 289], "51524": [0, 10, 140, 205, 247, 289], "microlunatu": [0, 10, 140, 205, 247, 289], "phosphovoru": [0, 10, 140, 205, 247, 289], "nm": [0, 10, 140, 205, 247, 289], "12740": [0, 10, 140, 205, 247, 289], "oakridgensi": [0, 10, 140, 205, 247, 289], "33761": [0, 10, 140, 205, 247, 289], "21215": [0, 10, 140, 205, 247, 289], "mtcc": [0, 10, 140, 205, 247, 289], "9819": [0, 10, 140, 205, 247, 289], "psychrobact": [0, 10, 140, 205, 247, 289], "phenylpyruvicu": [0, 10, 140, 205, 247, 289], "7000": [0, 10, 140, 205, 247, 289], "102152": [0, 10, 140, 205, 247, 289], "savastanoi": [0, 10, 140, 205, 247, 289], "phaseolicola": [0, 10, 140, 205, 247, 289], "1448a": [0, 10, 140, 205, 247, 289], "albilinean": [0, 10, 140, 205, 247, 289], "gpe": [0, 10, 140, 205, 247, 289], "pc73": [0, 10, 140, 205, 247, 289], "elkanii": [0, 10, 140, 205, 247, 289], "wsm2783": [0, 10, 140, 205, 247, 289], "etli": [0, 10, 140, 205, 247, 289], "652": [0, 10, 140, 205, 247, 289], "leucaena": [0, 10, 140, 205, 247, 289], "melitensi": [0, 10, 140, 205, 247, 289], "16m": [0, 10, 140, 205, 247, 289], "neotoma": [0, 10, 140, 205, 247, 289], "5k33": [0, 10, 140, 205, 247, 289], "1330": [0, 10, 140, 205, 247, 289], "veillonella": [0, 10, 140, 205, 247, 289], "parvula": [0, 10, 140, 205, 247, 289], "2008": [0, 10, 140, 205, 247, 289], "atrosepticum": [0, 10, 140, 205, 247, 289], "scri1043": [0, 10, 140, 205, 247, 289], "aldova": [0, 10, 140, 205, 247, 289], "35236": [0, 10, 140, 205, 247, 289], "frederiksenii": [0, 10, 140, 205, 247, 289], "33641": [0, 10, 140, 205, 247, 289], "rohdei": [0, 10, 140, 205, 247, 289], "ruckeri": [0, 10, 140, 205, 247, 289], "furnissii": [0, 10, 140, 205, 247, 289], "11218": [0, 10, 140, 205, 247, 289], "navarrensi": [0, 10, 140, 205, 247, 289], "splendidu": [0, 10, 140, 205, 247, 289], "139": [0, 10, 140, 205, 247, 289], "tubiashii": [0, 10, 140, 205, 247, 289], "19109": [0, 10, 140, 205, 247, 289], "haemof": [0, 10, 140, 205, 247, 289], "ohio2": [0, 10, 140, 205, 247, 289], "turneriella": [0, 10, 140, 205, 247, 289], "21527": [0, 10, 140, 205, 247, 289], "afzelii": [0, 10, 140, 205, 247, 289], "pko": [0, 10, 140, 205, 247, 289], "garinii": [0, 10, 140, 205, 247, 289], "bgvir": [0, 10, 140, 205, 247, 289], "crocidura": [0, 10, 140, 205, 247, 289], "dou": [0, 10, 140, 205, 247, 289], "3654": [0, 10, 140, 205, 247, 289], "succinican": [0, 10, 140, 205, 247, 289], "10402": [0, 10, 140, 205, 247, 289], "2379": [0, 10, 140, 205, 247, 289], "lawsonia": [0, 10, 140, 205, 247, 289], "intracellulari": [0, 10, 140, 205, 247, 289], "phe": [0, 10, 140, 205, 247, 289], "mn1": [0, 10, 140, 205, 247, 289], "rhodothermu": [0, 10, 140, 205, 247, 289], "4252": [0, 10, 140, 205, 247, 289], "axanthum": [0, 10, 140, 205, 247, 289], "25176": [0, 10, 140, 205, 247, 289], "canadens": [0, 10, 140, 205, 247, 289], "meleagridi": [0, 10, 140, 205, 247, 289], "ovipneumonia": [0, 10, 140, 205, 247, 289], "14811": [0, 10, 140, 205, 247, 289], "taylorella": [0, 10, 140, 205, 247, 289], "equigenitali": [0, 10, 140, 205, 247, 289], "mce9": [0, 10, 140, 205, 247, 289], "janthinobacterium": [0, 10, 140, 205, 247, 289], "lividum": [0, 10, 140, 205, 247, 289], "dioscorea": [0, 10, 140, 205, 247, 289], "cayenensi": [0, 10, 140, 205, 247, 289], "rotundata": [0, 10, 140, 205, 247, 289], "raimondii": [0, 10, 140, 205, 247, 289], "lipomyc": [0, 10, 140, 205, 247, 289], "starkeyi": [0, 10, 140, 205, 247, 289], "11557": [0, 10, 140, 205, 247, 289], "cidri": [0, 10, 140, 205, 247, 289], "hanseniaspora": [0, 10, 140, 205, 247, 289], "uvarum": [0, 10, 140, 205, 247, 289], "2768": [0, 10, 140, 205, 247, 289], "vulpinum": [0, 10, 140, 205, 247, 289], "gaeumannomyc": [0, 10, 140, 205, 247, 289], "viren": [0, 10, 140, 205, 247, 289], "discreta": [0, 10, 140, 205, 247, 289], "fgsc": [0, 10, 140, 205, 247, 289], "8579": [0, 10, 140, 205, 247, 289], "laccaria": [0, 10, 140, 205, 247, 289], "calocera": [0, 10, 140, 205, 247, 289], "cornea": [0, 10, 140, 205, 247, 289], "hhb12733": [0, 10, 140, 205, 247, 289], "wp1": [0, 10, 140, 205, 247, 289], "sporothrix": [0, 10, 140, 205, 247, 289], "schenckii": [0, 10, 140, 205, 247, 289], "tolypocladium": [0, 10, 140, 205, 247, 289], "inflatum": [0, 10, 140, 205, 247, 289], "cactorum": [0, 10, 140, 205, 247, 289], "emarginata": [0, 10, 140, 205, 247, 289], "ficusphila": [0, 10, 140, 205, 247, 289], "kikkawai": [0, 10, 140, 205, 247, 289], "neocordata": [0, 10, 140, 205, 247, 289], "prosaltan": [0, 10, 140, 205, 247, 289], "sturtevanti": [0, 10, 140, 205, 247, 289], "meru": [0, 10, 140, 205, 247, 289], "stephensi": [0, 10, 140, 205, 247, 289], "bombu": [0, 10, 140, 205, 247, 289], "terrestri": [0, 10, 140, 205, 247, 289], "opisthocomu": [0, 10, 140, 205, 247, 289], "hoazin": [0, 10, 140, 205, 247, 289], "fulmaru": [0, 10, 140, 205, 247, 289], "glaciali": [0, 10, 140, 205, 247, 289], "tinamu": [0, 10, 140, 205, 247, 289], "remanei": [0, 10, 140, 205, 247, 289], "perkinsu": [0, 10, 140, 205, 247, 289], "50983": [0, 10, 140, 205, 247, 289], "enterocytozoon": [0, 10, 140, 205, 247, 289], "bieneusi": [0, 10, 140, 205, 247, 289], "h348": [0, 10, 140, 205, 247, 289], "graminicola": [0, 10, 140, 205, 247, 289], "m1": [0, 10, 140, 205, 247, 289], "001": [0, 10, 140, 205, 247, 289], "caldicellulosiruptor": [0, 10, 140, 205, 247, 289], "bescii": [0, 10, 140, 205, 247, 289], "6725": [0, 10, 140, 205, 247, 289], "halothermothrix": [0, 10, 140, 205, 247, 289], "orenii": [0, 10, 140, 205, 247, 289], "40040": [0, 10, 140, 205, 247, 289], "9412": [0, 10, 140, 205, 247, 289], "lurida": [0, 10, 140, 205, 247, 289], "2430": [0, 10, 140, 205, 247, 289], "absiella": [0, 10, 140, 205, 247, 289], "dolichum": [0, 10, 140, 205, 247, 289], "3991": [0, 10, 140, 205, 247, 289], "eggerthia": [0, 10, 140, 205, 247, 289], "catenaformi": [0, 10, 140, 205, 247, 289], "ot": [0, 2, 10, 140, 205, 247, 289], "569": [0, 10, 140, 205, 247, 289], "20559": [0, 10, 140, 205, 247, 289], "methylobacterium": [0, 10, 140, 205, 247, 289], "radiotoleran": [0, 10, 140, 205, 247, 289], "2831": [0, 10, 140, 205, 247, 289], "hepaticu": [0, 10, 140, 205, 247, 289], "51449": [0, 10, 140, 205, 247, 289], "synechococcu": [0, 10, 140, 205, 247, 289], "elongatu": [0, 10, 140, 205, 247, 289], "7002": [0, 10, 140, 205, 247, 289], "wh": [0, 10, 140, 205, 247, 289], "7803": [0, 10, 140, 205, 247, 289], "calothrix": [0, 10, 140, 205, 247, 289], "6303": [0, 10, 140, 205, 247, 289], "7103": [0, 10, 140, 205, 247, 289], "tetranychu": [0, 10, 140, 205, 247, 289], "urtica": [0, 10, 140, 205, 247, 289], "desulfurella": [0, 10, 140, 205, 247, 289], "a63": [0, 10, 140, 205, 247, 289], "winkia": [0, 10, 140, 205, 247, 289], "neuii": [0, 10, 140, 205, 247, 289], "8576": [0, 10, 140, 205, 247, 289], "avidum": [0, 10, 140, 205, 247, 289], "44067": [0, 10, 140, 205, 247, 289], "granulosum": [0, 10, 140, 205, 247, 289], "tm11": [0, 10, 140, 205, 247, 289], "propionimicrobium": [0, 10, 140, 205, 247, 289], "lymphophilum": [0, 10, 140, 205, 247, 289], "093": [0, 10, 140, 205, 247, 289], "sch5": [0, 10, 140, 205, 247, 289], "sporolactobacillu": [0, 10, 140, 205, 247, 289], "laevolacticu": [0, 10, 140, 205, 247, 289], "442": [0, 10, 140, 205, 247, 289], "anaerococcu": [0, 10, 140, 205, 247, 289], "hydrogenali": [0, 10, 140, 205, 247, 289], "7454": [0, 10, 140, 205, 247, 289], "peptoniphilu": [0, 10, 140, 205, 247, 289], "indolicu": [0, 10, 140, 205, 247, 289], "29427": [0, 10, 140, 205, 247, 289], "lacrimali": [0, 10, 140, 205, 247, 289], "315": [0, 10, 140, 205, 247, 289], "lactolyticu": [0, 10, 140, 205, 247, 289], "51172": [0, 10, 140, 205, 247, 289], "parvimona": [0, 10, 140, 205, 247, 289], "micra": [0, 10, 140, 205, 247, 289], "33270": [0, 10, 140, 205, 247, 289], "prevotii": [0, 10, 140, 205, 247, 289], "20548": [0, 10, 140, 205, 247, 289], "producta": [0, 10, 140, 205, 247, 289], "tetradiu": [0, 10, 140, 205, 247, 289], "35098": [0, 10, 140, 205, 247, 289], "51170": [0, 10, 140, 205, 247, 289], "coprococcu": [0, 10, 140, 205, 247, 289], "eutactu": [0, 10, 140, 205, 247, 289], "27759": [0, 10, 140, 205, 247, 289], "doshia": [0, 10, 140, 205, 247, 289], "12862": [0, 10, 140, 205, 247, 289], "700133": [0, 10, 140, 205, 247, 289], "grahamii": [0, 10, 140, 205, 247, 289], "as4aup": [0, 10, 140, 205, 247, 289], "taylorii": [0, 10, 140, 205, 247, 289], "8tbb": [0, 10, 140, 205, 247, 289], "vinsonii": [0, 10, 140, 205, 247, 289], "arupensi": [0, 10, 140, 205, 247, 289], "pm136co": [0, 10, 140, 205, 247, 289], "kinetoplastibacterium": [0, 10, 140, 205, 247, 289], "crithidii": [0, 10, 140, 205, 247, 289], "tcc036e": [0, 10, 140, 205, 247, 289], "caldu": [0, 10, 140, 205, 247, 289], "51756": [0, 10, 140, 205, 247, 289], "7421": [0, 10, 140, 205, 247, 289], "acidobacterium": [0, 10, 140, 205, 247, 289], "51196": [0, 10, 140, 205, 247, 289], "invaden": [0, 10, 140, 205, 247, 289], "ip1": [0, 10, 140, 205, 247, 289], "eremothecium": [0, 10, 140, 205, 247, 289], "10895": [0, 10, 140, 205, 247, 289], "terreu": [0, 10, 140, 205, 247, 289], "uncinocarpu": [0, 10, 140, 205, 247, 289], "reesii": [0, 10, 140, 205, 247, 289], "1704": [0, 10, 140, 205, 247, 289], "purpureocillium": [0, 10, 140, 205, 247, 289], "lilacinum": [0, 10, 140, 205, 247, 289], "coriobacterium": [0, 10, 140, 205, 247, 289], "glomeran": [0, 10, 140, 205, 247, 289], "pw2": [0, 10, 140, 205, 247, 289], "catenuloplan": [0, 10, 140, 205, 247, 289], "s18": [0, 10, 140, 205, 247, 289], "galbu": [0, 10, 140, 205, 247, 289], "avermitili": [0, 10, 140, 205, 247, 289], "4680": [0, 10, 140, 205, 247, 289], "14893": [0, 10, 140, 205, 247, 289], "mortiv": [0, 10, 140, 205, 247, 289], "44261": [0, 10, 140, 205, 247, 289], "u32": [0, 10, 140, 205, 247, 289], "anoxybacillu": [0, 10, 140, 205, 247, 289], "flavithermu": [0, 10, 140, 205, 247, 289], "yunnanensi": [0, 10, 140, 205, 247, 289], "e13": [0, 10, 140, 205, 247, 289], "thermodenitrifican": [0, 10, 140, 205, 247, 289], "ng80": [0, 10, 140, 205, 247, 289], "thermoleovoran": [0, 10, 140, 205, 247, 289], "ccb_us3_uf5": [0, 10, 140, 205, 247, 289], "kyrpidia": [0, 10, 140, 205, 247, 289], "tuscia": [0, 10, 140, 205, 247, 289], "2912": [0, 10, 140, 205, 247, 289], "14025": [0, 10, 140, 205, 247, 289], "acetobacterium": [0, 10, 140, 205, 247, 289], "woodii": [0, 10, 140, 205, 247, 289], "1030": [0, 10, 140, 205, 247, 289], "johnsonii": [0, 10, 140, 205, 247, 289], "ncc": [0, 10, 140, 205, 247, 289], "533": [0, 10, 140, 205, 247, 289], "citreum": [0, 10, 140, 205, 247, 289], "km20": [0, 10, 140, 205, 247, 289], "pseudomesenteroid": [0, 10, 140, 205, 247, 289], "4882": [0, 10, 140, 205, 247, 289], "melissococcu": [0, 10, 140, 205, 247, 289], "plutoniu": [0, 10, 140, 205, 247, 289], "35311": [0, 10, 140, 205, 247, 289], "amblyommati": [0, 10, 140, 205, 247, 289], "gat": [0, 10, 140, 205, 247, 289], "30v": [0, 10, 140, 205, 247, 289], "osu": [0, 10, 140, 205, 247, 289], "85": [0, 10, 140, 165, 166, 168, 205, 247, 289], "389": [0, 10, 140, 205, 247, 289], "montanensi": [0, 10, 140, 205, 247, 289], "930": [0, 10, 140, 205, 247, 289], "rhipicephali": [0, 10, 140, 205, 247, 289], "female6": [0, 10, 140, 205, 247, 289], "cwpp": [0, 10, 140, 205, 247, 289], "helminthoeca": [0, 10, 140, 205, 247, 289], "oregon": [0, 10, 140, 205, 247, 289], "gluconacetobact": [0, 10, 140, 205, 247, 289], "pa1": [0, 10, 140, 205, 247, 289], "aminophilu": [0, 10, 140, 205, 247, 289], "7686": [0, 10, 140, 205, 247, 289], "versutu": [0, 10, 140, 205, 247, 289], "halopraeferen": [0, 10, 140, 205, 247, 289], "3675": [0, 10, 140, 205, 247, 289], "centenum": [0, 10, 140, 205, 247, 289], "sw": [0, 10, 140, 172, 205, 217, 247, 258, 289, 302], "liberibact": [0, 10, 140, 205, 247, 289], "asiaticu": [0, 10, 140, 205, 247, 289], "gxpsy": [0, 10, 140, 205, 247, 289], "leptothrix": [0, 10, 140, 205, 247, 289], "cholodnii": [0, 10, 140, 205, 247, 289], "rahnella": [0, 10, 140, 205, 247, 289], "aquatili": [0, 10, 140, 205, 247, 289], "78": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "65": [0, 10, 140, 158, 205, 221, 247, 289], "33071": [0, 10, 140, 205, 247, 289], "variovorax": [0, 10, 140, 205, 247, 289], "110b": [0, 10, 140, 205, 247, 289], "riemerella": [0, 10, 140, 205, 247, 289], "anatipestif": [0, 10, 140, 205, 247, 289], "ra": [0, 10, 140, 205, 247, 289], "gd": [0, 10, 140, 205, 247, 289], "antarcticu": [0, 10, 140, 205, 247, 289], "4by": [0, 10, 140, 205, 247, 289], "phaeoclathratiform": [0, 10, 140, 205, 247, 289], "bu": [0, 10, 140, 205, 247, 289], "sphaerotilu": [0, 10, 140, 205, 247, 289], "natan": [0, 10, 140, 205, 247, 289], "6575": [0, 10, 140, 205, 247, 289], "streptobacillu": [0, 10, 140, 205, 247, 289], "moniliformi": [0, 10, 140, 205, 247, 289], "12112": [0, 10, 140, 205, 247, 289], "lotu": [0, 10, 140, 205, 247, 289], "mixia": [0, 10, 140, 205, 247, 289], "osmunda": [0, 10, 140, 205, 247, 289], "blumeria": [0, 10, 140, 205, 247, 289], "tonsuran": [0, 10, 140, 205, 247, 289], "conidiobolu": [0, 10, 140, 205, 247, 289], "coronatu": [0, 10, 140, 205, 247, 289], "28638": [0, 10, 140, 205, 247, 289], "strongyloid": [0, 10, 140, 205, 247, 289], "mela": [0, 10, 140, 205, 247, 289], "quadriannulatu": [0, 10, 140, 205, 247, 289], "heliconiu": [0, 10, 140, 205, 247, 289], "melpomen": [0, 10, 140, 205, 247, 289], "plesseni": [0, 10, 140, 205, 247, 289], "brl": [0, 10, 140, 205, 247, 289], "brachi": [0, 10, 140, 205, 247, 289], "33089": [0, 10, 140, 205, 247, 289], "nodatum": [0, 10, 140, 205, 247, 289], "33099": [0, 10, 140, 205, 247, 289], "stomoxi": [0, 10, 140, 205, 247, 289], "calcitran": [0, 10, 140, 205, 247, 289], "griseoflavu": [0, 10, 140, 205, 247, 289], "tu4000": [0, 10, 140, 205, 247, 289], "mobaraensi": [0, 10, 140, 205, 247, 289], "13819": [0, 10, 140, 205, 247, 289], "40847": [0, 10, 140, 205, 247, 289], "oculi": [0, 10, 140, 205, 247, 289], "heliobacterium": [0, 10, 140, 205, 247, 289], "modesticaldum": [0, 10, 140, 205, 247, 289], "ice1": [0, 10, 140, 205, 247, 289], "amalonaticu": [0, 10, 140, 205, 247, 289], "festuca": [0, 10, 140, 205, 247, 289], "macrophomina": [0, 10, 140, 205, 247, 289], "phaseolina": [0, 10, 140, 205, 247, 289], "ms6": [0, 10, 140, 205, 247, 289], "sporichthya": [0, 10, 140, 205, 247, 289], "43042": [0, 10, 140, 205, 247, 289], "dactylosporangium": [0, 10, 140, 205, 247, 289], "aurantiacum": [0, 10, 140, 205, 247, 289], "kutscheri": [0, 10, 140, 205, 247, 289], "pilosum": [0, 10, 140, 205, 247, 289], "20521": [0, 10, 140, 205, 247, 289], "choerinum": [0, 10, 140, 205, 247, 289], "peanut": [0, 10, 140, 205, 247, 289], "witch": [0, 10, 140, 205, 247, 289], "broom": [0, 10, 140, 205, 247, 289], "phytoplasma": [0, 10, 140, 205, 247, 289], "ntu2011": [0, 10, 140, 205, 247, 289], "coprothermobact": [0, 10, 140, 205, 247, 289], "5265": [0, 10, 140, 205, 247, 289], "africa": [0, 10, 140, 205, 247, 289], "esf": [0, 10, 140, 205, 247, 289], "helvetica": [0, 10, 140, 205, 247, 289], "c9p9": [0, 10, 140, 205, 247, 289], "yh": [0, 10, 140, 205, 247, 289], "massilia": [0, 10, 140, 205, 247, 289], "azt80": [0, 10, 140, 205, 247, 289], "portsmouth": [0, 10, 140, 205, 247, 289], "sibirica": [0, 10, 140, 205, 247, 289], "246": [0, 10, 140, 205, 247, 289], "slovaca": [0, 10, 140, 205, 247, 289], "as145": [0, 10, 140, 205, 247, 289], "nitrococcu": [0, 10, 140, 205, 247, 289], "231": [0, 10, 140, 205, 247, 289], "briensi": [0, 10, 140, 205, 247, 289], "128": [0, 10, 140, 205, 247, 289], "nitrospina": [0, 10, 140, 205, 247, 289], "211": [0, 10, 140, 165, 205, 247, 289], "rhodovulum": [0, 10, 140, 205, 247, 289], "sulfidophilum": [0, 10, 140, 205, 247, 289], "1374": [0, 10, 140, 205, 247, 289], "holmesii": [0, 10, 140, 205, 247, 289], "51541": [0, 10, 140, 205, 247, 289], "heilmannii": [0, 10, 140, 205, 247, 289], "asb1": [0, 10, 140, 205, 247, 289], "pullorum": [0, 10, 140, 205, 247, 289], "mit": [0, 10, 140, 205, 247, 289], "98": [0, 10, 140, 205, 247, 289], "5489": [0, 10, 140, 205, 247, 289], "pseudobacteroid": [0, 10, 140, 205, 247, 289], "cellulosolven": [0, 10, 140, 205, 247, 289], "35603": [0, 10, 140, 205, 247, 289], "2933": [0, 10, 140, 205, 247, 289], "cd2": [0, 10, 140, 205, 247, 289], "bilophila": [0, 10, 140, 205, 247, 289], "wadsworthia": [0, 10, 140, 205, 247, 289], "49260": [0, 10, 140, 205, 247, 289], "holophaga": [0, 10, 140, 205, 247, 289], "foetida": [0, 10, 140, 205, 247, 289], "6591": [0, 10, 140, 205, 247, 289], "thermoamylovoran": [0, 10, 140, 205, 247, 289], "ipomoea": [0, 10, 140, 205, 247, 289], "triloba": [0, 10, 140, 205, 247, 289], "fabianii": [0, 10, 140, 205, 247, 289], "vanderwaltozyma": [0, 10, 140, 205, 247, 289], "polyspora": [0, 10, 140, 205, 247, 289], "70294": [0, 10, 140, 205, 247, 289], "poae": [0, 10, 140, 205, 247, 289], "cantharellu": [0, 10, 140, 205, 247, 289], "cibariu": [0, 10, 140, 205, 247, 289], "ganoderma": [0, 10, 140, 205, 247, 289], "sinens": [0, 10, 140, 205, 247, 289], "zz0214": [0, 10, 140, 205, 247, 289], "mucor": [0, 10, 140, 205, 247, 289], "circinelloid": [0, 10, 140, 205, 247, 289], "megaselia": [0, 10, 140, 205, 247, 289], "scalari": [0, 10, 140, 205, 247, 289], "pelecanu": [0, 10, 140, 205, 247, 289], "oval": [0, 10, 140, 205, 247, 289], "curtisi": [0, 10, 140, 205, 247, 289], "globisporangium": [0, 10, 140, 205, 247, 289], "irregular": [0, 10, 140, 205, 247, 289], "181": [0, 10, 140, 169, 205, 247, 289], "coprophilum": [0, 10, 140, 205, 247, 289], "digitatum": [0, 10, 140, 205, 247, 289], "dermabact": [0, 10, 140, 205, 247, 289], "1368": [0, 10, 140, 205, 247, 289], "saccharoperbutylacetonicum": [0, 10, 140, 205, 247, 289], "hmt": [0, 10, 140, 205, 247, 289], "cichorii": [0, 10, 140, 205, 247, 289], "jbc1": [0, 10, 140, 205, 247, 289], "abscessu": [0, 10, 140, 205, 247, 289], "genavens": [0, 10, 140, 205, 247, 289], "51234": [0, 10, 140, 205, 247, 289], "rhodesia": [0, 10, 140, 205, 247, 289], "js60": [0, 10, 140, 205, 247, 289], "aichiensi": [0, 10, 140, 205, 247, 289], "108223": [0, 10, 140, 205, 247, 289], "amara": [0, 10, 140, 205, 247, 289], "15530": [0, 10, 140, 205, 247, 289], "sputi": [0, 10, 140, 205, 247, 289], "100414": [0, 10, 140, 205, 247, 289], "celatum": [0, 10, 140, 205, 247, 289], "1785": [0, 10, 140, 205, 247, 289], "intestinal": [0, 10, 140, 205, 247, 289], "urnw": [0, 10, 140, 205, 247, 289], "desulfitobacterium": [0, 10, 140, 205, 247, 289], "dehalogenan": [0, 10, 140, 205, 247, 289], "51507": [0, 10, 140, 205, 247, 289], "23365": [0, 10, 140, 205, 247, 289], "12475": [0, 10, 140, 205, 247, 289], "paraburkholderia": [0, 10, 140, 205, 247, 289], "xenovoran": [0, 10, 140, 205, 247, 289], "lb400": [0, 10, 140, 205, 247, 289], "cangingivali": [0, 10, 140, 205, 247, 289], "canori": [0, 10, 140, 205, 247, 289], "clavispora": [0, 10, 140, 205, 247, 289], "lusitania": [0, 10, 140, 205, 247, 289], "lodderomyc": [0, 10, 140, 205, 247, 289], "elongisporu": [0, 10, 140, 205, 247, 289], "brevipalpi": [0, 10, 140, 205, 247, 289], "gavia": [0, 10, 140, 205, 247, 289], "stellata": [0, 10, 140, 205, 247, 289], "700358": [0, 10, 140, 205, 247, 289], "brevicatena": [0, 10, 140, 205, 247, 289], "12119": [0, 10, 140, 205, 247, 289], "carnea": [0, 10, 140, 205, 247, 289], "14403": [0, 10, 140, 205, 247, 289], "farcinica": [0, 10, 140, 205, 247, 289], "ifm": [0, 10, 140, 205, 247, 289], "10152": [0, 10, 140, 205, 247, 289], "nova": [0, 10, 140, 205, 247, 289], "sh22a": [0, 10, 140, 205, 247, 289], "transvalensi": [0, 10, 140, 205, 247, 289], "15921": [0, 10, 140, 205, 247, 289], "plasmodiophora": [0, 10, 140, 205, 247, 289], "bili": [0, 10, 140, 205, 247, 289], "43879": [0, 10, 140, 205, 247, 289], "pisolithu": [0, 10, 140, 205, 247, 289], "tinctoriu": [0, 10, 140, 205, 247, 289], "marx": [0, 10, 140, 205, 247, 289], "270": [0, 10, 140, 205, 247, 289], "laceyella": [0, 10, 140, 205, 247, 289], "sacchari": [0, 10, 140, 205, 247, 289], "marichromatium": [0, 10, 140, 205, 247, 289], "purpuratum": [0, 10, 140, 205, 247, 289], "984": [0, 10, 140, 205, 247, 289], "scotoductu": [0, 10, 140, 205, 247, 289], "sa": [0, 10, 140, 205, 247, 289], "octopu": [0, 10, 140, 205, 247, 289], "bimaculoid": [0, 10, 140, 205, 247, 289], "algidicarni": [0, 10, 140, 205, 247, 289], "aegilop": [0, 10, 140, 205, 247, 289], "tauschii": [0, 10, 140, 205, 247, 289], "mali": [0, 10, 140, 205, 247, 289], "AT": [0, 10, 140, 205, 247, 289], "marneffei": [0, 10, 140, 205, 247, 289], "18224": [0, 10, 140, 205, 247, 289], "casseliflavu": [0, 10, 140, 205, 247, 289], "ec20": [0, 10, 140, 205, 247, 289], "gattii": [0, 10, 140, 205, 247, 289], "ejb2": [0, 10, 140, 205, 247, 289], "heterorhabd": [0, 10, 140, 205, 247, 289], "bacteriophora": [0, 10, 140, 205, 247, 289], "rhytidhysteron": [0, 10, 140, 205, 247, 289], "rufulum": [0, 10, 140, 205, 247, 289], "opacu": [0, 10, 140, 205, 247, 289], "sicilia": [0, 10, 140, 205, 247, 289], "c2j": [0, 10, 140, 205, 247, 289], "chaetomium": [0, 10, 140, 205, 247, 289], "rhynchosporium": [0, 10, 140, 205, 247, 289], "secali": [0, 10, 140, 205, 247, 289], "accolen": [0, 10, 140, 205, 247, 289], "49725": [0, 10, 140, 205, 247, 289], "33030": [0, 10, 140, 205, 247, 289], "jeikeium": [0, 10, 140, 205, 247, 289], "k411": [0, 10, 140, 205, 247, 289], "damsela": [0, 10, 140, 205, 247, 289], "102761": [0, 10, 140, 205, 247, 289], "pristinaespirali": [0, 10, 140, 205, 247, 289], "25486": [0, 10, 140, 205, 247, 289], "pseudogenitalium": [0, 10, 140, 205, 247, 289], "33035": [0, 10, 140, 205, 247, 289], "vitaerumini": [0, 10, 140, 205, 247, 289], "20294": [0, 10, 140, 205, 247, 289], "frateurii": [0, 10, 140, 205, 247, 289], "103465": [0, 10, 140, 205, 247, 289], "rhodnii": [0, 10, 140, 205, 247, 289], "5362": [0, 10, 140, 205, 247, 289], "alga": [0, 10, 140, 205, 247, 289], "14758": [0, 10, 140, 205, 247, 289], "hensela": [0, 10, 140, 205, 247, 289], "houston": [0, 10, 140, 205, 247, 289], "tonsillarum": [0, 10, 140, 205, 247, 289], "14972": [0, 10, 140, 205, 247, 289], "eragrosti": [0, 10, 140, 205, 247, 289], "curvula": [0, 10, 140, 205, 247, 289], "panicum": [0, 10, 140, 205, 247, 289], "virgatum": [0, 10, 140, 205, 247, 289], "neolentinu": [0, 10, 140, 205, 247, 289], "lepideu": [0, 10, 140, 205, 247, 289], "hhb14362": [0, 10, 140, 205, 247, 289], "ss": [0, 10, 140, 205, 247, 289], "micromona": [0, 10, 140, 205, 247, 289], "pusilla": [0, 10, 140, 205, 247, 289], "fraxinu": [0, 10, 140, 205, 247, 289], "excelsior": [0, 10, 140, 205, 247, 289], "palma": [0, 10, 140, 205, 247, 289], "j233": [0, 10, 140, 205, 247, 289], "maripaludi": [0, 10, 140, 205, 247, 289], "c6": [0, 10, 140, 205, 247, 289], "tuber": [0, 10, 140, 205, 247, 289], "melanosporum": [0, 10, 140, 205, 247, 289], "mel28": [0, 10, 140, 205, 247, 289], "faecalitalea": [0, 10, 140, 205, 247, 289], "cylindroid": [0, 10, 140, 205, 247, 289], "27803": [0, 10, 140, 205, 247, 289], "agathobaculum": [0, 10, 140, 205, 247, 289], "desmolan": [0, 10, 140, 205, 247, 289], "43058": [0, 10, 140, 205, 247, 289], "dorea": [0, 10, 140, 205, 247, 289], "formicigeneran": [0, 10, 140, 205, 247, 289], "4_6_53afaa": [0, 10, 140, 205, 247, 289], "anaerobutyricum": [0, 10, 140, 205, 247, 289], "hallii": [0, 10, 140, 205, 247, 289], "3353": [0, 10, 140, 205, 247, 289], "ramulu": [0, 10, 140, 205, 247, 289], "29099": [0, 10, 140, 205, 247, 289], "ventriosum": [0, 10, 140, 205, 247, 289], "27560": [0, 10, 140, 205, 247, 289], "xylanophilum": [0, 10, 140, 205, 247, 289], "35991": [0, 10, 140, 205, 247, 289], "ciceri": [0, 10, 140, 205, 247, 289], "biserrula": [0, 10, 140, 205, 247, 289], "wsm1271": [0, 10, 140, 205, 247, 289], "cellvibrio": [0, 10, 140, 205, 247, 289], "mixtu": [0, 10, 140, 205, 247, 289], "j3": [0, 10, 140, 205, 247, 289], "methanosalsum": [0, 10, 140, 205, 247, 289], "zhilina": [0, 10, 140, 205, 247, 289], "4017": [0, 10, 140, 205, 247, 289], "mayetiola": [0, 10, 140, 205, 247, 289], "destructor": [0, 10, 140, 205, 247, 289], "hydrogenovibrio": [0, 10, 140, 205, 247, 289], "crunogenu": [0, 10, 140, 205, 247, 289], "xcl": [0, 10, 140, 205, 247, 289], "sulfurimona": [0, 10, 140, 205, 247, 289], "1251": [0, 10, 140, 205, 247, 289], "blattabacterium": [0, 10, 140, 205, 247, 289], "mastoterm": [0, 10, 140, 205, 247, 289], "darwiniensi": [0, 10, 140, 205, 247, 289], "madar": [0, 10, 140, 205, 247, 289], "methylomicrobium": [0, 10, 140, 205, 247, 289], "album": [0, 10, 140, 205, 247, 289], "bg8": [0, 10, 140, 205, 247, 289], "atypica": [0, 10, 140, 205, 247, 289], "kon": [0, 10, 140, 205, 247, 289], "dispar": [0, 10, 140, 205, 247, 289], "17748": [0, 10, 140, 205, 247, 289], "glucuronolyticum": [0, 10, 140, 205, 247, 289], "51867": [0, 10, 140, 205, 247, 289], "htcc2594": [0, 10, 140, 205, 247, 289], "moravica": [0, 10, 140, 205, 247, 289], "19234": [0, 10, 140, 205, 247, 289], "hypsizygu": [0, 10, 140, 205, 247, 289], "marmoreu": [0, 10, 140, 205, 247, 289], "helcococcu": [0, 10, 140, 205, 247, 289], "kunzii": [0, 10, 140, 205, 247, 289], "51366": [0, 10, 140, 205, 247, 289], "victoria": [0, 10, 140, 205, 247, 289], "fi3": [0, 10, 140, 205, 247, 289], "tetrasperma": [0, 10, 140, 205, 247, 289], "oligotropha": [0, 10, 140, 205, 247, 289], "carboxidovoran": [0, 10, 140, 205, 247, 289], "om5": [0, 10, 140, 205, 247, 289], "glumipatula": [0, 10, 140, 205, 247, 289], "meridionali": [0, 10, 140, 205, 247, 289], "avenaceum": [0, 10, 140, 205, 247, 289], "sh046": [0, 10, 140, 205, 247, 289], "junii": [0, 10, 140, 205, 247, 289], "radioresisten": [0, 10, 140, 205, 247, 289], "sh164": [0, 10, 140, 205, 247, 289], "lfi1238": [0, 10, 140, 205, 247, 289], "italicum": [0, 10, 140, 205, 247, 289], "cerana": [0, 10, 140, 205, 247, 289], "brl01": [0, 10, 140, 205, 247, 289], "stenotrophomona": [0, 10, 140, 205, 247, 289], "maltophilia": [0, 10, 140, 205, 247, 289], "k279a": [0, 10, 140, 205, 247, 289], "fonsecaea": [0, 10, 140, 205, 247, 289], "pedrosoi": [0, 10, 140, 205, 247, 289], "37": [0, 10, 140, 205, 247, 289, 324, 325], "a165": [0, 10, 140, 205, 247, 289], "daedalea": [0, 10, 140, 205, 247, 289], "quercina": [0, 10, 140, 205, 247, 289], "l": [0, 5, 9, 10, 65, 66, 140, 205, 247, 289], "15889": [0, 10, 140, 205, 247, 289], "fistulina": [0, 10, 140, 205, 247, 289], "hepatica": [0, 10, 140, 205, 247, 289], "64428": [0, 10, 140, 205, 247, 289], "fomitopsi": [0, 10, 140, 205, 247, 289], "pinicola": [0, 10, 140, 205, 247, 289], "stereum": [0, 10, 140, 205, 247, 289], "bromii": [0, 10, 140, 205, 247, 289], "l2": [0, 10, 140, 166, 167, 169, 205, 247, 289, 324, 325], "63": [0, 10, 140, 165, 205, 247, 289], "callidu": [0, 10, 140, 205, 247, 289], "27760": [0, 10, 140, 205, 247, 289], "obeum": [0, 10, 140, 205, 247, 289], "29174": [0, 10, 140, 205, 247, 289], "leptotrichia": [0, 10, 140, 205, 247, 289], "1013": [0, 10, 140, 205, 247, 289], "sutterella": [0, 10, 140, 205, 247, 289], "wadsworthensi": [0, 10, 140, 205, 247, 289], "hga0223": [0, 10, 140, 205, 247, 289], "botryti": [0, 10, 140, 205, 247, 289], "sporobolomyc": [0, 10, 140, 205, 247, 289], "roseu": [0, 10, 140, 205, 247, 289], "13481": [0, 10, 140, 205, 247, 289], "actinosynnema": [0, 10, 140, 205, 247, 289], "43827": [0, 10, 140, 205, 247, 289], "lentzea": [0, 10, 140, 205, 247, 289], "albidocapillata": [0, 10, 140, 205, 247, 289], "bovienii": [0, 10, 140, 205, 247, 289], "2004": [0, 10, 140, 205, 247, 289], "poinarii": [0, 10, 140, 205, 247, 289], "g6": [0, 10, 140, 205, 247, 289], "paspali": [0, 10, 140, 205, 247, 289], "balansia": [0, 10, 140, 205, 247, 289], "obtecta": [0, 10, 140, 205, 247, 289], "thioploca": [0, 10, 140, 205, 247, 289], "ingrica": [0, 10, 140, 205, 247, 289], "duttonii": [0, 10, 140, 205, 247, 289], "ly": [0, 10, 140, 205, 247, 289], "rhopalosiphum": [0, 10, 140, 205, 247, 289], "padi": [0, 10, 140, 205, 247, 289], "azurea": [0, 10, 140, 205, 247, 289], "szmc": [0, 10, 140, 205, 247, 289], "14600": [0, 10, 140, 205, 247, 289], "cyanea": [0, 10, 140, 205, 247, 289], "na": [0, 10, 140, 205, 247, 289], "134": [0, 10, 140, 166, 169, 205, 247, 289], "k62": [0, 10, 140, 205, 247, 289], "carbonariu": [0, 10, 140, 205, 247, 289], "item": [0, 2, 10, 140, 205, 247, 289, 325], "5010": [0, 10, 140, 205, 247, 289], "elsino": [0, 10, 140, 205, 247, 289], "penicilliopsi": [0, 10, 140, 205, 247, 289], "zonata": [0, 10, 140, 205, 247, 289], "ewingella": [0, 10, 140, 205, 247, 289], "33852": [0, 10, 140, 205, 247, 289], "atroparvu": [0, 10, 140, 205, 247, 289], "lomentospora": [0, 10, 140, 205, 247, 289], "prolifican": [0, 10, 140, 205, 247, 289], "bathycoccu": [0, 10, 140, 205, 247, 289], "prasino": [0, 10, 140, 205, 247, 289], "microthrix": [0, 10, 140, 205, 247, 289], "parvicella": [0, 10, 140, 205, 247, 289], "rn1": [0, 10, 140, 205, 247, 289], "amanita": [0, 10, 140, 205, 247, 289], "muscaria": [0, 10, 140, 205, 247, 289], "koid": [0, 10, 140, 205, 247, 289], "bx008": [0, 10, 140, 205, 247, 289], "catonia": [0, 10, 140, 205, 247, 289], "f0037": [0, 10, 140, 205, 247, 289], "saccharolyticu": [0, 10, 140, 205, 247, 289], "43076": [0, 10, 140, 205, 247, 289], "bipectinata": [0, 10, 140, 205, 247, 289], "jirovecii": [0, 10, 140, 205, 247, 289], "se8": [0, 10, 140, 205, 247, 289], "diversum": [0, 10, 140, 205, 247, 289], "acidiscabi": [0, 10, 140, 205, 247, 289], "84": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "104": [0, 10, 140, 205, 247, 289], "magnatum": [0, 10, 140, 205, 247, 289], "borchii": [0, 10, 140, 205, 247, 289], "hi1": [0, 10, 140, 205, 247, 289], "rubrobact": [0, 10, 140, 205, 247, 289], "phoenix": [0, 10, 140, 205, 247, 289], "dactylifera": [0, 10, 140, 205, 247, 289], "aciculosporium": [0, 10, 140, 205, 247, 289], "maff": [0, 10, 140, 205, 247, 289], "241224": [0, 10, 140, 205, 247, 289], "dubliniensi": [0, 10, 140, 205, 247, 289], "vittaforma": [0, 10, 140, 205, 247, 289], "50505": [0, 10, 140, 205, 247, 289], "halobacteroid": [0, 10, 140, 205, 247, 289], "halobiu": [0, 10, 140, 205, 247, 289], "5150": [0, 10, 140, 205, 247, 289], "149": [0, 10, 140, 205, 247, 289], "lichtheimia": [0, 10, 140, 205, 247, 289], "corymbifera": [0, 10, 140, 205, 247, 289], "desulfofundulu": [0, 10, 140, 205, 247, 289], "thermocisternu": [0, 10, 140, 205, 247, 289], "10259": [0, 10, 140, 205, 247, 289], "salina": [0, 10, 140, 205, 247, 289], "collinu": [0, 10, 140, 205, 247, 289], "tu": [0, 10, 140, 205, 247, 289], "365": [0, 10, 140, 159, 171, 205, 211, 216, 247, 253, 257, 289, 296, 301, 324, 325], "gelatoporia": [0, 10, 140, 205, 247, 289], "subvermispora": [0, 10, 140, 205, 247, 289], "amarillan": [0, 10, 140, 205, 247, 289], "e57": [0, 10, 140, 205, 247, 289], "argentoratens": [0, 10, 140, 205, 247, 289], "44202": [0, 10, 140, 205, 247, 289], "ammonifex": [0, 10, 140, 205, 247, 289], "degensii": [0, 10, 140, 205, 247, 289], "kc4": [0, 10, 140, 205, 247, 289], "lentu": [0, 10, 140, 205, 247, 289], "f1142": [0, 10, 140, 205, 247, 289], "urrwxcal2": [0, 10, 140, 205, 247, 289], "nankai": [0, 10, 140, 205, 247, 289], "christyi": [0, 10, 140, 205, 247, 289], "rey15a": [0, 10, 140, 205, 247, 289], "maidi": [0, 10, 140, 205, 247, 289], "darlingi": [0, 10, 140, 205, 247, 289], "capronia": [0, 10, 140, 205, 247, 289], "epimyc": [0, 10, 140, 205, 247, 289], "14159": [0, 10, 140, 205, 247, 289], "proteoclasticu": [0, 10, 140, 205, 247, 289], "p6b7": [0, 10, 140, 205, 247, 289], "prauserella": [0, 10, 140, 205, 247, 289], "kutzneria": [0, 10, 140, 205, 247, 289], "albida": [0, 10, 140, 205, 247, 289], "43870": [0, 10, 140, 205, 247, 289], "cathart": [0, 10, 140, 205, 247, 289], "aura": [0, 10, 140, 205, 247, 289], "6643": [0, 10, 140, 205, 247, 289], "citrea": [0, 10, 140, 205, 247, 289], "8771": [0, 10, 140, 205, 247, 289], "luteoviolacea": [0, 10, 140, 205, 247, 289], "29581": [0, 10, 140, 205, 247, 289], "rubra": [0, 10, 140, 205, 247, 289], "6842": [0, 10, 140, 205, 247, 289], "aurescen": [0, 10, 140, 205, 247, 289], "tc1": [0, 10, 140, 205, 247, 289], "brachybacterium": [0, 10, 140, 205, 247, 289], "4810": [0, 10, 140, 205, 247, 289], "jonesia": [0, 10, 140, 205, 247, 289], "20603": [0, 10, 140, 205, 247, 289], "mucilaginosa": [0, 10, 140, 205, 247, 289], "dy": [0, 10, 140, 205, 247, 289], "metallosphaera": [0, 10, 140, 205, 247, 289], "sedula": [0, 10, 140, 205, 247, 289], "5348": [0, 10, 140, 205, 247, 289], "wedmorensi": [0, 10, 140, 205, 247, 289], "amycolatum": [0, 10, 140, 205, 247, 289], "sk46": [0, 10, 140, 205, 247, 289], "hoagii": [0, 10, 140, 205, 247, 289], "matruchotii": [0, 10, 140, 205, 247, 289], "14266": [0, 10, 140, 205, 247, 289], "propinquum": [0, 10, 140, 205, 247, 289], "44285": [0, 10, 140, 205, 247, 289], "striatum": [0, 10, 140, 205, 247, 289], "6940": [0, 10, 140, 205, 247, 289], "7109": [0, 10, 140, 205, 247, 289], "tolumona": [0, 10, 140, 205, 247, 289], "auensi": [0, 10, 140, 205, 247, 289], "9187": [0, 10, 140, 205, 247, 289], "johnsonella": [0, 10, 140, 205, 247, 289], "ignava": [0, 10, 140, 205, 247, 289], "51276": [0, 10, 140, 205, 247, 289], "catonella": [0, 10, 140, 205, 247, 289], "morbi": [0, 10, 140, 205, 247, 289], "51271": [0, 10, 140, 205, 247, 289], "8903": [0, 10, 140, 205, 247, 289], "cecorum": [0, 10, 140, 205, 247, 289], "20682": [0, 10, 140, 205, 247, 289], "43198": [0, 10, 140, 205, 247, 289], "51266": [0, 10, 140, 205, 247, 289], "ferrimona": [0, 10, 140, 205, 247, 289], "balearica": [0, 10, 140, 205, 247, 289], "9799": [0, 10, 140, 205, 247, 289], "aureococcu": [0, 10, 140, 205, 247, 289], "anophagefferen": [0, 10, 140, 205, 247, 289], "megasporu": [0, 10, 140, 205, 247, 289], "trichomonascu": [0, 10, 140, 205, 247, 289], "ciferrii": [0, 10, 140, 205, 247, 289], "duru": [0, 10, 140, 205, 247, 289], "maceran": [0, 10, 140, 205, 247, 289], "oligotrophicum": [0, 10, 140, 205, 247, 289], "s58": [0, 10, 140, 205, 247, 289], "caldanaerobiu": [0, 10, 140, 205, 247, 289], "polysaccharolyticu": [0, 10, 140, 205, 247, 289], "13641": [0, 10, 140, 205, 247, 289], "no12": [0, 10, 140, 205, 247, 289], "recurrenti": [0, 10, 140, 205, 247, 289], "a1": [0, 10, 140, 205, 247, 289], "amylolyticu": [0, 10, 140, 205, 247, 289], "10524": [0, 10, 140, 205, 247, 289], "cryotoleran": [0, 10, 140, 205, 247, 289], "49181": [0, 10, 140, 205, 247, 289], "sulfurospirillum": [0, 10, 140, 205, 247, 289], "barnesii": [0, 10, 140, 205, 247, 289], "se": [0, 10, 140, 205, 247, 289], "geothrix": [0, 10, 140, 205, 247, 289], "14018": [0, 10, 140, 205, 247, 289], "natronobacterium": [0, 10, 140, 205, 247, 289], "gregoryi": [0, 10, 140, 205, 247, 289], "sp2": [0, 10, 140, 205, 247, 289], "fairfieldensi": [0, 10, 140, 205, 247, 289], "49588": [0, 10, 140, 205, 247, 289], "lansingensi": [0, 10, 140, 205, 247, 289], "19556": [0, 10, 140, 205, 247, 289], "49751": [0, 10, 140, 205, 247, 289], "shakespearei": [0, 10, 140, 205, 247, 289], "23087": [0, 10, 140, 205, 247, 289], "sorokiniana": [0, 10, 140, 205, 247, 289], "pyrenophora": [0, 10, 140, 205, 247, 289], "repenti": [0, 10, 140, 205, 247, 289], "1c": [0, 10, 140, 205, 247, 289], "bfp": [0, 10, 140, 205, 247, 289], "cyanidioschyzon": [0, 10, 140, 205, 247, 289], "merola": [0, 10, 140, 205, 247, 289], "capitatum": [0, 10, 140, 205, 247, 289], "granulosa": [0, 10, 140, 205, 247, 289], "51502": [0, 10, 140, 205, 247, 289], "leucothrix": [0, 10, 140, 205, 247, 289], "2157": [0, 10, 140, 169, 205, 247, 289], "cymbalaria": [0, 10, 140, 205, 247, 289], "sinecaudum": [0, 10, 140, 205, 247, 289], "conjunctiva": [0, 10, 140, 205, 247, 289], "hrc": [0, 10, 140, 205, 247, 289], "581": [0, 10, 140, 205, 247, 289], "bovoculi": [0, 10, 140, 205, 247, 289], "m165": [0, 10, 140, 205, 247, 289], "alkalescen": [0, 10, 140, 205, 247, 289], "14918": [0, 10, 140, 205, 247, 289], "borstelensi": [0, 10, 140, 205, 247, 289], "3096": [0, 10, 140, 205, 247, 289], "wickerhamiella": [0, 10, 140, 205, 247, 289], "sorbophila": [0, 10, 140, 205, 247, 289], "babjeviella": [0, 10, 140, 205, 247, 289], "inositovora": [0, 10, 140, 205, 247, 289], "12698": [0, 10, 140, 205, 247, 289], "AS": [0, 10, 140, 205, 247, 289], "3089": [0, 10, 140, 205, 247, 289], "scophthalmi": [0, 10, 140, 205, 247, 289], "19158": [0, 10, 140, 205, 247, 289], "desulfohalobium": [0, 10, 140, 205, 247, 289], "retbaens": [0, 10, 140, 205, 247, 289], "5692": [0, 10, 140, 205, 247, 289], "nadsonia": [0, 10, 140, 205, 247, 289], "fulvescen": [0, 10, 140, 205, 247, 289], "crossotu": [0, 10, 140, 205, 247, 289], "2876": [0, 10, 140, 205, 247, 289], "pasteuri": [0, 10, 140, 205, 247, 289], "sp1": [0, 10, 140, 205, 247, 289], "granulicatella": [0, 10, 140, 205, 247, 289], "adiacen": [0, 10, 140, 205, 247, 289], "49175": [0, 10, 140, 205, 247, 289], "abiotrophia": [0, 10, 140, 205, 247, 289], "defectiva": [0, 10, 140, 205, 247, 289], "49176": [0, 10, 140, 205, 247, 289], "chromogen": [0, 10, 140, 205, 247, 289], "970": [0, 10, 140, 205, 247, 289], "pseudobutyrivibrio": [0, 10, 140, 205, 247, 289], "cf1b": [0, 10, 140, 205, 247, 289], "hellenica": [0, 10, 140, 205, 247, 289], "avellana": [0, 10, 140, 205, 247, 289], "bpic": [0, 10, 140, 205, 247, 289], "631": [0, 10, 140, 205, 247, 289], "hassiacum": [0, 10, 140, 205, 247, 289], "44199": [0, 10, 140, 205, 247, 289], "wiegelii": [0, 10, 140, 205, 247, 289], "rt8": [0, 10, 140, 205, 247, 289], "8902": [0, 10, 140, 205, 247, 289], "chlorophenolicum": [0, 10, 140, 205, 247, 289], "reticulomyxa": [0, 10, 140, 205, 247, 289], "filosa": [0, 10, 140, 205, 247, 289], "orenia": [0, 10, 140, 205, 247, 289], "5156": [0, 10, 140, 205, 247, 289], "merda": [0, 10, 140, 205, 247, 289], "43184": [0, 10, 140, 205, 247, 289], "stercori": [0, 10, 140, 205, 247, 289], "melanesiensi": [0, 10, 140, 205, 247, 289], "bi429": [0, 10, 140, 205, 247, 289], "suhomyc": [0, 10, 140, 205, 247, 289], "tanzawaensi": [0, 10, 140, 205, 247, 289], "melanogenum": [0, 10, 140, 205, 247, 289], "nitroreducen": [0, 10, 140, 205, 247, 289], "hbp1": [0, 10, 140, 205, 247, 289], "cenarchaeum": [0, 10, 140, 205, 247, 289], "symbiosum": [0, 10, 140, 205, 247, 289], "dethiosulfovibrio": [0, 10, 140, 205, 247, 289], "peptidovoran": [0, 10, 140, 205, 247, 289], "11002": [0, 10, 140, 205, 247, 289], "bastinii": [0, 10, 140, 205, 247, 289], "16055": [0, 10, 140, 205, 247, 289], "timona": [0, 10, 140, 205, 247, 289], "45783": [0, 10, 140, 205, 247, 289], "armillaria": [0, 10, 140, 205, 247, 289], "gallica": [0, 10, 140, 205, 247, 289], "ostoya": [0, 10, 140, 205, 247, 289], "miyamotoi": [0, 10, 140, 205, 247, 289], "lb": [0, 10, 140, 205, 247, 289], "peacockii": [0, 10, 140, 205, 247, 289], "rustic": [0, 10, 140, 205, 247, 289], "lautropia": [0, 10, 140, 205, 247, 289], "51599": [0, 10, 140, 205, 247, 289], "cacca": [0, 10, 140, 205, 247, 289], "43185": [0, 10, 140, 205, 247, 289], "alligatori": [0, 10, 140, 205, 247, 289], "a21jp2": [0, 10, 140, 205, 247, 289], "rhamnosu": [0, 10, 140, 205, 247, 289], "gg": [0, 10, 140, 205, 247, 289], "olivaceu": [0, 10, 140, 205, 247, 289], "bibersteinia": [0, 10, 140, 205, 247, 289], "trehalosi": [0, 10, 140, 205, 247, 289], "189": [0, 10, 140, 205, 247, 289], "atkinsonella": [0, 10, 140, 205, 247, 289], "hypoxylon": [0, 10, 140, 205, 247, 289], "40104": [0, 10, 140, 205, 247, 289], "lydicu": [0, 10, 140, 205, 247, 289], "crispatu": [0, 10, 140, 205, 247, 289], "st1": [0, 10, 140, 205, 247, 289], "baconii": [0, 10, 140, 205, 247, 289], "200745": [0, 10, 140, 205, 247, 289], "triplex": [0, 10, 140, 205, 247, 289], "micromonospora": [0, 10, 140, 205, 247, 289], "27029": [0, 10, 140, 205, 247, 289], "amygdali": [0, 10, 140, 205, 247, 289], "301020": [0, 10, 140, 205, 247, 289], "corrugata": [0, 10, 140, 205, 247, 289], "cfbp": [0, 10, 140, 205, 247, 289], "5454": [0, 10, 140, 205, 247, 289], "fulva": [0, 10, 140, 205, 247, 289], "synxantha": [0, 10, 140, 205, 247, 289], "bg33r": [0, 10, 140, 205, 247, 289], "luteola": [0, 10, 140, 205, 247, 289], "xldn4": [0, 10, 140, 205, 247, 289], "fonticola": [0, 10, 140, 205, 247, 289], "au": [0, 10, 140, 205, 247, 289], "ap2c": [0, 10, 140, 205, 247, 289], "cyclitrophicu": [0, 10, 140, 205, 247, 289], "ff75": [0, 10, 140, 205, 247, 289], "hyphomicrobium": [0, 10, 140, 205, 247, 289], "zavarzinii": [0, 10, 140, 205, 247, 289], "27496": [0, 10, 140, 205, 247, 289], "pittii": [0, 10, 140, 205, 247, 289], "phea": [0, 10, 140, 205, 247, 289], "fragaria": [0, 10, 140, 205, 247, 289], "25863": [0, 10, 140, 205, 247, 289], "neolecta": [0, 10, 140, 205, 247, 289], "irregulari": [0, 10, 140, 205, 247, 289], "freii": [0, 10, 140, 205, 247, 289], "orchesella": [0, 10, 140, 205, 247, 289], "cincta": [0, 10, 140, 205, 247, 289], "novosphingobium": [0, 10, 140, 205, 247, 289], "aromaticivoran": [0, 10, 140, 205, 247, 289], "12444": [0, 10, 140, 205, 247, 289], "sporisorium": [0, 10, 140, 205, 247, 289], "scitamineum": [0, 10, 140, 205, 247, 289], "arthromitu": [0, 10, 140, 205, 247, 289], "sfb": [0, 10, 140, 205, 247, 289], "mous": [0, 10, 140, 205, 247, 289], "japan": [0, 10, 140, 205, 247, 289], "kineosporia": [0, 10, 140, 205, 247, 289], "3230": [0, 10, 140, 205, 247, 289], "marinobacterium": [0, 10, 140, 205, 247, 289], "stanieri": [0, 10, 140, 205, 247, 289], "s30": [0, 10, 140, 205, 247, 289], "psychroserpen": [0, 10, 140, 205, 247, 289], "burtonensi": [0, 10, 140, 205, 247, 289], "12212": [0, 10, 140, 205, 247, 289], "xylanophilu": [0, 10, 140, 205, 247, 289], "9941": [0, 10, 140, 205, 247, 289], "hafniens": [0, 10, 140, 205, 247, 289], "y51": [0, 10, 140, 205, 247, 289], "coffea": [0, 10, 140, 205, 247, 289], "canephora": [0, 10, 140, 205, 247, 289], "attenuata": [0, 10, 140, 205, 247, 289], "holospora": [0, 10, 140, 205, 247, 289], "obtusa": [0, 10, 140, 205, 247, 289], "crocodyli": [0, 10, 140, 205, 247, 289], "mp145": [0, 10, 140, 205, 247, 289], "sulla": [0, 10, 140, 205, 247, 289], "wsm1592": [0, 10, 140, 205, 247, 289], "volcanium": [0, 10, 140, 205, 247, 289], "gss1": [0, 10, 140, 205, 247, 289], "charadriu": [0, 10, 140, 205, 247, 289], "vociferu": [0, 10, 140, 205, 247, 289], "pinctada": [0, 10, 140, 205, 247, 289], "fucata": [0, 10, 140, 205, 247, 289], "arabi": [0, 10, 140, 205, 247, 289], "alpina": [0, 10, 140, 205, 247, 289], "trogontum": [0, 10, 140, 205, 247, 289], "minor": [0, 1, 5, 10, 140, 205, 247, 289], "nm305": [0, 10, 140, 205, 247, 289], "saphenum": [0, 10, 140, 205, 247, 289], "49989": [0, 10, 140, 205, 247, 289], "maltophilum": [0, 10, 140, 205, 247, 289], "51939": [0, 10, 140, 205, 247, 289], "ureibacillu": [0, 10, 140, 205, 247, 289], "thermosphaericu": [0, 10, 140, 205, 247, 289], "thermo": [0, 10, 140, 205, 247, 289], "bf": [0, 10, 140, 205, 247, 289], "syntrophobotulu": [0, 10, 140, 205, 247, 289], "glycolicu": [0, 10, 140, 205, 247, 289], "8271": [0, 10, 140, 205, 247, 289], "wigglesworthia": [0, 10, 140, 205, 247, 289], "glossinidia": [0, 10, 140, 205, 247, 289], "endosymbiont": [0, 10, 140, 205, 247, 289], "yale": [0, 10, 140, 205, 247, 289], "coloni": [0, 10, 140, 205, 247, 289], "kluyvera": [0, 10, 140, 205, 247, 289], "ascorbata": [0, 10, 140, 205, 247, 289], "33433": [0, 10, 140, 205, 247, 289], "brunetti": [0, 10, 140, 205, 247, 289], "praecox": [0, 10, 140, 205, 247, 289], "auri": [0, 10, 140, 205, 247, 289], "15026": [0, 10, 140, 205, 247, 289], "yeatsii": [0, 10, 140, 205, 247, 289], "13926": [0, 10, 140, 205, 247, 289], "reesei": [0, 10, 140, 205, 247, 289], "spraguea": [0, 10, 140, 205, 247, 289], "lophii": [0, 10, 140, 205, 247, 289], "42_110": [0, 10, 140, 205, 247, 289], "hispanica": [0, 10, 140, 205, 247, 289], "33960": [0, 10, 140, 205, 247, 289], "dobzhanskii": [0, 10, 140, 205, 247, 289], "2104": [0, 10, 140, 205, 247, 289], "nakaseomyc": [0, 10, 140, 205, 247, 289], "delphensi": [0, 10, 140, 205, 247, 289], "bacillisporu": [0, 10, 140, 205, 247, 289], "tetragenococcu": [0, 10, 140, 205, 247, 289], "12172": [0, 10, 140, 205, 247, 289], "tortispora": [0, 10, 140, 205, 247, 289], "caseinolytica": [0, 10, 140, 205, 247, 289], "silvanu": [0, 10, 140, 205, 247, 289], "9946": [0, 10, 140, 205, 247, 289], "calidithermu": [0, 10, 140, 205, 247, 289], "chliarophilu": [0, 10, 140, 205, 247, 289], "9957": [0, 10, 140, 205, 247, 289], "venetianu": [0, 10, 140, 205, 247, 289], "rag": [0, 10, 140, 205, 247, 289], "110063": [0, 10, 140, 205, 247, 289], "mitsuokella": [0, 10, 140, 205, 247, 289], "multacida": [0, 10, 140, 205, 247, 289], "20544": [0, 10, 140, 205, 247, 289], "dentali": [0, 10, 140, 205, 247, 289], "3688": [0, 10, 140, 205, 247, 289], "10532": [0, 10, 140, 205, 247, 289], "2011": [0, 9, 10, 140, 205, 247, 289, 323, 324, 325], "sarcopt": [0, 10, 140, 205, 247, 289], "inui": [0, 10, 140, 205, 247, 289], "san": [0, 10, 140, 205, 247, 289], "antonio": [0, 10, 140, 205, 247, 289], "pilosicoli": [0, 10, 140, 205, 247, 289], "95": [0, 10, 140, 165, 205, 247, 289], "1000": [0, 10, 140, 145, 148, 205, 247, 289], "erysiph": [0, 10, 140, 205, 247, 289], "necat": [0, 10, 140, 205, 247, 289], "sulfitobact": [0, 10, 140, 205, 247, 289], "ee": [0, 10, 140, 205, 247, 289], "sagittula": [0, 10, 140, 205, 247, 289], "leucocephalu": [0, 10, 140, 205, 247, 289], "alsatica": [0, 10, 140, 205, 247, 289], "ib": [0, 10, 140, 205, 247, 289], "382": [0, 10, 140, 205, 247, 289], "kristjanssonii": [0, 10, 140, 205, 247, 289], "i77r1b": [0, 10, 140, 205, 247, 289], "lactoaceticu": [0, 10, 140, 205, 247, 289], "6a": [0, 10, 140, 205, 247, 289], "georgia": [0, 10, 140, 205, 247, 289], "6843": [0, 10, 140, 205, 247, 289], "desulfonatronovibrio": [0, 10, 140, 205, 247, 289], "hydrogenovoran": [0, 10, 140, 205, 247, 289], "9292": [0, 10, 140, 205, 247, 289], "desulfospira": [0, 10, 140, 205, 247, 289], "joergensenii": [0, 10, 140, 205, 247, 289], "10085": [0, 10, 140, 205, 247, 289], "duran": [0, 10, 140, 205, 247, 289], "6056": [0, 10, 140, 205, 247, 289], "mundtii": [0, 10, 140, 205, 247, 289], "qu": [0, 10, 140, 205, 247, 289], "intrasporangium": [0, 10, 140, 205, 247, 289], "calvum": [0, 10, 140, 205, 247, 289], "43043": [0, 10, 140, 205, 247, 289], "mcbrellneri": [0, 10, 140, 205, 247, 289], "49030": [0, 10, 140, 205, 247, 289], "hamadaea": [0, 10, 140, 205, 247, 289], "tsunoensi": [0, 10, 140, 205, 247, 289], "44101": [0, 10, 140, 205, 247, 289], "1nes1": [0, 10, 140, 205, 247, 289], "coronafacien": [0, 10, 140, 205, 247, 289], "1_6": [0, 10, 140, 205, 247, 289], "resinovoran": [0, 10, 140, 205, 247, 289], "106553": [0, 10, 140, 205, 247, 289], "axonopodi": [0, 10, 140, 205, 247, 289], "vasculorum": [0, 10, 140, 205, 247, 289], "lecithinolyticum": [0, 10, 140, 205, 247, 289], "700332": [0, 10, 140, 205, 247, 289], "socranskii": [0, 10, 140, 205, 247, 289], "dr56br1116": [0, 10, 140, 205, 247, 289], "35536": [0, 10, 140, 205, 247, 289], "thermobrachium": [0, 10, 140, 205, 247, 289], "celer": [0, 10, 140, 205, 247, 289], "8682": [0, 10, 140, 205, 247, 289], "hveragerdens": [0, 10, 140, 205, 247, 289], "12571": [0, 10, 140, 205, 247, 289], "hirsuta": [0, 10, 140, 205, 247, 289], "44140": [0, 10, 140, 205, 247, 289], "16056": [0, 10, 140, 205, 247, 289], "paraluiscuniculi": [0, 10, 140, 205, 247, 289], "2165": [0, 10, 140, 205, 247, 289], "hydrogenotrophica": [0, 10, 140, 205, 247, 289], "10507": [0, 10, 140, 205, 247, 289], "nakamurella": [0, 10, 140, 205, 247, 289], "multipartita": [0, 10, 140, 205, 247, 289], "44233": [0, 10, 140, 205, 247, 289], "mageritens": [0, 10, 140, 205, 247, 289], "44476": [0, 10, 140, 205, 247, 289], "104973": [0, 10, 140, 205, 247, 289], "tere": [0, 10, 140, 205, 247, 289], "sulfobacillu": [0, 10, 140, 205, 247, 289], "tpy": [0, 10, 140, 205, 247, 289], "acidimicrobium": [0, 10, 140, 205, 247, 289], "10331": [0, 10, 140, 205, 247, 289], "valbyensi": [0, 10, 140, 205, 247, 289], "1626": [0, 10, 140, 205, 247, 289], "octadecabact": [0, 10, 140, 205, 247, 289], "arcticu": [0, 10, 140, 205, 247, 289], "238": [0, 10, 140, 205, 247, 289], "horikoshii": [0, 10, 140, 205, 247, 289], "ot3": [0, 10, 140, 205, 247, 289], "harei": [0, 10, 140, 205, 247, 289], "146": [0, 10, 140, 205, 247, 289], "sch2b": [0, 10, 140, 205, 247, 289], "44247": [0, 10, 140, 205, 247, 289], "16224": [0, 10, 140, 205, 247, 289], "zilligii": [0, 10, 140, 205, 247, 289], "an1": [0, 10, 140, 205, 247, 289], "methanolacinia": [0, 10, 140, 205, 247, 289], "petrolearia": [0, 10, 140, 205, 247, 289], "11571": [0, 10, 140, 205, 247, 289], "ascoidea": [0, 10, 140, 205, 247, 289], "rubescen": [0, 10, 140, 205, 247, 289], "1968": [0, 10, 140, 205, 247, 289], "hyperthermu": [0, 10, 140, 205, 247, 289], "butylicu": [0, 10, 140, 205, 247, 289], "5456": [0, 10, 140, 205, 247, 289], "pyrolobu": [0, 10, 140, 205, 247, 289], "fumarii": [0, 10, 140, 205, 247, 289], "1a": [0, 10, 140, 205, 247, 289], "thermosphaera": [0, 10, 140, 205, 247, 289], "aggregan": [0, 10, 140, 205, 247, 289], "11486": [0, 10, 140, 205, 247, 289], "ferroglobu": [0, 10, 140, 205, 247, 289], "placidu": [0, 10, 140, 205, 247, 289], "10642": [0, 10, 140, 205, 247, 289], "raoultella": [0, 10, 140, 205, 247, 289], "ornithinolytica": [0, 10, 140, 205, 247, 289], "chroococcidiopsi": [0, 10, 140, 205, 247, 289], "thermali": [0, 10, 140, 205, 247, 289], "7203": [0, 10, 140, 205, 247, 289], "pleurocapsa": [0, 10, 140, 205, 247, 289], "7327": [0, 10, 140, 205, 247, 289], "spirulina": [0, 10, 140, 205, 247, 289], "subsalsa": [0, 10, 140, 205, 247, 289], "9445": [0, 10, 140, 205, 247, 289], "mesitorni": [0, 10, 140, 205, 247, 289], "unicolor": [0, 10, 140, 205, 247, 289], "cariama": [0, 10, 140, 205, 247, 289], "cristata": [0, 10, 140, 205, 247, 289], "eurypyga": [0, 10, 140, 205, 247, 289], "helia": [0, 10, 140, 205, 247, 289], "venezuela": [0, 10, 140, 205, 247, 289], "10712": [0, 10, 140, 205, 247, 289], "bongori": [0, 10, 140, 205, 247, 289], "n268": [0, 10, 140, 205, 247, 289], "08": [0, 6, 10, 140, 205, 247, 289, 324, 325], "thoraltensi": [0, 10, 140, 205, 247, 289], "12221": [0, 10, 140, 205, 247, 289], "mrp": [0, 10, 140, 205, 247, 289], "branchiophilum": [0, 10, 140, 205, 247, 289], "elymi": [0, 10, 140, 205, 247, 289], "e56": [0, 10, 140, 205, 247, 289], "owensensi": [0, 10, 140, 205, 247, 289], "ol": [0, 10, 140, 205, 247, 289], "smaragdina": [0, 10, 140, 205, 247, 289], "11293": [0, 10, 140, 205, 247, 289], "betavasculorum": [0, 10, 140, 205, 247, 289], "ruegeria": [0, 10, 140, 205, 247, 289], "lacuscaerulensi": [0, 10, 140, 205, 247, 289], "iti": [0, 10, 140, 205, 247, 289], "1157": [0, 10, 140, 205, 247, 289], "thermonema": [0, 10, 140, 205, 247, 289], "rossianum": [0, 10, 140, 205, 247, 289], "10300": [0, 10, 140, 205, 247, 289], "agaricidamnosum": [0, 10, 140, 205, 247, 289], "102515": [0, 10, 140, 205, 247, 289], "9628": [0, 10, 140, 205, 247, 289], "pistacia": [0, 10, 140, 205, 247, 289], "vera": [0, 10, 140, 205, 247, 289], "magnetospirillum": [0, 10, 140, 205, 247, 289], "gryphiswaldens": [0, 10, 140, 205, 247, 289], "msr": [0, 10, 140, 205, 247, 289], "v2": [0, 10, 140, 205, 247, 289], "guillardia": [0, 10, 140, 205, 247, 289], "theta": [0, 10, 140, 205, 247, 289], "graevenitzii": [0, 10, 140, 205, 247, 289], "c83": [0, 10, 140, 205, 247, 289], "dehalobact": [0, 10, 140, 205, 247, 289], "restrictu": [0, 10, 140, 205, 247, 289], "9455": [0, 10, 140, 205, 247, 289], "anguillarum": [0, 10, 140, 205, 247, 289], "cuculu": [0, 10, 140, 205, 247, 289], "canoru": [0, 10, 140, 205, 247, 289], "barophilu": [0, 10, 140, 205, 247, 289], "mp": [0, 10, 140, 205, 247, 289], "toyocaensi": [0, 10, 140, 205, 247, 289], "tyto": [0, 10, 140, 205, 247, 289], "osmophila": [0, 10, 140, 205, 247, 289], "clarridgeia": [0, 10, 140, 205, 247, 289], "arboricola": [0, 10, 140, 205, 247, 289], "celebensi": [0, 10, 140, 205, 247, 289], "cassava": [0, 10, 140, 205, 247, 289], "4642": [0, 10, 140, 205, 247, 289], "hortorum": [0, 10, 140, 205, 247, 289], "m081": [0, 10, 140, 205, 247, 289], "musacearum": [0, 10, 140, 205, 247, 289], "ncppb": [0, 10, 140, 205, 247, 289], "4379": [0, 10, 140, 205, 247, 289], "vesicatoria": [0, 10, 140, 205, 247, 289], "35937": [0, 10, 140, 205, 247, 289], "protomyc": [0, 10, 140, 205, 247, 289], "lactucaedebili": [0, 10, 140, 205, 247, 289], "aeropyrum": [0, 10, 140, 205, 247, 289], "pernix": [0, 10, 140, 205, 247, 289], "k1": [0, 10, 140, 205, 247, 289], "gallicum": [0, 10, 140, 205, 247, 289], "r602sp": [0, 10, 140, 205, 247, 289], "giardinii": [0, 10, 140, 205, 247, 289], "h152": [0, 10, 140, 205, 247, 289], "infirmum": [0, 10, 140, 205, 247, 289], "f0142": [0, 10, 140, 205, 247, 289], "glaciecola": [0, 10, 140, 205, 247, 289], "punicea": [0, 10, 140, 205, 247, 289], "611": [0, 10, 140, 205, 247, 289], "frigidimarina": [0, 10, 140, 205, 247, 289], "400": [0, 10, 140, 205, 247, 289], "bizzozeronii": [0, 10, 140, 205, 247, 289], "ciii": [0, 10, 140, 205, 247, 289], "broomea": [0, 10, 140, 205, 247, 289], "49717": [0, 10, 140, 205, 247, 289], "oshimai": [0, 10, 140, 205, 247, 289], "jl": [0, 10, 140, 205, 247, 289], "torqui": [0, 10, 140, 205, 247, 289], "700755": [0, 10, 140, 205, 247, 289], "zeae": [0, 10, 140, 205, 247, 289], "20178": [0, 10, 140, 205, 247, 289], "3804": [0, 10, 140, 205, 247, 289], "acanthisitta": [0, 10, 140, 205, 247, 289], "chlori": [0, 10, 140, 205, 247, 289], "apaloderma": [0, 10, 140, 205, 247, 289], "vittatum": [0, 10, 140, 205, 247, 289], "coliu": [0, 10, 140, 205, 247, 289], "striatu": [0, 10, 140, 205, 247, 289], "merop": [0, 10, 140, 205, 247, 289], "nubicu": [0, 10, 140, 205, 247, 289], "trifolium": [0, 10, 140, 205, 247, 289], "pratens": [0, 10, 140, 205, 247, 289], "arcachonens": [0, 10, 140, 205, 247, 289], "9755": [0, 10, 140, 205, 247, 289], "mongolens": [0, 10, 140, 205, 247, 289], "1844": [0, 10, 140, 205, 247, 289], "halomicrobium": [0, 10, 140, 205, 247, 289], "mukohataei": [0, 10, 140, 205, 247, 289], "12286": [0, 10, 140, 205, 247, 289], "asini": [0, 10, 140, 205, 247, 289], "700915": [0, 10, 140, 205, 247, 289], "vesca": [0, 10, 140, 205, 247, 289], "thailandensi": [0, 10, 140, 205, 247, 289], "msmb43": [0, 10, 140, 205, 247, 289], "daktulosphaira": [0, 10, 140, 205, 247, 289], "vitifolia": [0, 10, 140, 205, 247, 289], "spirillospora": [0, 10, 140, 205, 247, 289], "kuznetsovii": [0, 10, 140, 205, 247, 289], "6115": [0, 10, 140, 205, 247, 289], "desulfofarcimen": [0, 10, 140, 205, 247, 289], "acetoxidan": [0, 10, 140, 205, 247, 289], "771": [0, 10, 140, 205, 247, 289], "alaskensi": [0, 10, 140, 205, 247, 289], "g20": [0, 10, 140, 205, 247, 289], "medium": [0, 10, 140, 205, 247, 289], "700293": [0, 10, 140, 205, 247, 289], "veneficu": [0, 10, 140, 205, 247, 289], "snp6": [0, 10, 140, 205, 247, 289], "rhizopu": [0, 10, 140, 205, 247, 289], "microsporu": [0, 10, 140, 205, 247, 289], "celluloflavu": [0, 10, 140, 205, 247, 289], "azatica": [0, 10, 140, 205, 247, 289], "9699": [0, 10, 140, 205, 247, 289], "mediocidica": [0, 10, 140, 205, 247, 289], "9733": [0, 10, 140, 205, 247, 289], "fabryi": [0, 10, 140, 205, 247, 289], "50506": [0, 10, 140, 205, 247, 289], "citrinovirid": [0, 10, 140, 205, 247, 289], "tilletiopsi": [0, 10, 140, 205, 247, 289], "washingtonensi": [0, 10, 140, 205, 247, 289], "rickettsiella": [0, 10, 140, 205, 247, 289], "grylli": [0, 10, 140, 205, 247, 289], "macedonicu": [0, 10, 140, 205, 247, 289], "aca": [0, 10, 140, 205, 247, 289], "dc": [0, 10, 140, 205, 247, 289], "198": [0, 10, 140, 165, 205, 247, 289], "actinotignum": [0, 10, 140, 205, 247, 289], "schaalii": [0, 10, 140, 205, 247, 289], "fb123": [0, 10, 140, 205, 247, 289], "cna": [0, 10, 140, 205, 247, 289], "pantholop": [0, 10, 140, 205, 247, 289], "hodgsonii": [0, 10, 140, 205, 247, 289], "corynespora": [0, 10, 140, 205, 247, 289], "cassiicola": [0, 10, 140, 205, 247, 289], "philippin": [0, 10, 140, 205, 247, 289], "algicola": [0, 10, 140, 205, 247, 289], "14237": [0, 10, 140, 205, 247, 289], "reducen": [0, 10, 140, 205, 247, 289], "mi": [0, 9, 10, 140, 205, 247, 289], "rodentium": [0, 10, 140, 205, 247, 289], "700285": [0, 10, 140, 205, 247, 289], "lyrata": [0, 10, 140, 205, 247, 289], "australiens": [0, 10, 140, 205, 247, 289], "alcanivorax": [0, 10, 140, 205, 247, 289], "borkumensi": [0, 10, 140, 205, 247, 289], "sk2": [0, 10, 140, 205, 247, 289], "angomona": [0, 10, 140, 205, 247, 289], "deanei": [0, 10, 140, 205, 247, 289], "echinoid": [0, 10, 140, 205, 247, 289], "14820": [0, 10, 140, 205, 247, 289], "5050": [0, 10, 140, 205, 247, 289], "15375": [0, 10, 140, 205, 247, 289], "curdlanolyticu": [0, 10, 140, 205, 247, 289], "yk9": [0, 10, 140, 205, 247, 289], "peoria": [0, 10, 140, 205, 247, 289], "3763": [0, 10, 140, 205, 247, 289], "cyanobium": [0, 10, 140, 205, 247, 289], "gracil": [0, 10, 140, 205, 247, 289], "6307": [0, 10, 140, 205, 247, 289], "7805": [0, 10, 140, 205, 247, 289], "pallen": [0, 10, 140, 205, 247, 289], "700821": [0, 10, 140, 205, 247, 289], "polonicum": [0, 10, 140, 205, 247, 289], "solitum": [0, 10, 140, 205, 247, 289], "nalgiovens": [0, 10, 140, 205, 247, 289], "violacea": [0, 10, 140, 205, 247, 289], "dss12": [0, 10, 140, 205, 247, 289], "amazonensi": [0, 10, 140, 205, 247, 289], "sb2b": [0, 10, 140, 205, 247, 289], "mr": [0, 9, 10, 140, 205, 247, 289], "paraplantarum": [0, 10, 140, 205, 247, 289], "vietnamiensi": [0, 10, 140, 205, 247, 289], "g4": [0, 10, 140, 205, 247, 289], "halogeometricum": [0, 10, 140, 205, 247, 289], "borinquens": [0, 10, 140, 205, 247, 289], "11551": [0, 10, 140, 205, 247, 289], "phaeobact": [0, 10, 140, 205, 247, 289], "gallaeciensi": [0, 10, 140, 205, 247, 289], "26640": [0, 10, 140, 205, 247, 289], "desulfobacca": [0, 10, 140, 205, 247, 289], "11109": [0, 10, 140, 205, 247, 289], "spinosa": [0, 10, 140, 205, 247, 289], "18395": [0, 10, 140, 205, 247, 289], "sanguibact": [0, 10, 140, 205, 247, 289], "keddieii": [0, 10, 140, 205, 247, 289], "10542": [0, 10, 140, 205, 247, 289], "woodyi": [0, 10, 140, 205, 247, 289], "51908": [0, 10, 140, 205, 247, 289], "holdemania": [0, 10, 140, 205, 247, 289], "filiformi": [0, 10, 140, 205, 247, 289], "12042": [0, 10, 140, 205, 247, 289], "monilinia": [0, 10, 140, 205, 247, 289], "laxa": [0, 10, 140, 205, 247, 289], "picea": [0, 10, 140, 205, 247, 289], "dehalococcoid": [0, 10, 140, 205, 247, 289], "mccartyi": [0, 10, 140, 205, 247, 289], "195": [0, 10, 140, 169, 205, 247, 289], "coniosporium": [0, 10, 140, 205, 247, 289], "apollini": [0, 10, 140, 205, 247, 289], "f0235": [0, 10, 140, 205, 247, 289], "mucilaginosu": [0, 10, 140, 205, 247, 289], "knp414": [0, 10, 140, 205, 247, 289], "asburia": [0, 10, 140, 205, 247, 289], "lf7a": [0, 10, 140, 205, 247, 289], "lelliottia": [0, 10, 140, 205, 247, 289], "amnigena": [0, 10, 140, 205, 247, 289], "ch": [0, 10, 140, 205, 247, 289], "pluralibact": [0, 10, 140, 205, 247, 289], "gergovia": [0, 10, 140, 205, 247, 289], "natronorubrum": [0, 10, 140, 205, 247, 289], "bangens": [0, 10, 140, 205, 247, 289], "10635": [0, 10, 140, 205, 247, 289], "valaisiana": [0, 10, 140, 205, 247, 289], "tom4006": [0, 10, 140, 205, 247, 289], "multivorum": [0, 10, 140, 205, 247, 289], "aiu301": [0, 10, 140, 205, 247, 289], "haloterrigena": [0, 10, 140, 205, 247, 289], "turkmenica": [0, 10, 140, 205, 247, 289], "5511": [0, 10, 140, 205, 247, 289], "os117": [0, 10, 140, 205, 247, 289], "funestu": [0, 10, 140, 205, 247, 289], "saccharum": [0, 10, 140, 205, 247, 289], "spontaneum": [0, 10, 140, 205, 247, 289], "tibetens": [0, 10, 140, 205, 247, 289], "ga33": [0, 10, 140, 205, 247, 289], "viscosa": [0, 10, 140, 205, 247, 289], "tufc12733": [0, 10, 140, 205, 247, 289], "zobellia": [0, 10, 140, 205, 247, 289], "galactanivoran": [0, 10, 140, 205, 247, 289], "vf5": [0, 10, 140, 205, 247, 289], "melanopsichium": [0, 10, 140, 205, 247, 289], "pennsylvanicum": [0, 10, 140, 205, 247, 289], "benhamia": [0, 10, 140, 205, 247, 289], "nannizzia": [0, 10, 140, 205, 247, 289], "gypsea": [0, 10, 140, 205, 247, 289], "118893": [0, 10, 140, 205, 247, 289], "microsporum": [0, 10, 140, 205, 247, 289], "113480": [0, 10, 140, 205, 247, 289], "verrucosum": [0, 10, 140, 205, 247, 289], "equinum": [0, 10, 140, 205, 247, 289], "oxyclina": [0, 10, 140, 205, 247, 289], "11498": [0, 10, 140, 205, 247, 289], "atrovirid": [0, 10, 140, 205, 247, 289], "sodali": [0, 10, 140, 205, 247, 289], "glossinidiu": [0, 10, 140, 205, 247, 289], "kuenenii": [0, 10, 140, 205, 247, 289], "12350": [0, 10, 140, 205, 247, 289], "sideroxydan": [0, 10, 140, 205, 247, 289], "lithotrophicu": [0, 10, 140, 205, 247, 289], "demetria": [0, 10, 140, 205, 247, 289], "terragena": [0, 10, 140, 205, 247, 289], "11295": [0, 10, 140, 205, 247, 289], "nevskia": [0, 10, 140, 205, 247, 289], "ramosa": [0, 10, 140, 205, 247, 289], "11499": [0, 10, 140, 205, 247, 289], "pseudomycoid": [0, 10, 140, 205, 247, 289], "12442": [0, 10, 140, 205, 247, 289], "desulfurobacterium": [0, 10, 140, 205, 247, 289], "thermolithotrophum": [0, 10, 140, 205, 247, 289], "11699": [0, 10, 140, 205, 247, 289], "coleofasciculu": [0, 10, 140, 205, 247, 289], "chthonoplast": [0, 10, 140, 205, 247, 289], "7420": [0, 10, 140, 205, 247, 289], "carnimona": [0, 10, 140, 205, 247, 289], "dothistroma": [0, 10, 140, 205, 247, 289], "septosporum": [0, 10, 140, 205, 247, 289], "cc9311": [0, 10, 140, 205, 247, 289], "mortierella": [0, 10, 140, 205, 247, 289], "32222": [0, 10, 140, 205, 247, 289], "lobosporangium": [0, 10, 140, 205, 247, 289], "transversal": [0, 10, 140, 205, 247, 289], "asiatica": [0, 10, 140, 205, 247, 289], "12278": [0, 10, 140, 205, 247, 289], "muriaticu": [0, 10, 140, 205, 247, 289], "15685": [0, 10, 140, 205, 247, 289], "bissettii": [0, 10, 140, 205, 247, 289], "dn127": [0, 10, 140, 205, 247, 289], "terasakiella": [0, 10, 140, 205, 247, 289], "6293": [0, 10, 140, 205, 247, 289], "marinospirillum": [0, 10, 140, 205, 247, 289], "minutulum": [0, 10, 140, 205, 247, 289], "6287": [0, 10, 140, 205, 247, 289], "jadensi": [0, 10, 140, 205, 247, 289], "t9": [0, 10, 140, 205, 247, 289], "ad22": [0, 10, 140, 205, 247, 289], "pythium": [0, 10, 140, 205, 247, 289], "aphanidermatum": [0, 10, 140, 205, 247, 289], "daom": [0, 10, 140, 205, 247, 289], "br444": [0, 10, 140, 205, 247, 289], "halothec": [0, 10, 140, 205, 247, 289], "7418": [0, 10, 140, 205, 247, 289], "wenyonii": [0, 10, 140, 205, 247, 289], "massachusett": [0, 10, 140, 205, 247, 289], "barthii": [0, 10, 140, 205, 247, 289], "actinoalloteichu": [0, 10, 140, 205, 247, 289], "cyanogriseu": [0, 10, 140, 205, 247, 289], "cerbereu": [0, 10, 140, 205, 247, 289], "11376": [0, 10, 140, 205, 247, 289], "deleyianum": [0, 10, 140, 205, 247, 289], "6946": [0, 10, 140, 205, 247, 289], "desulfocapsa": [0, 10, 140, 205, 247, 289], "sulfexigen": [0, 10, 140, 205, 247, 289], "10523": [0, 10, 140, 205, 247, 289], "serendipita": [0, 10, 140, 205, 247, 289], "tracheiphila": [0, 10, 140, 205, 247, 289], "knackmussii": [0, 10, 140, 205, 247, 289], "b13": [0, 10, 140, 205, 247, 289], "wolbachia": [0, 10, 140, 205, 247, 289], "wri": [0, 10, 140, 205, 247, 289], "lachnoclostridium": [0, 10, 140, 205, 247, 289], "phytofermentan": [0, 10, 140, 205, 247, 289], "isdg": [0, 10, 140, 205, 247, 289], "gleimia": [0, 10, 140, 205, 247, 289], "col10b": [0, 10, 140, 205, 247, 289], "af2": [0, 10, 140, 205, 247, 289], "stewartii": [0, 10, 140, 205, 247, 289], "violen": [0, 10, 140, 205, 247, 289], "papilio": [0, 10, 140, 205, 247, 289], "xuthu": [0, 10, 140, 205, 247, 289], "roseoverticillatu": [0, 10, 140, 205, 247, 289], "12446": [0, 10, 140, 205, 247, 289], "afghaniensi": [0, 10, 140, 205, 247, 289], "772": [0, 10, 140, 205, 247, 289], "atroolivaceu": [0, 10, 140, 205, 247, 289], "catenula": [0, 10, 140, 205, 247, 289], "griseoruben": [0, 10, 140, 205, 247, 289], "theileri": [0, 10, 140, 205, 247, 289], "alboflavu": [0, 10, 140, 205, 247, 289], "aureocirculatu": [0, 10, 140, 205, 247, 289], "filamentosu": [0, 10, 140, 205, 247, 289], "15998": [0, 10, 140, 205, 247, 289], "flavidoviren": [0, 10, 140, 205, 247, 289], "40150": [0, 10, 140, 205, 247, 289], "lavenduligriseu": [0, 10, 140, 205, 247, 289], "mutabili": [0, 10, 140, 205, 247, 289], "purpeofusca": [0, 10, 140, 205, 247, 289], "resistomycificu": [0, 10, 140, 205, 247, 289], "varsoviensi": [0, 10, 140, 205, 247, 289], "rheinheimera": [0, 10, 140, 205, 247, 289], "14885": [0, 10, 140, 205, 247, 289], "viridosporu": [0, 10, 140, 205, 247, 289], "14672": [0, 10, 140, 205, 247, 289], "infernu": [0, 10, 140, 205, 247, 289], "me": [0, 2, 10, 140, 205, 247, 289], "ictaluri": [0, 10, 140, 205, 247, 289], "farmeri": [0, 10, 140, 205, 247, 289], "gtc": [0, 10, 140, 205, 247, 289], "1319": [0, 10, 140, 205, 247, 289], "icc168": [0, 10, 140, 205, 247, 289], "sedlakii": [0, 10, 140, 205, 247, 289], "105722": [0, 10, 140, 205, 247, 289], "130z": [0, 10, 140, 205, 247, 289], "aerocolonigen": [0, 10, 140, 205, 247, 289], "cyaneogriseu": [0, 10, 140, 205, 247, 289], "noncyanogenu": [0, 10, 140, 205, 247, 289], "durhamensi": [0, 10, 140, 205, 247, 289], "flavochromogen": [0, 10, 140, 205, 247, 289], "fulvissimu": [0, 10, 140, 205, 247, 289], "40593": [0, 10, 140, 205, 247, 289], "griseoaurantiacu": [0, 10, 140, 205, 247, 289], "m045": [0, 10, 140, 205, 247, 289], "iakyru": [0, 10, 140, 205, 247, 289], "katra": [0, 10, 140, 205, 247, 289], "pyridomyceticu": [0, 10, 140, 205, 247, 289], "violaceusnig": [0, 10, 140, 205, 247, 289], "4113": [0, 10, 140, 205, 247, 289], "albulu": [0, 10, 140, 205, 247, 289], "sphaerobolu": [0, 10, 140, 205, 247, 289], "stellatu": [0, 10, 140, 205, 247, 289], "ss14": [0, 10, 140, 205, 247, 289], "scleroderma": [0, 10, 140, 205, 247, 289], "citrinum": [0, 10, 140, 205, 247, 289], "foug": [0, 10, 140, 205, 247, 289], "rasamsonia": [0, 10, 140, 205, 247, 289], "emersonii": [0, 10, 140, 205, 247, 289], "393": [0, 10, 140, 205, 247, 289], "64": [0, 10, 140, 205, 247, 289], "perori": [0, 10, 140, 205, 247, 289], "700780": [0, 10, 140, 205, 247, 289], "infanti": [0, 10, 140, 205, 247, 289], "sk970": [0, 10, 140, 205, 247, 289], "geothermali": [0, 10, 140, 205, 247, 289], "11300": [0, 10, 140, 205, 247, 289], "farauti": [0, 10, 140, 205, 247, 289], "5701": [0, 10, 140, 205, 247, 289], "cancerogenu": [0, 10, 140, 205, 247, 289], "35316": [0, 10, 140, 205, 247, 289], "paradisiaca": [0, 10, 140, 205, 247, 289], "ech703": [0, 10, 140, 205, 247, 289], "aquamicrobium": [0, 10, 140, 205, 247, 289], "defluvii": [0, 10, 140, 205, 247, 289], "micropl": [0, 10, 140, 205, 247, 289], "demolitor": [0, 10, 140, 205, 247, 289], "vlb120": [0, 10, 140, 205, 247, 289], "chara": [0, 10, 140, 205, 247, 289], "braunii": [0, 10, 140, 205, 247, 289], "caulobact": [0, 10, 140, 205, 247, 289], "henricii": [0, 10, 140, 205, 247, 289], "petrotoga": [0, 10, 140, 205, 247, 289], "sj95": [0, 10, 140, 205, 247, 289], "natrinema": [0, 10, 140, 205, 247, 289], "pellirubrum": [0, 10, 140, 205, 247, 289], "15624": [0, 10, 140, 205, 247, 289], "3751": [0, 10, 140, 205, 247, 289], "vincentii": [0, 10, 140, 205, 247, 289], "35580": [0, 10, 140, 205, 247, 289], "oxalicum": [0, 10, 140, 205, 247, 289], "35185": [0, 10, 140, 205, 247, 289], "soudanens": [0, 10, 140, 205, 247, 289], "452": [0, 10, 140, 205, 247, 289], "61": [0, 10, 140, 205, 247, 289], "macrococcu": [0, 10, 140, 205, 247, 289], "caseolyticu": [0, 10, 140, 205, 247, 289], "jcsc5402": [0, 10, 140, 205, 247, 289], "ostreococcu": [0, 10, 140, 205, 247, 289], "tauri": [0, 10, 140, 205, 247, 289], "edhazardia": [0, 10, 140, 205, 247, 289], "aedi": [0, 10, 140, 205, 247, 289], "usnm": [0, 10, 140, 205, 247, 289], "41457": [0, 10, 140, 205, 247, 289], "neutrophilum": [0, 10, 140, 205, 247, 289], "v24sta": [0, 10, 140, 205, 247, 289], "plecoglossicida": [0, 10, 140, 205, 247, 289], "nb2011": [0, 10, 140, 205, 247, 289], "nodularia": [0, 10, 140, 205, 247, 289], "spumigena": [0, 10, 140, 205, 247, 289], "ccy9414": [0, 10, 140, 205, 247, 289], "pealeana": [0, 10, 140, 205, 247, 289], "700345": [0, 10, 140, 205, 247, 289], "flexithrix": [0, 10, 140, 205, 247, 289], "dorothea": [0, 10, 140, 205, 247, 289], "6795": [0, 10, 140, 205, 247, 289], "lewinella": [0, 10, 140, 205, 247, 289], "cohaeren": [0, 10, 140, 205, 247, 289], "23179": [0, 10, 140, 205, 247, 289], "23188": [0, 10, 140, 205, 247, 289], "paxillu": [0, 10, 140, 205, 247, 289], "involutu": [0, 10, 140, 205, 247, 289], "200175": [0, 10, 140, 205, 247, 289], "vitulinu": [0, 10, 140, 205, 247, 289], "f1028": [0, 10, 140, 205, 247, 289], "halioticoli": [0, 10, 140, 205, 247, 289], "102217": [0, 10, 140, 205, 247, 289], "amorpha": [0, 10, 140, 205, 247, 289], "ccnwgs0123": [0, 10, 140, 205, 247, 289], "malodoratu": [0, 10, 140, 205, 247, 289], "43197": [0, 10, 140, 205, 247, 289], "raffinosu": [0, 10, 140, 205, 247, 289], "49464": [0, 10, 140, 205, 247, 289], "ophioglossoid": [0, 10, 140, 205, 247, 289], "100239": [0, 10, 140, 205, 247, 289], "lonsdalea": [0, 10, 140, 205, 247, 289], "waddlia": [0, 10, 140, 205, 247, 289], "chondrophila": [0, 10, 140, 205, 247, 289], "wsu": [0, 10, 140, 205, 247, 289], "86": [0, 10, 140, 205, 247, 289], "1044": [0, 10, 140, 205, 247, 289], "naematelia": [0, 10, 140, 205, 247, 289], "encephala": [0, 10, 140, 205, 247, 289], "hypholoma": [0, 10, 140, 205, 247, 289], "sublateritium": [0, 10, 140, 205, 247, 289], "334": [0, 10, 140, 205, 247, 289], "kocuria": [0, 10, 140, 205, 247, 289], "rhizophila": [0, 10, 140, 205, 247, 289], "p7": [0, 10, 140, 205, 247, 289], "sphaeroforma": [0, 10, 140, 205, 247, 289], "arctica": [0, 10, 140, 205, 247, 289], "jp610": [0, 10, 140, 205, 247, 289], "thielaviopsi": [0, 10, 140, 205, 247, 289], "punctulata": [0, 10, 140, 205, 247, 289], "lepeophtheiru": [0, 10, 140, 205, 247, 289], "salmoni": [0, 10, 140, 205, 247, 289], "citromicrobium": [0, 10, 140, 205, 247, 289], "bathyomarinum": [0, 10, 140, 205, 247, 289], "jl354": [0, 10, 140, 205, 247, 289], "ophiocordycep": [0, 10, 140, 205, 247, 289], "trachipleistophora": [0, 10, 140, 205, 247, 289], "ro": [0, 10, 140, 205, 247, 289], "3706": [0, 10, 140, 205, 247, 289], "austrosaltan": [0, 10, 140, 205, 247, 289], "lusaltan": [0, 10, 140, 205, 247, 289], "milleri": [0, 10, 140, 205, 247, 289], "nannochloropsi": [0, 10, 140, 205, 247, 289], "gaditana": [0, 10, 140, 205, 247, 289], "ccmp526": [0, 10, 140, 205, 247, 289], "achromobact": [0, 10, 140, 205, 247, 289], "piechaudii": [0, 10, 140, 205, 247, 289], "hle": [0, 10, 140, 205, 247, 289], "reilianum": [0, 10, 140, 205, 247, 289], "boechera": [0, 10, 140, 205, 247, 289], "stricta": [0, 10, 140, 205, 247, 289], "eutrema": [0, 10, 140, 205, 247, 289], "salsugineum": [0, 10, 140, 205, 247, 289], "dechloromona": [0, 10, 140, 205, 247, 289], "agitata": [0, 10, 140, 205, 247, 289], "is5": [0, 10, 140, 205, 247, 289], "seoulensi": [0, 10, 140, 205, 247, 289], "thiocysti": [0, 10, 140, 205, 247, 289], "violascen": [0, 10, 140, 205, 247, 289], "emmonsia": [0, 10, 140, 205, 247, 289], "crescen": [0, 10, 140, 205, 247, 289], "uamh": [0, 10, 140, 205, 247, 289], "3008": [0, 10, 140, 205, 247, 289], "cordycep": [0, 10, 140, 205, 247, 289], "militari": [0, 10, 140, 205, 247, 289], "piromyc": [0, 10, 140, 205, 247, 289], "e2": [0, 10, 140, 205, 247, 289], "vulcaniu": [0, 10, 140, 205, 247, 289], "m7": [0, 10, 140, 205, 247, 289], "thermaerobact": [0, 10, 140, 205, 247, 289], "marianensi": [0, 10, 140, 205, 247, 289], "12885": [0, 10, 140, 205, 247, 289], "profundum": [0, 10, 140, 205, 247, 289], "ss9": [0, 10, 140, 205, 247, 289], "4726": [0, 10, 140, 205, 247, 289], "subvibrioid": [0, 10, 140, 205, 247, 289], "15264": [0, 10, 140, 205, 247, 289], "maricauli": [0, 10, 140, 205, 247, 289], "mcs10": [0, 10, 140, 205, 247, 289], "ps728": [0, 10, 140, 205, 247, 289], "guttiformi": [0, 10, 140, 205, 247, 289], "32187": [0, 10, 140, 205, 247, 289], "thraustotheca": [0, 10, 140, 205, 247, 289], "clavata": [0, 10, 140, 205, 247, 289], "rosa": [0, 10, 140, 205, 247, 289], "stachybotri": [0, 10, 140, 205, 247, 289], "chartarum": [0, 10, 140, 205, 247, 289], "ibt": [0, 10, 140, 205, 247, 289], "7711": [0, 10, 140, 205, 247, 289], "6083": [0, 10, 140, 205, 247, 289], "caribensi": [0, 10, 140, 205, 247, 289], "mba4": [0, 10, 140, 205, 247, 289], "xinjiangensi": [0, 10, 140, 205, 247, 289], "xj": [0, 10, 140, 205, 247, 289], "54": [0, 10, 140, 205, 247, 289], "mandelii": [0, 10, 140, 205, 247, 289], "pd30": [0, 10, 140, 205, 247, 289], "castellaniella": [0, 10, 140, 205, 247, 289], "defragran": [0, 10, 140, 205, 247, 289], "65phen": [0, 10, 140, 205, 247, 289], "thermocrini": [0, 10, 140, 205, 247, 289], "12173": [0, 10, 140, 205, 247, 289], "js617": [0, 10, 140, 205, 247, 289], "mannheimia": [0, 10, 140, 205, 247, 289], "haemolytica": [0, 10, 140, 205, 247, 289], "m42548": [0, 10, 140, 205, 247, 289], "thauera": [0, 10, 140, 205, 247, 289], "linaloolenti": [0, 10, 140, 205, 247, 289], "47lol": [0, 10, 140, 205, 247, 289], "12138": [0, 10, 140, 205, 247, 289], "terpenica": [0, 10, 140, 205, 247, 289], "58eu": [0, 10, 140, 205, 247, 289], "alloprevotella": [0, 10, 140, 205, 247, 289], "tannera": [0, 10, 140, 205, 247, 289], "51259": [0, 10, 140, 205, 247, 289], "enoeca": [0, 10, 140, 205, 247, 289], "12259": [0, 10, 140, 205, 247, 289], "rumoiensi": [0, 10, 140, 205, 247, 289], "45": [0, 10, 140, 205, 247, 289], "381": [0, 10, 140, 205, 247, 289], "mycetocola": [0, 10, 140, 205, 247, 289], "saprophilu": [0, 10, 140, 205, 247, 289], "vitaminophilu": [0, 10, 140, 205, 247, 289], "41686": [0, 10, 140, 205, 247, 289], "arbori": [0, 10, 140, 205, 247, 289], "14919": [0, 10, 140, 205, 247, 289], "monteilii": [0, 10, 140, 205, 247, 289], "sb3078": [0, 10, 140, 205, 247, 289], "malassezia": [0, 10, 140, 205, 247, 289], "globosa": [0, 10, 140, 205, 247, 289], "sympodiali": [0, 10, 140, 205, 247, 289], "42132": [0, 10, 140, 205, 247, 289], "odoratimimu": [0, 10, 140, 205, 247, 289], "h1bi": [0, 10, 140, 205, 247, 289], "solibacillu": [0, 10, 140, 205, 247, 289], "silvestri": [0, 10, 140, 205, 247, 289], "stlb046": [0, 10, 140, 205, 247, 289], "constellatu": [0, 10, 140, 205, 247, 289], "pharyngi": [0, 10, 140, 205, 247, 289], "sk1060": [0, 10, 140, 205, 247, 289], "46377": [0, 10, 140, 205, 247, 289], "hebeloma": [0, 10, 140, 205, 247, 289], "cylindrosporum": [0, 10, 140, 205, 247, 289], "h7": [0, 10, 140, 205, 247, 289], "caldivirga": [0, 10, 140, 205, 247, 289], "maquilingensi": [0, 10, 140, 205, 247, 289], "ic": [0, 10, 140, 205, 247, 289], "167": [0, 10, 140, 169, 205, 247, 289], "asticcacauli": [0, 10, 140, 205, 247, 289], "biprosthecum": [0, 10, 140, 205, 247, 289], "c19": [0, 10, 140, 205, 247, 289], "herbicidovoran": [0, 10, 140, 205, 247, 289], "16415": [0, 10, 140, 205, 247, 289], "pachydermati": [0, 10, 140, 205, 247, 289], "cylindrospermopsi": [0, 10, 140, 205, 247, 289], "raciborskii": [0, 10, 140, 205, 247, 289], "wno": [0, 10, 140, 205, 247, 289], "rosellinia": [0, 10, 140, 205, 247, 289], "necatrix": [0, 10, 140, 205, 247, 289], "boreali": [0, 10, 140, 205, 247, 289], "4128": [0, 10, 140, 205, 247, 289], "dendroctonu": [0, 10, 140, 205, 247, 289], "ponderosa": [0, 10, 140, 205, 247, 289], "gonderi": [0, 10, 140, 205, 247, 289], "leersia": [0, 10, 140, 205, 247, 289], "perrieri": [0, 10, 140, 205, 247, 289], "subtil": [0, 10, 140, 205, 247, 289], "albensi": [0, 10, 140, 205, 247, 289], "11370": [0, 10, 140, 205, 247, 289], "12258": [0, 10, 140, 205, 247, 289], "succinispira": [0, 10, 140, 205, 247, 289], "6222": [0, 10, 140, 205, 247, 289], "oidiodendron": [0, 10, 140, 205, 247, 289], "maiu": [0, 10, 140, 205, 247, 289], "parascardovia": [0, 10, 140, 205, 247, 289], "denticolen": [0, 10, 140, 205, 247, 289], "10105": [0, 10, 140, 205, 247, 289], "12538": [0, 10, 140, 205, 247, 289], "scardovia": [0, 10, 140, 205, 247, 289], "inopinata": [0, 10, 140, 205, 247, 289], "f0304": [0, 10, 140, 205, 247, 289], "mosselii": [0, 10, 140, 205, 247, 289], "sj10": [0, 10, 140, 205, 247, 289], "canettii": [0, 10, 140, 205, 247, 289], "cipt": [0, 10, 140, 205, 247, 289], "140070017": [0, 10, 140, 205, 247, 289], "20093": [0, 10, 140, 205, 247, 289], "11596": [0, 10, 140, 205, 247, 289], "merycicum": [0, 10, 140, 205, 247, 289], "somaliensi": [0, 10, 140, 205, 247, 289], "40738": [0, 10, 140, 205, 247, 289], "odoriferum": [0, 10, 140, 205, 247, 289], "neonectria": [0, 10, 140, 205, 247, 289], "ditissima": [0, 10, 140, 205, 247, 289], "20433": [0, 10, 140, 205, 247, 289], "undicola": [0, 10, 140, 205, 247, 289], "992": [0, 10, 140, 205, 247, 289], "700741": [0, 10, 140, 205, 247, 289], "thermothelomyc": [0, 10, 140, 205, 247, 289], "excentricu": [0, 10, 140, 205, 247, 289], "podila": [0, 10, 140, 205, 247, 289], "verticillata": [0, 10, 140, 205, 247, 289], "meridiei": [0, 10, 140, 205, 247, 289], "13257": [0, 10, 140, 205, 247, 289], "chitinophaga": [0, 10, 140, 205, 247, 289], "pinensi": [0, 10, 140, 205, 247, 289], "2588": [0, 10, 140, 205, 247, 289], "brachyelytri": [0, 10, 140, 205, 247, 289], "cimex": [0, 10, 140, 205, 247, 289], "lectulariu": [0, 10, 140, 205, 247, 289], "clausii": [0, 10, 140, 205, 247, 289], "ksm": [0, 10, 140, 205, 247, 289], "k16": [0, 10, 140, 205, 247, 289], "pseudofirmu": [0, 10, 140, 205, 247, 289], "of4": [0, 10, 140, 205, 247, 289], "pyrifolia": [0, 10, 140, 205, 247, 289], "ep1": [0, 10, 140, 205, 247, 289], "96": [0, 10, 140, 205, 247, 289, 324, 325], "coniophora": [0, 10, 140, 205, 247, 289], "puteana": [0, 10, 140, 205, 247, 289], "piloderma": [0, 10, 140, 205, 247, 289], "croceum": [0, 10, 140, 205, 247, 289], "1598": [0, 10, 140, 205, 247, 289], "thioflavicoccu": [0, 10, 140, 205, 247, 289], "8321": [0, 10, 140, 205, 247, 289], "aphi": [0, 10, 140, 205, 247, 289], "haliangium": [0, 10, 140, 205, 247, 289], "ochraceum": [0, 10, 140, 205, 247, 289], "14365": [0, 10, 140, 205, 247, 289], "wodani": [0, 10, 140, 205, 247, 289], "moritella": [0, 10, 140, 205, 247, 289], "delftia": [0, 10, 140, 205, 247, 289], "acidovoran": [0, 10, 140, 205, 247, 289], "sph": [0, 10, 140, 205, 247, 289], "acidovorax": [0, 10, 140, 205, 247, 289], "19860": [0, 10, 140, 205, 247, 289], "citrulli": [0, 10, 140, 205, 247, 289], "aac00": [0, 10, 140, 205, 247, 289], "cryptosporangium": [0, 10, 140, 205, 247, 289], "arvum": [0, 10, 140, 205, 247, 289], "44712": [0, 10, 140, 205, 247, 289], "hylemonella": [0, 10, 140, 205, 247, 289], "niagara": [0, 10, 140, 205, 247, 289], "simplicispira": [0, 10, 140, 205, 247, 289], "psychrophila": [0, 10, 140, 205, 247, 289], "11588": [0, 10, 140, 205, 247, 289], "higginsianum": [0, 10, 140, 205, 247, 289], "brennaborens": [0, 10, 140, 205, 247, 289], "12168": [0, 10, 140, 205, 247, 289], "mh": [0, 10, 140, 205, 247, 289], "neptunium": [0, 10, 140, 205, 247, 289], "15444": [0, 10, 140, 205, 247, 289], "ocean": [0, 10, 140, 205, 247, 289], "sch89": [0, 10, 140, 205, 247, 289], "wolfiporia": [0, 10, 140, 205, 247, 289], "coco": [0, 10, 140, 205, 247, 289], "md": [0, 10, 140, 205, 247, 289], "ss10": [0, 10, 140, 205, 247, 289], "alcoholivoran": [0, 10, 140, 205, 247, 289], "5433": [0, 10, 140, 205, 247, 289], "caldoxylosilyticu": [0, 10, 140, 205, 247, 289], "cic9": [0, 10, 140, 205, 247, 289], "aminomona": [0, 10, 140, 205, 247, 289], "paucivoran": [0, 10, 140, 205, 247, 289], "12260": [0, 10, 140, 205, 247, 289], "12254": [0, 10, 140, 205, 247, 289], "thermanaerovibrio": [0, 10, 140, 205, 247, 289], "acidaminovoran": [0, 10, 140, 205, 247, 289], "6589": [0, 10, 140, 205, 247, 289], "aminobacterium": [0, 10, 140, 205, 247, 289], "12262": [0, 10, 140, 205, 247, 289], "colombiens": [0, 10, 140, 205, 247, 289], "12261": [0, 10, 140, 205, 247, 289], "frateuria": [0, 10, 140, 205, 247, 289], "aurantia": [0, 10, 140, 205, 247, 289], "6220": [0, 10, 140, 205, 247, 289], "cheerisanensi": [0, 10, 140, 205, 247, 289], "2395": [0, 10, 140, 205, 247, 289], "vagococcu": [0, 10, 140, 205, 247, 289], "lutra": [0, 10, 140, 205, 247, 289], "lbd1": [0, 10, 140, 205, 247, 289], "halleri": [0, 10, 140, 205, 247, 289], "gemmifera": [0, 10, 140, 205, 247, 289], "capsella": [0, 10, 140, 205, 247, 289], "rubella": [0, 10, 140, 205, 247, 289], "picrophilu": [0, 10, 140, 205, 247, 289], "torridu": [0, 10, 140, 205, 247, 289], "vagina": [0, 10, 140, 205, 247, 289], "15829": [0, 10, 140, 205, 247, 289], "centipeda": [0, 10, 140, 205, 247, 289], "periodontii": [0, 10, 140, 205, 247, 289], "2778": [0, 10, 140, 205, 247, 289], "phlebiopsi": [0, 10, 140, 205, 247, 289], "gigantea": [0, 10, 140, 205, 247, 289], "11061_1": [0, 10, 140, 205, 247, 289], "cr5": [0, 10, 140, 205, 247, 289], "facklamia": [0, 10, 140, 205, 247, 289], "languida": [0, 10, 140, 205, 247, 289], "37842": [0, 10, 140, 205, 247, 289], "pantotrophu": [0, 10, 140, 205, 247, 289], "j46": [0, 10, 140, 205, 247, 289], "anaerovibrio": [0, 10, 140, 205, 247, 289], "lipolyticu": [0, 10, 140, 205, 247, 289], "lb2005": [0, 10, 140, 205, 247, 289], "anaeroarcu": [0, 10, 140, 205, 247, 289], "burkinensi": [0, 10, 140, 205, 247, 289], "6283": [0, 10, 140, 205, 247, 289], "trichosporon": [0, 10, 140, 205, 247, 289], "asahii": [0, 10, 140, 205, 247, 289], "pseudanabaena": [0, 10, 140, 205, 247, 289], "7367": [0, 10, 140, 205, 247, 289], "16829": [0, 10, 140, 205, 247, 289], "arrhenoman": [0, 10, 140, 205, 247, 289], "12531": [0, 10, 140, 205, 247, 289], "buttiauxella": [0, 10, 140, 205, 247, 289], "agresti": [0, 10, 140, 205, 247, 289], "33320": [0, 10, 140, 205, 247, 289], "budvicia": [0, 10, 140, 205, 247, 289], "aquatica": [0, 10, 140, 205, 247, 289], "5075": [0, 10, 140, 205, 247, 289], "35567": [0, 10, 140, 205, 247, 289], "leminorella": [0, 10, 140, 205, 247, 289], "grimontii": [0, 10, 140, 205, 247, 289], "33999": [0, 10, 140, 205, 247, 289], "5078": [0, 10, 140, 205, 247, 289], "tatumella": [0, 10, 140, 205, 247, 289], "ptyseo": [0, 10, 140, 205, 247, 289], "33301": [0, 10, 140, 205, 247, 289], "grimesii": [0, 10, 140, 205, 247, 289], "plymuthica": [0, 10, 140, 205, 247, 289], "ferven": [0, 10, 140, 205, 247, 289], "ag86": [0, 10, 140, 205, 247, 289], "mediterraneu": [0, 10, 140, 205, 247, 289], "p6b11": [0, 10, 140, 205, 247, 289], "rhizosphera": [0, 10, 140, 205, 247, 289], "16068": [0, 10, 140, 205, 247, 289], "14675": [0, 10, 140, 205, 247, 289], "linepithema": [0, 10, 140, 205, 247, 289], "humil": [0, 10, 140, 205, 247, 289], "parachlamydia": [0, 10, 140, 205, 247, 289], "uv": [0, 10, 140, 205, 247, 289], "psittaci": [0, 10, 140, 205, 247, 289], "10_1398_11": [0, 10, 140, 205, 247, 289], "s26": [0, 10, 140, 205, 247, 289], "fe": [0, 10, 140, 205, 247, 289], "gpic": [0, 10, 140, 205, 247, 289], "tw": [0, 10, 140, 205, 247, 289], "183": [0, 10, 140, 205, 247, 289], "md56": [0, 10, 140, 205, 247, 289], "muridarum": [0, 10, 140, 205, 247, 289], "nigg": [0, 10, 140, 205, 247, 289], "simkania": [0, 10, 140, 205, 247, 289], "negevensi": [0, 10, 140, 205, 247, 289], "leclercia": [0, 10, 140, 205, 247, 289], "adecarboxylata": [0, 10, 140, 205, 247, 289], "23216": [0, 10, 140, 205, 247, 289], "102595": [0, 10, 140, 205, 247, 289], "11664": [0, 10, 140, 205, 247, 289], "succinimona": [0, 10, 140, 205, 247, 289], "amylolytica": [0, 10, 140, 205, 247, 289], "2873": [0, 10, 140, 205, 247, 289], "succinivibrio": [0, 10, 140, 205, 247, 289], "dextrinosolven": [0, 10, 140, 205, 247, 289], "h5": [0, 10, 140, 205, 247, 289], "conorhini": [0, 10, 140, 205, 247, 289], "methanocorpusculum": [0, 10, 140, 205, 247, 289], "labreanum": [0, 10, 140, 205, 247, 289], "bourgensi": [0, 10, 140, 205, 247, 289], "ms2": [0, 10, 140, 205, 247, 289], "autoethanogenum": [0, 10, 140, 205, 247, 289], "10061": [0, 10, 140, 205, 247, 289], "9693": [0, 10, 140, 205, 247, 289], "alkanivoran": [0, 10, 140, 205, 247, 289], "16433": [0, 10, 140, 205, 247, 289], "slackia": [0, 10, 140, 205, 247, 289], "exigua": [0, 10, 140, 205, 247, 289], "700122": [0, 10, 140, 205, 247, 289], "heliotrinireducen": [0, 10, 140, 205, 247, 289], "20476": [0, 10, 140, 205, 247, 289], "eggerthella": [0, 10, 140, 205, 247, 289], "lenta": [0, 10, 140, 205, 247, 289], "2243": [0, 10, 140, 205, 247, 289], "m325": [0, 10, 140, 205, 247, 289], "bergeri": [0, 10, 140, 205, 247, 289], "700627": [0, 10, 140, 205, 247, 289], "profundu": [0, 10, 140, 205, 247, 289], "5631": [0, 10, 140, 205, 247, 289], "magneticum": [0, 10, 140, 205, 247, 289], "amb": [0, 10, 140, 205, 247, 289], "cryptobacterium": [0, 10, 140, 205, 247, 289], "curtum": [0, 10, 140, 205, 247, 289], "15641": [0, 10, 140, 205, 247, 289], "pw": [0, 10, 140, 205, 247, 289], "murdochii": [0, 10, 140, 205, 247, 289], "12563": [0, 10, 140, 205, 247, 289], "hippea": [0, 10, 140, 205, 247, 289], "10411": [0, 10, 140, 205, 247, 289], "lysobact": [0, 10, 140, 205, 247, 289], "antibioticu": [0, 10, 140, 205, 247, 289], "8102": [0, 10, 140, 205, 247, 289], "asinigenitali": [0, 10, 140, 205, 247, 289], "mce3": [0, 10, 140, 205, 247, 289], "polyisoprenivoran": [0, 10, 140, 205, 247, 289], "vh2": [0, 10, 140, 205, 247, 289], "hellenicu": [0, 10, 140, 205, 247, 289], "12710": [0, 10, 140, 205, 247, 289], "odyssella": [0, 10, 140, 205, 247, 289], "thessalonicensi": [0, 10, 140, 205, 247, 289], "l13": [0, 10, 140, 205, 247, 289], "anthracocysti": [0, 10, 140, 205, 247, 289], "flocculosa": [0, 10, 140, 205, 247, 289], "moesziomyc": [0, 10, 140, 205, 247, 289], "aphidi": [0, 10, 140, 205, 247, 289], "70725": [0, 10, 140, 205, 247, 289], "beutenbergia": [0, 10, 140, 205, 247, 289], "caverna": [0, 10, 140, 205, 247, 289], "12333": [0, 10, 140, 205, 247, 289], "desulfotalea": [0, 10, 140, 205, 247, 289], "lsv54": [0, 10, 140, 205, 247, 289], "brachyrhyncho": [0, 10, 140, 205, 247, 289], "pseudarthrobact": [0, 10, 140, 205, 247, 289], "chlorophenolicu": [0, 10, 140, 205, 247, 289], "a6": [0, 10, 140, 205, 247, 289], "clogmia": [0, 10, 140, 205, 247, 289], "albipunctata": [0, 10, 140, 205, 247, 289], "varigena": [0, 10, 140, 205, 247, 289], "1296": [0, 10, 140, 205, 247, 289], "relictum": [0, 10, 140, 205, 247, 289], "mz1t": [0, 10, 140, 205, 247, 289], "clementina": [0, 10, 140, 205, 247, 289], "dicoccoid": [0, 10, 140, 205, 247, 289], "xylosoxidan": [0, 10, 140, 205, 247, 289], "a8": [0, 10, 140, 205, 247, 289], "tribocorum": [0, 10, 140, 205, 247, 289], "105476": [0, 10, 140, 205, 247, 289], "thermacetogenium": [0, 10, 140, 205, 247, 289], "phaeum": [0, 10, 140, 205, 247, 289], "12270": [0, 10, 140, 205, 247, 289], "sphaerulina": [0, 10, 140, 205, 247, 289], "musiva": [0, 10, 140, 205, 247, 289], "serpula": [0, 10, 140, 205, 247, 289], "lacryman": [0, 10, 140, 205, 247, 289], "pecorum": [0, 10, 140, 205, 247, 289], "e58": [0, 10, 140, 205, 247, 289], "cladophialophora": [0, 10, 140, 205, 247, 289], "carrionii": [0, 10, 140, 205, 247, 289], "rhinocladiella": [0, 10, 140, 205, 247, 289], "mackenziei": [0, 10, 140, 205, 247, 289], "650": [0, 10, 140, 205, 247, 289], "arenibact": [0, 10, 140, 205, 247, 289], "latericiu": [0, 10, 140, 205, 247, 289], "15913": [0, 10, 140, 205, 247, 289], "syntrophothermu": [0, 10, 140, 205, 247, 289], "lipocalidu": [0, 10, 140, 205, 247, 289], "12680": [0, 10, 140, 205, 247, 289], "phaseolibact": [0, 10, 140, 205, 247, 289], "flecten": [0, 10, 140, 205, 247, 289], "12775": [0, 10, 140, 205, 247, 289], "saccharophagu": [0, 10, 140, 205, 247, 289], "degradan": [0, 10, 140, 205, 247, 289], "flexu": [0, 10, 140, 205, 247, 289], "t6186": [0, 10, 140, 205, 247, 289], "haloduran": [0, 10, 140, 205, 247, 289], "125": [0, 2, 10, 140, 205, 247, 289], "propionispira": [0, 10, 140, 205, 247, 289], "raffinosivoran": [0, 10, 140, 205, 247, 289], "20765": [0, 10, 140, 205, 247, 289], "sourekii": [0, 10, 140, 205, 247, 289], "700629": [0, 10, 140, 205, 247, 289], "17616": [0, 10, 140, 205, 247, 289], "primitia": [0, 10, 140, 205, 247, 289], "za": [0, 10, 140, 205, 247, 289], "eremococcu": [0, 10, 140, 205, 247, 289], "coleocola": [0, 10, 140, 205, 247, 289], "15696": [0, 10, 140, 205, 247, 289], "igniterra": [0, 10, 140, 205, 247, 289], "700962": [0, 10, 140, 205, 247, 289], "antranikianii": [0, 10, 140, 205, 247, 289], "12462": [0, 10, 140, 205, 247, 289], "longicatena": [0, 10, 140, 205, 247, 289], "agr2136": [0, 10, 140, 205, 247, 289], "cyclospora": [0, 10, 140, 205, 247, 289], "cayetanensi": [0, 10, 140, 205, 247, 289], "abdita": [0, 10, 140, 205, 247, 289], "21756": [0, 10, 140, 205, 247, 289], "ceratocysti": [0, 10, 140, 205, 247, 289], "platani": [0, 10, 140, 205, 247, 289], "spielmanii": [0, 10, 140, 205, 247, 289], "a14": [0, 10, 140, 205, 247, 289], "yeochonensi": [0, 10, 140, 205, 247, 289], "cn732": [0, 10, 140, 205, 247, 289], "amicali": [0, 10, 140, 205, 247, 289], "ccma": [0, 10, 140, 205, 247, 289], "559": [0, 10, 140, 205, 247, 289], "terpenotabidum": [0, 10, 140, 205, 247, 289], "pomeroyi": [0, 10, 140, 205, 247, 289], "dss": [0, 10, 140, 205, 247, 289], "amethystina": [0, 10, 140, 205, 247, 289], "laam": [0, 10, 140, 205, 247, 289], "bubalu": [0, 10, 140, 205, 247, 289], "bubali": [0, 10, 140, 205, 247, 289], "bantiana": [0, 10, 140, 205, 247, 289], "173": [0, 10, 140, 205, 247, 289], "19149": [0, 10, 140, 205, 247, 289], "oligella": [0, 10, 140, 205, 247, 289], "ureolytica": [0, 10, 140, 205, 247, 289], "18253": [0, 10, 140, 205, 247, 289], "urethrali": [0, 10, 140, 205, 247, 289], "dnf00040": [0, 10, 140, 205, 247, 289], "absidia": [0, 10, 140, 205, 247, 289], "repen": [0, 10, 140, 205, 247, 289], "camelina": [0, 10, 140, 205, 247, 289], "15381": [0, 10, 140, 205, 247, 289], "milo": [0, 10, 140, 205, 247, 289], "t1": [0, 10, 140, 205, 247, 289], "thiomicrorhabdu": [0, 10, 140, 205, 247, 289], "t2": [0, 10, 140, 205, 247, 289], "enterovibrio": [0, 10, 140, 205, 247, 289], "calviensi": [0, 10, 140, 205, 247, 289], "1f": [0, 10, 140, 205, 247, 289], "polist": [0, 10, 140, 205, 247, 289], "7335": [0, 10, 140, 205, 247, 289], "udagawa": [0, 10, 140, 205, 247, 289], "paracaedibact": [0, 10, 140, 205, 247, 289], "ambiguu": [0, 10, 140, 205, 247, 289], "portiera": [0, 10, 140, 205, 247, 289], "aleyrodidarum": [0, 10, 140, 205, 247, 289], "bt": [0, 10, 140, 205, 247, 289], "qvlc": [0, 10, 140, 205, 247, 289], "spinifera": [0, 10, 140, 205, 247, 289], "hortaea": [0, 10, 140, 205, 247, 289], "werneckii": [0, 10, 140, 205, 247, 289], "koehlera": [0, 10, 140, 205, 247, 289], "29": [0, 10, 140, 183, 191, 194, 205, 247, 289], "aerophila": [0, 10, 140, 205, 247, 289], "al3": [0, 10, 140, 205, 247, 289], "1941": [0, 10, 140, 205, 247, 289], "acridum": [0, 10, 140, 205, 247, 289], "cqma": [0, 10, 140, 205, 247, 289], "102": [0, 10, 140, 167, 205, 247, 289], "frisingens": [0, 10, 140, 205, 247, 289], "gsf30": [0, 10, 140, 205, 247, 289], "fischerella": [0, 10, 140, 205, 247, 289], "muscicola": [0, 10, 140, 205, 247, 289], "7414": [0, 10, 140, 205, 247, 289], "ketogulonicigenium": [0, 10, 140, 205, 247, 289], "wsh": [0, 10, 140, 205, 247, 289], "pandoraea": [0, 10, 140, 205, 247, 289], "apista": [0, 10, 140, 205, 247, 289], "pnomenusa": [0, 10, 140, 205, 247, 289], "pulmonicola": [0, 10, 140, 205, 247, 289], "pseudaminobact": [0, 10, 140, 205, 247, 289], "salicylatoxidan": [0, 10, 140, 205, 247, 289], "kct001": [0, 10, 140, 205, 247, 289], "hoshina": [0, 10, 140, 205, 247, 289], "105699": [0, 10, 140, 205, 247, 289], "33379": [0, 10, 140, 205, 247, 289], "pennivoran": [0, 10, 140, 205, 247, 289], "9078": [0, 10, 140, 205, 247, 289], "exserohilum": [0, 10, 140, 205, 247, 289], "turcicum": [0, 10, 140, 205, 247, 289], "roseivivax": [0, 10, 140, 205, 247, 289], "10272": [0, 10, 140, 205, 247, 289], "cerasi": [0, 10, 140, 205, 247, 289], "petrophila": [0, 10, 140, 205, 247, 289], "rku": [0, 10, 140, 205, 247, 289], "naphthophila": [0, 10, 140, 205, 247, 289], "thermicanu": [0, 10, 140, 205, 247, 289], "aegyptiu": [0, 10, 140, 205, 247, 289], "12793": [0, 10, 140, 205, 247, 289], "rhizophagu": [0, 10, 140, 205, 247, 289], "claru": [0, 10, 140, 205, 247, 289], "ramlibact": [0, 10, 140, 205, 247, 289], "tataouinensi": [0, 10, 140, 205, 247, 289], "ttb310": [0, 10, 140, 205, 247, 289], "paradoxum": [0, 10, 140, 205, 247, 289], "dyadobact": [0, 10, 140, 205, 247, 289], "18053": [0, 10, 140, 205, 247, 289], "petrii": [0, 10, 140, 205, 247, 289], "intermedium": [0, 10, 140, 205, 247, 289], "3301": [0, 10, 140, 205, 247, 289], "besnoitia": [0, 10, 140, 205, 247, 289], "besnoiti": [0, 10, 140, 205, 247, 289], "1221n": [0, 10, 140, 205, 247, 289], "gaviali": [0, 10, 140, 205, 247, 289], "gangeticu": [0, 10, 140, 205, 247, 289], "pametensi": [0, 10, 140, 205, 247, 289], "51478": [0, 10, 140, 205, 247, 289], "cenocepacia": [0, 10, 140, 205, 247, 289], "j2315": [0, 10, 140, 205, 247, 289], "fallonii": [0, 10, 140, 205, 247, 289], "llap": [0, 10, 140, 205, 247, 289], "psychrophilum": [0, 10, 140, 205, 247, 289], "jip02": [0, 10, 140, 205, 247, 289], "hamsteri": [0, 10, 140, 205, 247, 289], "5661": [0, 10, 140, 205, 247, 289], "6256": [0, 10, 140, 205, 247, 289], "halobacteriovorax": [0, 10, 140, 205, 247, 289], "sj": [0, 10, 140, 205, 247, 289], "eutypa": [0, 10, 140, 205, 247, 289], "lata": [0, 10, 140, 205, 247, 289], "phaethon": [0, 10, 140, 205, 247, 289], "lepturu": [0, 10, 140, 205, 247, 289], "asf360": [0, 10, 140, 205, 247, 289], "md294": [0, 10, 140, 205, 247, 289], "plexicaudatum": [0, 10, 140, 205, 247, 289], "asf492": [0, 10, 140, 205, 247, 289], "ferroplasma": [0, 10, 140, 205, 247, 289], "acidarmanu": [0, 10, 140, 205, 247, 289], "fer1": [0, 10, 140, 205, 247, 289], "acetomicrobium": [0, 10, 140, 205, 247, 289], "13181": [0, 10, 140, 205, 247, 289], "lm1": [0, 10, 140, 205, 247, 289], "periconia": [0, 10, 140, 205, 247, 289], "macrospinosa": [0, 10, 140, 205, 247, 289], "oxb": [0, 10, 140, 205, 247, 289], "drechmeria": [0, 10, 140, 205, 247, 289], "coniospora": [0, 10, 140, 205, 247, 289], "septicum": [0, 10, 140, 205, 247, 289], "44393": [0, 10, 140, 205, 247, 289], "phlebia": [0, 10, 140, 205, 247, 289], "centrifuga": [0, 10, 140, 205, 247, 289], "oguniens": [0, 10, 140, 205, 247, 289], "te7": [0, 10, 140, 205, 247, 289], "hammondia": [0, 10, 140, 205, 247, 289], "hammondi": [0, 10, 140, 205, 247, 289], "frigidarium": [0, 10, 140, 205, 247, 289], "17623": [0, 10, 140, 205, 247, 289], "7507": [0, 10, 140, 205, 247, 289], "austwickia": [0, 10, 140, 205, 247, 289], "105200": [0, 10, 140, 205, 247, 289], "onion": [0, 10, 140, 205, 247, 289], "yellow": [0, 10, 140, 205, 247, 289], "chloroherpeton": [0, 10, 140, 205, 247, 289], "thalassium": [0, 10, 140, 205, 247, 289], "35110": [0, 10, 140, 205, 247, 289], "longisporum": [0, 10, 140, 205, 247, 289], "madurella": [0, 10, 140, 205, 247, 289], "mycetomati": [0, 10, 140, 205, 247, 289], "ochengi": [0, 10, 140, 205, 247, 289], "pseudograminearum": [0, 10, 140, 205, 247, 289], "cs3096": [0, 10, 140, 205, 247, 289], "choanephora": [0, 10, 140, 205, 247, 289], "cucurbitarum": [0, 10, 140, 205, 247, 289], "hesseltinella": [0, 10, 140, 205, 247, 289], "vesiculosa": [0, 10, 140, 205, 247, 289], "methanomethylovoran": [0, 10, 140, 205, 247, 289], "15978": [0, 10, 140, 205, 247, 289], "asperellum": [0, 10, 140, 205, 247, 289], "433": [0, 10, 140, 205, 247, 289], "97": [0, 10, 140, 165, 169, 171, 205, 216, 247, 257, 289, 301, 324, 325], "saprolegnia": [0, 10, 140, 205, 247, 289], "223": [0, 10, 140, 205, 247, 289], "aequorivita": [0, 10, 140, 205, 247, 289], "sublithincola": [0, 10, 140, 205, 247, 289], "14238": [0, 10, 140, 205, 247, 289], "interdigital": [0, 10, 140, 205, 247, 289], "h6": [0, 10, 140, 205, 247, 289], "blochmannia": [0, 10, 140, 205, 247, 289], "pennsylvanicu": [0, 10, 140, 205, 247, 289], "bpen": [0, 10, 140, 205, 247, 289], "ubonensi": [0, 10, 140, 205, 247, 289], "msmb22": [0, 10, 140, 205, 247, 289], "tetrasphaera": [0, 10, 140, 205, 247, 289], "lp2": [0, 10, 140, 205, 247, 289], "glarea": [0, 10, 140, 205, 247, 289], "lozoyensi": [0, 10, 140, 205, 247, 289], "20868": [0, 10, 140, 205, 247, 289], "mume": [0, 10, 140, 205, 247, 289], "stanieria": [0, 10, 140, 205, 247, 289], "cyanosphaera": [0, 10, 140, 205, 247, 289], "7437": [0, 10, 140, 205, 247, 289], "xenococcu": [0, 10, 140, 205, 247, 289], "7305": [0, 10, 140, 205, 247, 289], "7375": [0, 10, 140, 205, 247, 289], "desulfalla": [0, 10, 140, 205, 247, 289], "gibsonia": [0, 10, 140, 205, 247, 289], "7213": [0, 10, 140, 205, 247, 289], "solobacterium": [0, 10, 140, 205, 247, 289], "moorei": [0, 10, 140, 205, 247, 289], "22971": [0, 10, 140, 205, 247, 289], "gloeocapsa": [0, 10, 140, 205, 247, 289], "73106": [0, 10, 140, 205, 247, 289], "cyanobacterium": [0, 10, 140, 205, 247, 289], "7202": [0, 10, 140, 205, 247, 289], "infantariu": [0, 10, 140, 205, 247, 289], "cj18": [0, 10, 140, 205, 247, 289], "penneri": [0, 10, 140, 205, 247, 289], "35198": [0, 10, 140, 205, 247, 289], "didelphi": [0, 10, 140, 205, 247, 289], "15616": [0, 10, 140, 205, 247, 289], "acromyrmex": [0, 10, 140, 205, 247, 289], "echinatior": [0, 10, 140, 205, 247, 289], "vavraia": [0, 10, 140, 205, 247, 289], "floridensi": [0, 10, 140, 205, 247, 289], "coleocani": [0, 10, 140, 205, 247, 289], "15436": [0, 10, 140, 205, 247, 289], "urogenitali": [0, 10, 140, 205, 247, 289], "15434": [0, 10, 140, 205, 247, 289], "7120": [0, 10, 140, 205, 247, 289], "fachb": [0, 10, 140, 205, 247, 289], "418": [0, 10, 140, 205, 247, 289], "saccharothrix": [0, 10, 140, 205, 247, 289], "espanaensi": [0, 10, 140, 205, 247, 289], "44229": [0, 10, 140, 205, 247, 289], "columbina": [0, 10, 140, 205, 247, 289], "16469": [0, 10, 140, 205, 247, 289], "pyridinivoran": [0, 10, 140, 205, 247, 289], "sb3094": [0, 10, 140, 205, 247, 289], "hinzii": [0, 10, 140, 205, 247, 289], "51730": [0, 10, 140, 205, 247, 289], "oscillochlori": [0, 10, 140, 205, 247, 289], "trichoid": [0, 10, 140, 205, 247, 289], "dg": [0, 10, 140, 205, 247, 289], "brasilianum": [0, 10, 140, 205, 247, 289], "postia": [0, 10, 140, 205, 247, 289], "placenta": [0, 10, 140, 205, 247, 289], "mad": [0, 10, 140, 205, 247, 289], "698": [0, 10, 140, 205, 247, 289], "gloeophyllum": [0, 10, 140, 205, 247, 289], "trabeum": [0, 10, 140, 205, 247, 289], "camponotu": [0, 10, 140, 205, 247, 289], "floridanu": [0, 10, 140, 205, 247, 289], "39006": [0, 10, 140, 205, 247, 289], "hs1": [0, 10, 140, 205, 247, 289], "amylolentu": [0, 10, 140, 205, 247, 289], "adineta": [0, 10, 140, 205, 247, 289], "vaga": [0, 10, 140, 205, 247, 289], "mannitolilytica": [0, 10, 140, 205, 247, 289], "streptacidiphilu": [0, 10, 140, 205, 247, 289], "neutrinimicu": [0, 10, 140, 205, 247, 289], "carboni": [0, 10, 140, 205, 247, 289], "desulfohalotomaculum": [0, 10, 140, 205, 247, 289], "alkaliphilum": [0, 10, 140, 205, 247, 289], "12257": [0, 10, 140, 205, 247, 289], "valsa": [0, 10, 140, 205, 247, 289], "pyri": [0, 10, 140, 205, 247, 289], "methylibium": [0, 10, 140, 205, 247, 289], "petroleiphilum": [0, 10, 140, 205, 247, 289], "pm1": [0, 10, 140, 205, 247, 289], "epicoccum": [0, 10, 140, 205, 247, 289], "nigrum": [0, 10, 140, 205, 247, 289], "cryptoterm": [0, 10, 140, 205, 247, 289], "secundu": [0, 10, 140, 205, 247, 289], "anaerostip": [0, 10, 140, 205, 247, 289], "14662": [0, 10, 140, 205, 247, 289], "leucosporidium": [0, 10, 140, 205, 247, 289], "creatinivorum": [0, 10, 140, 205, 247, 289], "casuarina": [0, 10, 140, 205, 247, 289], "siderophilu": [0, 10, 140, 205, 247, 289], "sr4": [0, 10, 140, 205, 247, 289], "pseudoflavonifractor": [0, 10, 140, 205, 247, 289], "capillosu": [0, 10, 140, 205, 247, 289], "29799": [0, 10, 140, 205, 247, 289], "cupriavidu": [0, 10, 140, 205, 247, 289], "h16": [0, 10, 140, 205, 247, 289], "ensif": [0, 10, 140, 205, 247, 289], "ov14": [0, 10, 140, 205, 247, 289], "berezinia": [0, 10, 140, 205, 247, 289], "guillouia": [0, 10, 140, 205, 247, 289], "niph": [0, 10, 140, 205, 247, 289], "991": [0, 10, 140, 205, 247, 289], "ruh2624": [0, 10, 140, 205, 247, 289], "tenacibaculum": [0, 10, 140, 205, 247, 289], "maritimum": [0, 10, 140, 205, 247, 289], "lw3": [0, 10, 140, 205, 247, 289], "pw1": [0, 10, 140, 205, 247, 289], "opitutu": [0, 10, 140, 205, 247, 289], "pb90": [0, 10, 140, 205, 247, 289], "velox": [0, 10, 140, 205, 247, 289], "12556": [0, 10, 140, 205, 247, 289], "italicu": [0, 10, 140, 205, 247, 289], "ab9": [0, 10, 140, 205, 247, 289], "falsenii": [0, 10, 140, 205, 247, 289], "44353": [0, 10, 140, 205, 247, 289], "platensi": [0, 10, 140, 205, 247, 289], "11748": [0, 10, 140, 205, 247, 289], "ursingii": [0, 10, 140, 205, 247, 289], "16037": [0, 10, 140, 205, 247, 289], "107286": [0, 10, 140, 205, 247, 289], "schindleri": [0, 10, 140, 205, 247, 289], "900": [0, 10, 140, 205, 247, 289], "monacensi": [0, 10, 140, 205, 247, 289], "anaerovorax": [0, 10, 140, 205, 247, 289], "odorimutan": [0, 10, 140, 205, 247, 289], "5092": [0, 10, 140, 205, 247, 289], "trevisanii": [0, 10, 140, 205, 247, 289], "22070": [0, 10, 140, 205, 247, 289], "varroa": [0, 10, 140, 205, 247, 289], "brandtii": [0, 10, 140, 205, 247, 289], "galerina": [0, 10, 140, 205, 247, 289], "marginata": [0, 10, 140, 205, 247, 289], "339": [0, 10, 140, 205, 247, 289], "88": [0, 10, 140, 165, 166, 167, 205, 247, 289], "spizellomyc": [0, 10, 140, 205, 247, 289], "115": [0, 10, 140, 205, 247, 289], "chn": [0, 10, 140, 205, 247, 289], "jam81": [0, 10, 140, 205, 247, 289], "catenaria": [0, 10, 140, 205, 247, 289], "anguillula": [0, 10, 140, 205, 247, 289], "pl171": [0, 10, 140, 205, 247, 289], "vermifera": [0, 10, 140, 205, 247, 289], "305830": [0, 10, 140, 205, 247, 289], "nocardioid": [0, 10, 140, 205, 247, 289], "cf8": [0, 10, 140, 205, 247, 289], "medica": [0, 10, 140, 205, 247, 289], "wsm419": [0, 10, 140, 205, 247, 289], "gregarina": [0, 10, 140, 205, 247, 289], "niphandrod": [0, 10, 140, 205, 247, 289], "pelotomaculum": [0, 10, 140, 205, 247, 289], "thermopropionicum": [0, 10, 140, 205, 247, 289], "si": [0, 10, 140, 205, 247, 289], "vanbaalenii": [0, 10, 140, 205, 247, 289], "cc9605": [0, 10, 140, 205, 247, 289], "cc9616": [0, 10, 140, 205, 247, 289], "tef": [0, 10, 140, 205, 247, 289], "gula": [0, 10, 140, 205, 247, 289], "muricauda": [0, 10, 140, 205, 247, 289], "ruestringensi": [0, 10, 140, 205, 247, 289], "13258": [0, 10, 140, 205, 247, 289], "birtlesii": [0, 10, 140, 205, 247, 289], "e11": [0, 10, 140, 205, 247, 289], "kineosphaera": [0, 10, 140, 205, 247, 289], "limosa": [0, 10, 140, 205, 247, 289], "100340": [0, 10, 140, 205, 247, 289], "7376": [0, 10, 140, 205, 247, 289], "sulfurisphaera": [0, 10, 140, 205, 247, 289], "tokodaii": [0, 10, 140, 205, 247, 289], "ignatzschineria": [0, 10, 140, 205, 247, 289], "13226": [0, 10, 140, 205, 247, 289], "aphanomyc": [0, 10, 140, 205, 247, 289], "astaci": [0, 10, 140, 205, 247, 289], "diclina": [0, 10, 140, 205, 247, 289], "minimu": [0, 10, 140, 205, 247, 289], "ramularia": [0, 10, 140, 205, 247, 289], "collo": [0, 10, 140, 205, 247, 289], "cygni": [0, 10, 140, 205, 247, 289], "villorum": [0, 10, 140, 205, 247, 289], "700913": [0, 10, 140, 205, 247, 289], "700641": [0, 10, 140, 205, 247, 289], "pseudocercospora": [0, 10, 140, 205, 247, 289], "pseudoramibact": [0, 10, 140, 205, 247, 289], "alactolyticu": [0, 10, 140, 205, 247, 289], "23263": [0, 10, 140, 205, 247, 289], "melitaea": [0, 10, 140, 205, 247, 289], "cinxia": [0, 10, 140, 205, 247, 289], "tv2a": [0, 10, 140, 205, 247, 289], "globisporu": [0, 10, 140, 205, 247, 289], "43857": [0, 10, 140, 205, 247, 289], "tetrapisispora": [0, 10, 140, 205, 247, 289], "phaffii": [0, 10, 140, 205, 247, 289], "4417": [0, 10, 140, 205, 247, 289], "geoglobu": [0, 10, 140, 205, 247, 289], "ahangari": [0, 10, 140, 205, 247, 289], "dichomitu": [0, 10, 140, 205, 247, 289], "squalen": [0, 10, 140, 205, 247, 289], "lyad": [0, 10, 140, 205, 247, 289], "carsonella": [0, 10, 140, 205, 247, 289], "ruddii": [0, 10, 140, 205, 247, 289], "fumosorosea": [0, 10, 140, 205, 247, 289], "2679": [0, 10, 140, 205, 247, 289], "mikata": [0, 10, 140, 205, 247, 289], "278": [0, 10, 140, 205, 247, 289], "nodulan": [0, 10, 140, 205, 247, 289], "2060": [0, 10, 140, 205, 247, 289], "alkaliphilu": [0, 10, 140, 205, 247, 289], "transvaalensi": [0, 10, 140, 205, 247, 289], "700919": [0, 10, 140, 205, 247, 289], "orisratti": [0, 10, 140, 205, 247, 289], "15617": [0, 10, 140, 205, 247, 289], "agr0001": [0, 10, 140, 205, 247, 289], "columbinum": [0, 10, 140, 205, 247, 289], "sf7": [0, 10, 140, 205, 247, 289], "phoroni": [0, 10, 140, 205, 247, 289], "iwayama": [0, 10, 140, 205, 247, 289], "15354": [0, 10, 140, 205, 247, 289], "andersoni": [0, 10, 140, 205, 247, 289], "walkeri": [0, 10, 140, 205, 247, 289], "verticillioid": [0, 10, 140, 205, 247, 289], "sphingopyxi": [0, 10, 140, 205, 247, 289], "rb2256": [0, 10, 140, 205, 247, 289], "denitrovibrio": [0, 10, 140, 205, 247, 289], "acetiphilu": [0, 10, 140, 205, 247, 289], "12809": [0, 10, 140, 205, 247, 289], "7319": [0, 10, 140, 205, 247, 289], "6802": [0, 10, 140, 205, 247, 289], "picoid": [0, 10, 140, 205, 247, 289], "pubescen": [0, 10, 140, 205, 247, 289], "beauveria": [0, 10, 140, 205, 247, 289], "brongniartii": [0, 10, 140, 205, 247, 289], "rcef": [0, 10, 140, 205, 247, 289], "oscillatoria": [0, 10, 140, 205, 247, 289], "6304": [0, 10, 140, 205, 247, 289], "arthrospira": [0, 10, 140, 205, 247, 289], "39": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "noctiflora": [0, 10, 140, 205, 247, 289], "bulleidia": [0, 10, 140, 205, 247, 289], "extructa": [0, 10, 140, 205, 247, 289], "w1219": [0, 10, 140, 205, 247, 289], "lipot": [0, 10, 140, 205, 247, 289], "vexillif": [0, 10, 140, 205, 247, 289], "metalliduran": [0, 10, 140, 205, 247, 289], "ch34": [0, 10, 140, 205, 247, 289], "pseudothermotoga": [0, 10, 140, 205, 247, 289], "thermarum": [0, 10, 140, 205, 247, 289], "5069": [0, 10, 140, 205, 247, 289], "syntrophobact": [0, 10, 140, 205, 247, 289], "fumaroxidan": [0, 10, 140, 205, 247, 289], "mpob": [0, 10, 140, 205, 247, 289], "microcoleu": [0, 10, 140, 205, 247, 289], "vaginatu": [0, 10, 140, 205, 247, 289], "fgp": [0, 10, 140, 205, 247, 289], "sonorensi": [0, 10, 140, 205, 247, 289], "l12": [0, 10, 140, 205, 247, 289], "marinomona": [0, 10, 140, 205, 247, 289], "mediterranea": [0, 10, 140, 205, 247, 289], "mmb": [0, 10, 140, 205, 247, 289], "hordei": [0, 10, 140, 205, 247, 289], "uh4857": [0, 10, 140, 205, 247, 289], "pinnipediali": [0, 10, 140, 205, 247, 289], "b2": [0, 10, 140, 205, 247, 289], "ceti": [0, 10, 140, 205, 247, 289], "m644": [0, 10, 140, 205, 247, 289], "roseiflexu": [0, 10, 140, 205, 247, 289], "castenholzii": [0, 10, 140, 205, 247, 289], "13941": [0, 10, 140, 205, 247, 289], "ferrimicrobium": [0, 10, 140, 205, 247, 289], "acidiphilum": [0, 10, 140, 205, 247, 289], "19497": [0, 10, 140, 205, 247, 289], "helicocarpu": [0, 10, 140, 205, 247, 289], "uamh5409": [0, 10, 140, 205, 247, 289], "suimastitidi": [0, 10, 140, 205, 247, 289], "15538": [0, 10, 140, 205, 247, 289], "pediculu": [0, 10, 140, 205, 247, 289], "humanu": [0, 10, 140, 205, 247, 289], "arsenaticum": [0, 10, 140, 205, 247, 289], "13514": [0, 10, 140, 205, 247, 289], "xenophagum": [0, 10, 140, 205, 247, 289], "qyi": [0, 10, 140, 205, 247, 289], "tauraco": [0, 10, 140, 205, 247, 289], "erythrolophu": [0, 10, 140, 205, 247, 289], "pannonibact": [0, 10, 140, 205, 247, 289], "phragmitetu": [0, 10, 140, 205, 247, 289], "14782": [0, 10, 140, 205, 247, 289], "ska34": [0, 10, 140, 205, 247, 289], "paracoccidioid": [0, 10, 140, 205, 247, 289], "diaphorina": [0, 10, 140, 205, 247, 289], "cercospora": [0, 10, 140, 205, 247, 289], "beticola": [0, 10, 140, 205, 247, 289], "herbariu": [0, 10, 140, 205, 247, 289], "13609": [0, 10, 140, 205, 247, 289], "5491": [0, 10, 140, 205, 247, 289], "trematum": [0, 10, 140, 205, 247, 289], "yim": [0, 10, 140, 205, 247, 289], "90004": [0, 10, 140, 205, 247, 289], "thiolinea": [0, 10, 140, 205, 247, 289], "disciformi": [0, 10, 140, 205, 247, 289], "14473": [0, 10, 140, 205, 247, 289], "thiofilum": [0, 10, 140, 205, 247, 289], "flexil": [0, 10, 140, 205, 247, 289], "14609": [0, 10, 140, 205, 247, 289], "biarmip": [0, 10, 140, 205, 247, 289], "halodesulfovibrio": [0, 10, 140, 205, 247, 289], "10141": [0, 10, 140, 205, 247, 289], "alcalifacien": [0, 10, 140, 205, 247, 289], "30120": [0, 10, 140, 205, 247, 289], "rq7": [0, 10, 140, 205, 247, 289], "rq2": [0, 10, 140, 205, 247, 289], "strigamia": [0, 10, 140, 205, 247, 289], "nipponia": [0, 10, 140, 205, 247, 289], "nippon": [0, 10, 140, 205, 247, 289], "catelliglobosispora": [0, 10, 140, 205, 247, 289], "koreensi": [0, 10, 140, 205, 247, 289], "44566": [0, 10, 140, 205, 247, 289], "santomea": [0, 10, 140, 205, 247, 289], "mpf4": [0, 10, 140, 205, 247, 289], "328": [0, 10, 140, 205, 247, 289], "carboxydothermu": [0, 10, 140, 205, 247, 289], "hydrogenoforman": [0, 10, 140, 205, 247, 289], "2901": [0, 10, 140, 205, 247, 289], "halobiforma": [0, 10, 140, 205, 247, 289], "nitratireducen": [0, 10, 140, 205, 247, 289], "10879": [0, 10, 140, 205, 247, 289], "galdieria": [0, 10, 140, 205, 247, 289], "sulphuraria": [0, 10, 140, 205, 247, 289], "capitovi": [0, 10, 140, 205, 247, 289], "44611": [0, 10, 140, 205, 247, 289], "turicensi": [0, 10, 140, 205, 247, 289], "col4": [0, 10, 140, 205, 247, 289], "13458": [0, 10, 140, 205, 247, 289], "kineococcu": [0, 10, 140, 205, 247, 289], "srs30216": [0, 10, 140, 205, 247, 289], "impatien": [0, 10, 140, 205, 247, 289], "glomeribact": [0, 10, 140, 205, 247, 289], "gigasporarum": [0, 10, 140, 205, 247, 289], "beg34": [0, 10, 140, 205, 247, 289], "veterana": [0, 10, 140, 205, 247, 289], "100344": [0, 10, 140, 205, 247, 289], "jostii": [0, 10, 140, 205, 247, 289], "rha1": [0, 10, 140, 205, 247, 289], "exiguobacterium": [0, 10, 140, 205, 247, 289], "antarcticum": [0, 10, 140, 205, 247, 289], "b7": [0, 10, 140, 205, 247, 289], "younga": [0, 10, 140, 205, 247, 289], "29220": [0, 10, 140, 205, 247, 289], "caldilinea": [0, 10, 140, 205, 247, 289], "14535": [0, 10, 140, 205, 247, 289], "104270": [0, 10, 140, 205, 247, 289], "nc": [0, 10, 140, 205, 247, 289], "methylocapsa": [0, 10, 140, 205, 247, 289], "acidiphila": [0, 10, 140, 205, 247, 289], "frankliniella": [0, 10, 140, 205, 247, 289], "leisingera": [0, 10, 140, 205, 247, 289], "methylohalidivoran": [0, 10, 140, 205, 247, 289], "14336": [0, 10, 140, 205, 247, 289], "olsenella": [0, 10, 140, 205, 247, 289], "uli": [0, 10, 140, 205, 247, 289], "7084": [0, 10, 140, 205, 247, 289], "phytomona": [0, 10, 140, 205, 247, 289], "isol": [0, 10, 140, 205, 247, 289], "em1": [0, 10, 140, 205, 247, 289], "hart1": [0, 10, 140, 205, 247, 289], "freneyi": [0, 10, 140, 205, 247, 289], "dnf00450": [0, 10, 140, 205, 247, 289], "1103": [0, 10, 140, 205, 247, 289], "gyllenbergii": [0, 10, 140, 205, 247, 289], "230": [0, 10, 140, 205, 247, 289], "fungorum": [0, 10, 140, 205, 247, 289], "ministeria": [0, 10, 140, 205, 247, 289], "vibran": [0, 10, 140, 205, 247, 289], "se50": [0, 10, 140, 205, 247, 289], "110": [0, 10, 140, 205, 247, 289], "27815": [0, 10, 140, 205, 247, 289], "flueggei": [0, 10, 140, 205, 247, 289], "43531": [0, 10, 140, 205, 247, 289], "infelix": [0, 10, 140, 205, 247, 289], "43532": [0, 10, 140, 205, 247, 289], "noxia": [0, 10, 140, 205, 247, 289], "43541": [0, 10, 140, 205, 247, 289], "daejeonensi": [0, 10, 140, 205, 247, 289], "15491": [0, 10, 140, 205, 247, 289], "cyriacigeorgica": [0, 10, 140, 205, 247, 289], "guh": [0, 10, 140, 205, 247, 289], "vulcani": [0, 10, 140, 205, 247, 289], "pss1": [0, 10, 140, 205, 247, 289], "idiomarina": [0, 10, 140, 205, 247, 289], "loihiensi": [0, 10, 140, 205, 247, 289], "l2tr": [0, 10, 140, 205, 247, 289], "brenneri": [0, 10, 140, 205, 247, 289], "endophyticu": [0, 10, 140, 205, 247, 289], "2102": [0, 10, 140, 168, 205, 247, 289], "zootermopsi": [0, 10, 140, 205, 247, 289], "nevadensi": [0, 10, 140, 205, 247, 289], "14484": [0, 10, 140, 205, 247, 289], "knoellia": [0, 10, 140, 205, 247, 289], "19936": [0, 10, 140, 205, 247, 289], "haemocani": [0, 10, 140, 205, 247, 289], "polari": [0, 10, 140, 205, 247, 289], "atopobact": [0, 10, 140, 205, 247, 289], "phoca": [0, 10, 140, 205, 247, 289], "285": [0, 2, 10, 140, 205, 247, 289], "kimchii": [0, 10, 140, 205, 247, 289], "imsnu": [0, 10, 140, 205, 247, 289], "11154": [0, 10, 140, 205, 247, 289], "lw4": [0, 10, 140, 205, 247, 289], "cibaria": [0, 10, 140, 205, 247, 289], "kacc": [0, 10, 140, 205, 247, 289], "11862": [0, 10, 140, 205, 247, 289], "37419": [0, 10, 140, 205, 247, 289], "700633": [0, 10, 140, 205, 247, 289], "hamiltonella": [0, 10, 140, 205, 247, 289], "defensa": [0, 10, 140, 205, 247, 289], "5at": [0, 10, 140, 205, 247, 289], "regiella": [0, 10, 140, 205, 247, 289], "insecticola": [0, 10, 140, 205, 247, 289], "lsr1": [0, 10, 140, 205, 247, 289], "symbiotica": [0, 10, 140, 205, 247, 289], "cinara": [0, 10, 140, 205, 247, 289], "cedri": [0, 10, 140, 205, 247, 289], "blastococcu": [0, 10, 140, 205, 247, 289], "saxobsiden": [0, 10, 140, 205, 247, 289], "dd2": [0, 10, 140, 205, 247, 289], "cetorum": [0, 10, 140, 205, 247, 289], "7128": [0, 10, 140, 205, 247, 289], "profusa": [0, 10, 140, 205, 247, 289], "f0195": [0, 10, 140, 205, 247, 289], "sistotremastrum": [0, 10, 140, 205, 247, 289], "niveocremeum": [0, 10, 140, 205, 247, 289], "hhb9708": [0, 10, 140, 205, 247, 289], "isoptericola": [0, 10, 140, 205, 247, 289], "variabili": [0, 10, 140, 205, 247, 289], "plicaturopsi": [0, 10, 140, 205, 247, 289], "crispa": [0, 10, 140, 205, 247, 289], "325": [0, 10, 140, 205, 247, 289], "teleopsi": [0, 10, 140, 205, 247, 289], "dalmanni": [0, 10, 140, 205, 247, 289], "culicifaci": [0, 10, 140, 205, 247, 289], "shimazuella": [0, 10, 140, 205, 247, 289], "kribbensi": [0, 10, 140, 205, 247, 289], "45090": [0, 10, 140, 205, 247, 289], "lachnobacterium": [0, 10, 140, 205, 247, 289], "cordifolia": [0, 10, 140, 205, 247, 289], "haemolama": [0, 10, 140, 205, 247, 289], "purdu": [0, 10, 140, 205, 247, 289], "kunsanensi": [0, 10, 140, 205, 247, 289], "44524": [0, 10, 140, 205, 247, 289], "cylindrospermum": [0, 10, 140, 205, 247, 289], "stagnal": [0, 10, 140, 205, 247, 289], "7417": [0, 10, 140, 205, 247, 289], "15288": [0, 10, 140, 205, 247, 289], "uliginosa": [0, 10, 140, 205, 247, 289], "filifactor": [0, 10, 140, 205, 247, 289], "aloci": [0, 10, 140, 205, 247, 289], "35896": [0, 10, 140, 205, 247, 289], "sulci": [0, 10, 140, 205, 247, 289], "35585": [0, 10, 140, 205, 247, 289], "diuraphi": [0, 10, 140, 205, 247, 289], "sipha": [0, 10, 140, 205, 247, 289], "flava": [0, 10, 140, 205, 247, 289], "pogonomyrmex": [0, 10, 140, 205, 247, 289], "barbatu": [0, 10, 140, 205, 247, 289], "35242": [0, 10, 140, 205, 247, 289], "h1aii": [0, 10, 140, 205, 247, 289], "methanothermobact": [0, 10, 140, 205, 247, 289], "thermautotrophicu": [0, 10, 140, 205, 247, 289], "delta": [0, 10, 140, 205, 247, 289], "marburgensi": [0, 10, 140, 205, 247, 289], "marburg": [0, 10, 140, 205, 247, 289], "rathayibact": [0, 10, 140, 205, 247, 289], "toxicu": [0, 10, 140, 205, 247, 289], "7488": [0, 10, 140, 205, 247, 289], "thermosynechococcu": [0, 10, 140, 205, 247, 289], "halorhabdu": [0, 10, 140, 205, 247, 289], "12940": [0, 10, 140, 205, 247, 289], "pseudoloma": [0, 10, 140, 205, 247, 289], "neurophilia": [0, 10, 140, 205, 247, 289], "salinibact": [0, 10, 140, 205, 247, 289], "13855": [0, 10, 140, 205, 247, 289], "griseofuscu": [0, 10, 140, 205, 247, 289], "azovibrio": [0, 10, 140, 205, 247, 289], "23866": [0, 10, 140, 205, 247, 289], "azospira": [0, 10, 140, 205, 247, 289], "collinsella": [0, 10, 140, 205, 247, 289], "13279": [0, 10, 140, 205, 247, 289], "13280": [0, 10, 140, 205, 247, 289], "albertimagni": [0, 10, 140, 205, 247, 289], "aol15": [0, 10, 140, 205, 247, 289], "cyclica": [0, 10, 140, 205, 247, 289], "alm1": [0, 10, 140, 205, 247, 289], "limnospira": [0, 10, 140, 205, 247, 289], "8005": [0, 10, 140, 205, 247, 289], "yeei": [0, 10, 140, 205, 247, 289], "599": [0, 10, 140, 205, 247, 289], "inhiben": [0, 10, 140, 205, 247, 289], "gilichinskyi": [0, 10, 140, 205, 247, 289], "iner": [0, 10, 140, 205, 247, 289], "ab": [0, 10, 140, 205, 247, 289, 324], "magnaporthiopsi": [0, 10, 140, 205, 247, 289], "pyricularia": [0, 10, 140, 205, 247, 289], "grisea": [0, 10, 140, 205, 247, 289], "phymatum": [0, 10, 140, 205, 247, 289], "stm815": [0, 10, 140, 205, 247, 289], "ingluviei": [0, 10, 140, 205, 247, 289], "autruch": [0, 10, 140, 205, 247, 289], "sulfuricurvum": [0, 10, 140, 205, 247, 289], "kujiens": [0, 10, 140, 205, 247, 289], "16994": [0, 10, 140, 205, 247, 289], "kunkeei": [0, 10, 140, 205, 247, 289], "wallemia": [0, 10, 140, 205, 247, 289], "sebi": [0, 10, 140, 205, 247, 289], "urinali": [0, 10, 140, 205, 247, 289], "2285": [0, 10, 140, 205, 247, 289], "phialocephala": [0, 10, 140, 205, 247, 289], "scopiformi": [0, 10, 140, 205, 247, 289], "marinitoga": [0, 10, 140, 205, 247, 289], "piezophila": [0, 10, 140, 205, 247, 289], "ka3": [0, 10, 140, 205, 247, 289], "lutetiensi": [0, 10, 140, 205, 247, 289], "033": [0, 10, 140, 205, 247, 289], "halonatronum": [0, 10, 140, 205, 247, 289], "13868": [0, 10, 140, 205, 247, 289], "15828": [0, 10, 140, 205, 247, 289], "insectorum": [0, 10, 140, 205, 247, 289], "264": [0, 10, 140, 205, 247, 289], "escovopsi": [0, 10, 140, 205, 247, 289], "weberi": [0, 10, 140, 205, 247, 289], "mt": [0, 10, 140, 205, 247, 289], "azotonutricium": [0, 10, 140, 205, 247, 289], "ruthenica": [0, 10, 140, 205, 247, 289], "cp76": [0, 10, 140, 205, 247, 289], "coprosui": [0, 10, 140, 205, 247, 289], "18011": [0, 10, 140, 205, 247, 289], "birgia": [0, 10, 140, 205, 247, 289], "34632": [0, 10, 140, 205, 247, 289], "xenophilu": [0, 10, 140, 205, 247, 289], "azovoran": [0, 10, 140, 205, 247, 289], "13620": [0, 10, 140, 205, 247, 289], "pseudopedobact": [0, 10, 140, 205, 247, 289], "12145": [0, 10, 140, 205, 247, 289], "9485": [0, 10, 140, 205, 247, 289], "suebicu": [0, 10, 140, 205, 247, 289], "5007": [0, 10, 140, 205, 247, 289], "3549": [0, 10, 140, 205, 247, 289], "thioalkalivibrio": [0, 10, 140, 205, 247, 289], "thiocyanoxidan": [0, 10, 140, 205, 247, 289], "arh": [0, 10, 140, 205, 247, 289], "ambifaria": [0, 10, 140, 205, 247, 289], "ammd": [0, 10, 140, 205, 247, 289], "dolosa": [0, 10, 140, 205, 247, 289], "pc543": [0, 10, 140, 205, 247, 289], "meloni": [0, 10, 140, 205, 247, 289], "dapp": [0, 10, 140, 205, 247, 289], "224": [0, 10, 140, 168, 205, 247, 289], "efficien": [0, 10, 140, 205, 247, 289], "314": [0, 10, 140, 205, 247, 289], "desulforegula": [0, 10, 140, 205, 247, 289], "conservatrix": [0, 10, 140, 205, 247, 289], "mb1pa": [0, 10, 140, 205, 247, 289], "oceanicauli": [0, 10, 140, 205, 247, 289], "alexandrii": [0, 10, 140, 205, 247, 289], "11625": [0, 10, 140, 205, 247, 289], "alysiella": [0, 10, 140, 205, 247, 289], "2578": [0, 10, 140, 205, 247, 289], "conchiformibiu": [0, 10, 140, 205, 247, 289], "steeda": [0, 10, 140, 205, 247, 289], "2580": [0, 10, 140, 205, 247, 289], "kozakia": [0, 10, 140, 205, 247, 289], "baliensi": [0, 10, 140, 205, 247, 289], "moniliophthora": [0, 10, 140, 205, 247, 289], "perniciosa": [0, 10, 140, 205, 247, 289], "fa553": [0, 10, 140, 205, 247, 289], "sporocytophaga": [0, 10, 140, 205, 247, 289], "myxococcoid": [0, 10, 140, 205, 247, 289], "al212": [0, 10, 140, 205, 247, 289], "hungatella": [0, 10, 140, 205, 247, 289], "hathewayi": [0, 10, 140, 205, 247, 289], "13479": [0, 10, 140, 205, 247, 289], "turicibact": [0, 10, 140, 205, 247, 289], "pc909": [0, 10, 140, 205, 247, 289], "thiorhodospira": [0, 10, 140, 205, 247, 289], "700588": [0, 10, 140, 205, 247, 289], "phoeniculicola": [0, 10, 140, 205, 247, 289], "412": [0, 10, 140, 205, 247, 289], "ueda107": [0, 10, 140, 205, 247, 289], "91": [0, 10, 140, 205, 247, 289], "toyonensi": [0, 10, 140, 205, 247, 289], "bct": [0, 10, 140, 205, 247, 289], "7112": [0, 10, 140, 205, 247, 289], "genomosp": [0, 10, 140, 205, 247, 289], "moraviensi": [0, 10, 140, 205, 247, 289], "383": [0, 10, 140, 205, 247, 289], "haemoperoxidu": [0, 10, 140, 205, 247, 289], "entericu": [0, 10, 140, 205, 247, 289], "14446": [0, 10, 140, 205, 247, 289], "okinawensi": [0, 10, 140, 205, 247, 289], "ih1": [0, 10, 140, 205, 247, 289], "vibrioid": [0, 10, 140, 205, 247, 289], "na1000": [0, 10, 140, 205, 247, 289], "actinokineospora": [0, 10, 140, 205, 247, 289], "enzanensi": [0, 10, 140, 205, 247, 289], "44649": [0, 10, 140, 205, 247, 289], "acaryochlori": [0, 10, 140, 205, 247, 289], "mbic11017": [0, 10, 140, 205, 247, 289], "anaeroglobu": [0, 10, 140, 205, 247, 289], "geminatu": [0, 10, 140, 205, 247, 289], "f0357": [0, 10, 140, 205, 247, 289], "tulasnella": [0, 10, 140, 205, 247, 289], "calospora": [0, 10, 140, 205, 247, 289], "mut": [0, 10, 140, 205, 247, 289], "4182": [0, 10, 140, 205, 247, 289], "alteromonadal": [0, 10, 140, 205, 247, 289], "bacterium": [0, 10, 140, 205, 247, 289], "flavobacteria": [0, 10, 140, 205, 247, 289], "bbfl7": [0, 10, 140, 205, 247, 289], "dysgonomona": [0, 10, 140, 205, 247, 289], "gadei": [0, 10, 140, 205, 247, 289], "286": [0, 10, 140, 205, 247, 289], "imitan": [0, 10, 140, 205, 247, 289], "invadan": [0, 10, 140, 205, 247, 289], "jeotgalicoccu": [0, 10, 140, 205, 247, 289], "psychrophilu": [0, 10, 140, 205, 247, 289], "19085": [0, 10, 140, 205, 247, 289], "winghamensi": [0, 10, 140, 205, 247, 289], "430": [0, 10, 140, 205, 247, 289], "pyrrhocori": [0, 10, 140, 205, 247, 289], "wadei": [0, 10, 140, 205, 247, 289], "f0279": [0, 10, 140, 205, 247, 289], "hofstadii": [0, 10, 140, 205, 247, 289], "f0254": [0, 10, 140, 205, 247, 289], "shahii": [0, 10, 140, 205, 247, 289], "19757": [0, 10, 140, 205, 247, 289], "goodfellowii": [0, 10, 140, 205, 247, 289], "f0264": [0, 10, 140, 205, 247, 289], "parafulva": [0, 10, 140, 205, 247, 289], "16636": [0, 10, 140, 205, 247, 289], "17004": [0, 10, 140, 205, 247, 289], "cremoricolorata": [0, 10, 140, 205, 247, 289], "radiata": [0, 10, 140, 205, 247, 289], "phaeomoniella": [0, 10, 140, 205, 247, 289], "chlamydospora": [0, 10, 140, 205, 247, 289], "chromohalobact": [0, 10, 140, 205, 247, 289], "3043": [0, 10, 140, 205, 247, 289], "hahella": [0, 10, 140, 205, 247, 289], "chejuensi": [0, 10, 140, 205, 247, 289], "2396": [0, 10, 140, 205, 247, 289], "folsomia": [0, 10, 140, 205, 247, 289], "cedecea": [0, 10, 140, 205, 247, 289], "davisa": [0, 10, 140, 205, 247, 289], "4568": [0, 10, 140, 205, 247, 289], "resinovorum": [0, 10, 140, 205, 247, 289], "coccinea": [0, 10, 140, 205, 247, 289], "brfm310": [0, 10, 140, 205, 247, 289], "diaporth": [0, 10, 140, 205, 247, 289], "helianthi": [0, 10, 140, 205, 247, 289], "scardovii": [0, 10, 140, 205, 247, 289], "neteri": [0, 10, 140, 205, 247, 289], "megamona": [0, 10, 140, 205, 247, 289], "hypermegal": [0, 10, 140, 205, 247, 289], "1672": [0, 10, 140, 205, 247, 289], "rustigianii": [0, 10, 140, 205, 247, 289], "4541": [0, 10, 140, 205, 247, 289], "trabulsiella": [0, 10, 140, 205, 247, 289], "guamensi": [0, 10, 140, 205, 247, 289], "49490": [0, 10, 140, 205, 247, 289], "yokenella": [0, 10, 140, 205, 247, 289], "regensburgei": [0, 10, 140, 205, 247, 289], "43003": [0, 10, 140, 205, 247, 289], "collimona": [0, 10, 140, 205, 247, 289], "fungivoran": [0, 10, 140, 205, 247, 289], "ter331": [0, 10, 140, 205, 247, 289], "roseibacterium": [0, 10, 140, 205, 247, 289], "elongatum": [0, 10, 140, 205, 247, 289], "19469": [0, 10, 140, 205, 247, 289], "embleya": [0, 10, 140, 205, 247, 289], "scabrispora": [0, 10, 140, 205, 247, 289], "41855": [0, 10, 140, 205, 247, 289], "hpl": [0, 10, 140, 205, 247, 289], "003": [0, 10, 140, 205, 247, 289], "oceanica": [0, 10, 140, 205, 247, 289], "gubbeenens": [0, 10, 140, 205, 247, 289], "15944": [0, 10, 140, 205, 247, 289], "nanoarchaeum": [0, 10, 140, 205, 247, 289], "equitan": [0, 10, 140, 205, 247, 289], "kin4": [0, 10, 140, 205, 247, 289], "ignicoccu": [0, 10, 140, 205, 247, 289], "hospitali": [0, 10, 140, 205, 247, 289], "19264": [0, 10, 140, 205, 247, 289], "350": [0, 10, 140, 205, 247, 289], "351": [0, 10, 140, 205, 247, 289], "wittichii": [0, 10, 140, 205, 247, 289], "rw1": [0, 10, 140, 205, 247, 289], "ferrivoran": [0, 10, 140, 205, 247, 289], "ss3": [0, 10, 140, 205, 247, 289], "auricularia": [0, 10, 140, 205, 247, 289], "delicata": [0, 10, 140, 205, 247, 289], "hydrogeniphilum": [0, 10, 140, 205, 247, 289], "planococcu": [0, 10, 140, 205, 247, 289], "14505": [0, 10, 140, 205, 247, 289], "anaeromyxobact": [0, 10, 140, 205, 247, 289], "2cp": [0, 10, 140, 205, 247, 289], "sd": [0, 10, 140, 205, 247, 289], "kroppenstedtii": [0, 10, 140, 205, 247, 289], "44385": [0, 10, 140, 205, 247, 289], "lipophiloflavum": [0, 10, 140, 205, 247, 289], "44291": [0, 10, 140, 205, 247, 289], "mastitidi": [0, 10, 140, 205, 247, 289], "44356": [0, 10, 140, 205, 247, 289], "camporealensi": [0, 10, 140, 205, 247, 289], "singular": [0, 10, 140, 205, 247, 289], "beta": [0, 5, 10, 140, 205, 247, 289], "a4": [0, 10, 140, 205, 247, 289], "cleftensi": [0, 10, 140, 205, 247, 289], "mossii": [0, 10, 140, 205, 247, 289], "22836": [0, 10, 140, 205, 247, 289], "sagamiensi": [0, 10, 140, 205, 247, 289], "14643": [0, 10, 140, 205, 247, 289], "7108": [0, 10, 140, 205, 247, 289], "fuchuensi": [0, 10, 140, 205, 247, 289], "14340": [0, 10, 140, 205, 247, 289], "11249": [0, 10, 140, 205, 247, 289], "vulcanisaeta": [0, 10, 140, 205, 247, 289], "distributa": [0, 10, 140, 205, 247, 289], "14429": [0, 10, 140, 205, 247, 289], "cryptocercu": [0, 10, 140, 205, 247, 289], "punctulatu": [0, 10, 140, 205, 247, 289], "cpu": [0, 10, 140, 205, 247, 289], "taiwanensi": [0, 10, 140, 205, 247, 289], "19424": [0, 10, 140, 205, 247, 289], "mc": [0, 10, 140, 205, 247, 289], "15510": [0, 10, 140, 205, 247, 289], "copri": [0, 10, 140, 205, 247, 289], "18205": [0, 10, 140, 205, 247, 289], "schoenbuchensi": [0, 10, 140, 205, 247, 289], "m07a": [0, 10, 140, 205, 247, 289], "8109": [0, 10, 140, 205, 247, 289], "8016": [0, 10, 140, 205, 247, 289], "roseburia": [0, 10, 140, 205, 247, 289], "thermobaculum": [0, 10, 140, 205, 247, 289], "terrenum": [0, 10, 140, 205, 247, 289], "798": [0, 10, 140, 205, 247, 289], "translucida": [0, 10, 140, 205, 247, 289], "tac125": [0, 10, 140, 205, 247, 289], "allofusti": [0, 10, 140, 205, 247, 289], "semini": [0, 10, 140, 205, 247, 289], "15817": [0, 10, 140, 205, 247, 289], "ilyobact": [0, 10, 140, 205, 247, 289], "polytropu": [0, 10, 140, 205, 247, 289], "2926": [0, 10, 140, 205, 247, 289], "anaerolinea": [0, 10, 140, 205, 247, 289], "uni": [0, 10, 140, 205, 247, 289], "ishikawaella": [0, 10, 140, 205, 247, 289], "capsulata": [0, 10, 140, 205, 247, 289], "mpkobe": [0, 10, 140, 205, 247, 289], "marvinbryantia": [0, 10, 140, 205, 247, 289], "formatexigen": [0, 10, 140, 205, 247, 289], "14469": [0, 10, 140, 205, 247, 289], "laribact": [0, 10, 140, 205, 247, 289], "hongkongensi": [0, 10, 140, 205, 247, 289], "hlhk9": [0, 10, 140, 205, 247, 289], "salinispora": [0, 10, 140, 205, 247, 289], "tropica": [0, 10, 140, 205, 247, 289], "cnb": [0, 10, 140, 205, 247, 289], "440": [0, 10, 140, 205, 247, 289], "arenicola": [0, 10, 140, 205, 247, 289], "205": [0, 10, 140, 205, 247, 289], "drancourtii": [0, 10, 140, 205, 247, 289], "llap12": [0, 10, 140, 205, 247, 289], "guizhouens": [0, 10, 140, 205, 247, 289], "977": [0, 10, 140, 205, 247, 289], "gelidibact": [0, 10, 140, 205, 247, 289], "mesophilu": [0, 10, 140, 205, 247, 289], "14095": [0, 10, 140, 205, 247, 289], "tardaugen": [0, 10, 140, 205, 247, 289], "16725": [0, 10, 140, 205, 247, 289], "unda": [0, 10, 140, 205, 247, 289], "14481": [0, 10, 140, 205, 247, 289], "aurimucosum": [0, 10, 140, 205, 247, 289], "700975": [0, 10, 140, 205, 247, 289], "anaerotruncu": [0, 10, 140, 205, 247, 289], "colihomini": [0, 10, 140, 205, 247, 289], "17241": [0, 10, 140, 205, 247, 289], "saccharospirillum": [0, 10, 140, 205, 247, 289], "12546": [0, 10, 140, 205, 247, 289], "saccharobutylicum": [0, 10, 140, 205, 247, 289], "13864": [0, 10, 140, 205, 247, 289], "stellif": [0, 10, 140, 205, 247, 289], "aotearoa": [0, 10, 140, 205, 247, 289], "pettenkoferi": [0, 10, 140, 205, 247, 289], "vcu012": [0, 10, 140, 205, 247, 289], "20546": [0, 10, 140, 205, 247, 289], "kanaloa": [0, 10, 140, 205, 247, 289], "lacustri": [0, 10, 140, 205, 247, 289], "7289": [0, 10, 140, 205, 247, 289], "sulfurihydrogenibium": [0, 10, 140, 205, 247, 289], "subterraneum": [0, 10, 140, 205, 247, 289], "15120": [0, 10, 140, 205, 247, 289], "halosimplex": [0, 10, 140, 205, 247, 289], "carlsbadens": [0, 10, 140, 205, 247, 289], "1340": [0, 10, 140, 205, 247, 289], "cyno": [0, 10, 140, 205, 247, 289], "c142": [0, 10, 140, 205, 247, 289], "tistrella": [0, 10, 140, 205, 247, 289], "ka081020": [0, 10, 140, 205, 247, 289], "065": [0, 10, 140, 205, 247, 289], "michigan": [0, 10, 140, 205, 247, 289], "oceanobacillu": [0, 10, 140, 205, 247, 289], "pictura": [0, 10, 140, 205, 247, 289], "thermodesulfat": [0, 10, 140, 205, 247, 289], "15286": [0, 10, 140, 205, 247, 289], "aeria": [0, 10, 140, 205, 247, 289], "f0184": [0, 10, 140, 205, 247, 289], "miricola": [0, 10, 140, 205, 247, 289], "sibiricu": [0, 10, 140, 205, 247, 289], "mm": [0, 10, 140, 205, 247, 289], "739": [0, 10, 140, 205, 247, 289], "th": [0, 10, 140, 205, 247, 289, 323, 324, 325], "14542": [0, 10, 140, 205, 247, 289], "paraconglomeratum": [0, 10, 140, 205, 247, 289], "lc44": [0, 10, 140, 205, 247, 289], "methylobact": [0, 10, 140, 205, 247, 289], "tundripaludum": [0, 10, 140, 205, 247, 289], "sv96": [0, 10, 140, 205, 247, 289], "gemmatimona": [0, 10, 140, 205, 247, 289], "sihwensi": [0, 10, 140, 205, 247, 289], "108236": [0, 10, 140, 205, 247, 289], "ordospora": [0, 10, 140, 205, 247, 289], "colligata": [0, 10, 140, 205, 247, 289], "oc4": [0, 10, 140, 205, 247, 289], "allobaculum": [0, 10, 140, 205, 247, 289], "stercoricani": [0, 10, 140, 205, 247, 289], "13633": [0, 10, 140, 205, 247, 289], "paraffinivoran": [0, 10, 140, 205, 247, 289], "108238": [0, 10, 140, 205, 247, 289], "subterraneu": [0, 10, 140, 205, 247, 289], "13965": [0, 10, 140, 205, 247, 289], "bucero": [0, 10, 140, 205, 247, 289], "rhinocero": [0, 10, 140, 205, 247, 289], "nestor": [0, 10, 140, 205, 247, 289], "notabili": [0, 10, 140, 205, 247, 289], "agarivoran": [0, 10, 140, 205, 247, 289], "s816": [0, 10, 140, 205, 247, 289], "bassiana": [0, 10, 140, 205, 247, 289], "halocynthia": [0, 10, 140, 205, 247, 289], "14573": [0, 10, 140, 205, 247, 289], "malefermentan": [0, 10, 140, 205, 247, 289], "5705": [0, 10, 140, 205, 247, 289], "3548": [0, 10, 140, 205, 247, 289], "python": [0, 1, 2, 5, 6, 8, 9, 10, 76, 77, 140, 205, 247, 289, 324], "bivittatu": [0, 10, 140, 205, 247, 289], "coniochaeta": [0, 10, 140, 205, 247, 289], "ligniaria": [0, 10, 140, 205, 247, 289], "30616": [0, 10, 140, 205, 247, 289], "anaerophaga": [0, 10, 140, 205, 247, 289], "thermohalophila": [0, 10, 140, 205, 247, 289], "12881": [0, 10, 140, 205, 247, 289], "lettinga": [0, 10, 140, 205, 247, 289], "tmo": [0, 10, 140, 205, 247, 289], "shuttleworthia": [0, 10, 140, 205, 247, 289], "satel": [0, 10, 140, 205, 247, 289], "sch10": [0, 10, 140, 205, 247, 289], "ferriphilum": [0, 10, 140, 205, 247, 289], "ml": [0, 10, 140, 205, 247, 289], "04": [0, 6, 10, 140, 205, 247, 289], "microcarpu": [0, 10, 140, 205, 247, 289], "441": [0, 10, 140, 205, 247, 289], "malorum": [0, 10, 140, 205, 247, 289], "colicani": [0, 10, 140, 205, 247, 289], "209318": [0, 10, 140, 205, 247, 289], "alicycliphilu": [0, 10, 140, 205, 247, 289], "k601": [0, 10, 140, 205, 247, 289], "culicoid": [0, 10, 140, 205, 247, 289], "elodea": [0, 10, 140, 205, 247, 289], "31461": [0, 10, 140, 205, 247, 289], "rhizopogon": [0, 10, 140, 205, 247, 289], "vesiculosu": [0, 10, 140, 205, 247, 289], "7001": [0, 10, 140, 205, 247, 289], "robinsoniella": [0, 10, 140, 205, 247, 289], "peoriensi": [0, 10, 140, 205, 247, 289], "salinisphaera": [0, 10, 140, 205, 247, 289], "shabanensi": [0, 10, 140, 205, 247, 289], "e1l3a": [0, 10, 140, 205, 247, 289], "proteocatella": [0, 10, 140, 205, 247, 289], "sphenisci": [0, 10, 140, 205, 247, 289], "23131": [0, 10, 140, 205, 247, 289], "pleistocenium": [0, 10, 140, 205, 247, 289], "ftr1": [0, 10, 140, 205, 247, 289], "pseudopodoc": [0, 10, 140, 205, 247, 289], "humili": [0, 10, 140, 205, 247, 289], "calidifonti": [0, 10, 140, 205, 247, 289], "11548": [0, 10, 140, 205, 247, 289], "cardiffensi": [0, 10, 140, 205, 247, 289], "f0333": [0, 10, 140, 205, 247, 289], "cyanoderma": [0, 10, 140, 205, 247, 289], "oleovoran": [0, 10, 140, 205, 247, 289], "hxd3": [0, 10, 140, 205, 247, 289], "coleohomini": [0, 10, 140, 205, 247, 289], "101": [0, 10, 140, 168, 205, 247, 289], "pseudodesulfovibrio": [0, 10, 140, 205, 247, 289], "aespoeensi": [0, 10, 140, 205, 247, 289], "aspo": [0, 10, 140, 205, 247, 289], "billingia": [0, 10, 140, 205, 247, 289], "eb661": [0, 10, 140, 205, 247, 289], "rubritepida": [0, 10, 140, 205, 247, 289], "flocculan": [0, 10, 140, 205, 247, 289], "14296": [0, 10, 140, 205, 247, 289], "kribbella": [0, 10, 140, 205, 247, 289], "flavida": [0, 10, 140, 205, 247, 289], "17836": [0, 10, 140, 205, 247, 289], "iheyensi": [0, 10, 140, 205, 247, 289], "hte831": [0, 10, 140, 205, 247, 289], "stemphylium": [0, 10, 140, 205, 247, 289], "lycopersici": [0, 10, 140, 205, 247, 289], "nitzschia": [0, 10, 140, 205, 247, 289], "multistriata": [0, 10, 140, 205, 247, 289], "5447": [0, 10, 140, 205, 247, 289], "vaccimaxilla": [0, 10, 140, 205, 247, 289], "15804": [0, 10, 140, 205, 247, 289], "thermodesulfobium": [0, 10, 140, 205, 247, 289], "narugens": [0, 10, 140, 205, 247, 289], "14796": [0, 10, 140, 205, 247, 289], "uzoniensi": [0, 10, 140, 205, 247, 289], "768": [0, 10, 140, 205, 247, 289], "crocinitomix": [0, 10, 140, 205, 247, 289], "catalasitica": [0, 10, 140, 205, 247, 289], "23190": [0, 10, 140, 205, 247, 289], "varibaculum": [0, 10, 140, 205, 247, 289], "cambriens": [0, 10, 140, 205, 247, 289], "dora_20": [0, 10, 140, 205, 247, 289], "subterranea": [0, 10, 140, 205, 247, 289], "19937": [0, 10, 140, 205, 247, 289], "corallococcu": [0, 10, 140, 205, 247, 289], "coralloid": [0, 10, 140, 205, 247, 289], "2259": [0, 10, 140, 168, 205, 247, 289], "magneticu": [0, 10, 140, 205, 247, 289], "17970": [0, 10, 140, 205, 247, 289], "paludiviven": [0, 10, 140, 205, 247, 289], "17968": [0, 10, 140, 205, 247, 289], "13650": [0, 10, 140, 205, 247, 289], "paludibact": [0, 10, 140, 205, 247, 289], "propionicigen": [0, 10, 140, 205, 247, 289], "wb4": [0, 10, 140, 205, 247, 289], "chrysochlori": [0, 10, 140, 205, 247, 289], "fragilariopsi": [0, 10, 140, 205, 247, 289], "cylindru": [0, 10, 140, 205, 247, 289], "ccmp1102": [0, 10, 140, 205, 247, 289], "xylanimona": [0, 10, 140, 205, 247, 289], "cellulosilytica": [0, 10, 140, 205, 247, 289], "15894": [0, 10, 140, 205, 247, 289], "marinithermu": [0, 10, 140, 205, 247, 289], "hydrothermali": [0, 10, 140, 205, 247, 289], "14884": [0, 10, 140, 205, 247, 289], "baumannia": [0, 10, 140, 205, 247, 289], "cicadellinicola": [0, 10, 140, 205, 247, 289], "washoeensi": [0, 10, 140, 205, 247, 289], "sb944nv": [0, 10, 140, 205, 247, 289], "14787": [0, 10, 140, 205, 247, 289], "sneathia": [0, 10, 140, 205, 247, 289], "amnii": [0, 10, 140, 205, 247, 289], "oceanithermu": [0, 10, 140, 205, 247, 289], "14977": [0, 10, 140, 205, 247, 289], "caldithrix": [0, 10, 140, 205, 247, 289], "13497": [0, 10, 140, 205, 247, 289], "labrenzia": [0, 10, 140, 205, 247, 289], "aggregata": [0, 10, 140, 205, 247, 289], "12614": [0, 10, 140, 205, 247, 289], "micronuciformi": [0, 10, 140, 205, 247, 289], "f0359": [0, 10, 140, 205, 247, 289], "intestini": [0, 10, 140, 205, 247, 289], "ryc": [0, 10, 140, 205, 247, 289], "mr95": [0, 10, 140, 205, 247, 289], "montpellierensi": [0, 10, 140, 205, 247, 289], "dnf00314": [0, 10, 140, 205, 247, 289], "chlamydoti": [0, 10, 140, 205, 247, 289], "macqueenii": [0, 10, 140, 205, 247, 289], "zeaxanthinifacien": [0, 10, 140, 205, 247, 289], "21588": [0, 10, 140, 205, 247, 289], "claussenii": [0, 10, 140, 205, 247, 289], "344": [0, 10, 140, 166, 205, 247, 289], "thalassolituu": [0, 10, 140, 205, 247, 289], "oleivoran": [0, 10, 140, 205, 247, 289], "mil": [0, 10, 140, 205, 247, 289], "gammatoleran": [0, 10, 140, 205, 247, 289], "ej3": [0, 10, 140, 205, 247, 289], "jalaludinii": [0, 10, 140, 205, 247, 289], "13811": [0, 10, 140, 205, 247, 289], "ff": [0, 10, 140, 205, 247, 289], "leptosomu": [0, 10, 140, 205, 247, 289], "discolor": [0, 10, 140, 205, 247, 289], "egretta": [0, 10, 140, 205, 247, 289], "garzetta": [0, 10, 140, 205, 247, 289], "ellin185": [0, 10, 140, 205, 247, 289], "oleispira": [0, 10, 140, 205, 247, 289], "antarctica": [0, 10, 140, 205, 247, 289], "rb": [0, 10, 140, 205, 247, 289], "cetobacterium": [0, 10, 140, 205, 247, 289], "somera": [0, 10, 140, 205, 247, 289], "474": [0, 10, 140, 205, 247, 289], "tremblaya": [0, 10, 140, 205, 247, 289], "pcit": [0, 10, 140, 205, 247, 289], "odorif": [0, 10, 140, 205, 247, 289], "elgii": [0, 10, 140, 205, 247, 289], "b69": [0, 10, 140, 205, 247, 289], "marshii": [0, 10, 140, 205, 247, 289], "16973": [0, 10, 140, 205, 247, 289], "13450": [0, 10, 140, 205, 247, 289], "mican": [0, 10, 140, 205, 247, 289], "f0438": [0, 10, 140, 205, 247, 289], "ec3": [0, 10, 140, 205, 247, 289], "urinal": [0, 10, 140, 205, 247, 289], "15805": [0, 10, 140, 205, 247, 289], "os145": [0, 10, 140, 205, 247, 289], "coralliilyticu": [0, 10, 140, 205, 247, 289], "450": [0, 10, 140, 205, 247, 289], "am13": [0, 10, 140, 205, 247, 289], "14728": [0, 10, 140, 205, 247, 289], "aetherivoran": [0, 10, 140, 205, 247, 289], "cm": [0, 10, 140, 205, 247, 289], "76r": [0, 10, 140, 205, 247, 289], "conexibact": [0, 10, 140, 205, 247, 289], "woesei": [0, 10, 140, 205, 247, 289], "14684": [0, 10, 140, 205, 247, 289], "epilithonimona": [0, 10, 140, 205, 247, 289], "16811": [0, 10, 140, 205, 247, 289], "fluviicola": [0, 10, 140, 205, 247, 289], "taffensi": [0, 10, 140, 205, 247, 289], "16823": [0, 10, 140, 205, 247, 289], "atypicum": [0, 10, 140, 205, 247, 289], "plesiocysti": [0, 10, 140, 205, 247, 289], "pacifica": [0, 10, 140, 205, 247, 289], "sir": [0, 10, 140, 205, 247, 289], "pardinu": [0, 10, 140, 205, 247, 289], "chthoniobact": [0, 10, 140, 205, 247, 289], "ellin428": [0, 10, 140, 205, 247, 289], "os217": [0, 10, 140, 205, 247, 289], "rhodoferax": [0, 10, 140, 205, 247, 289], "ferrireducen": [0, 10, 140, 205, 247, 289], "t118": [0, 10, 140, 205, 247, 289], "capsaspora": [0, 10, 140, 205, 247, 289], "owczarzaki": [0, 10, 140, 205, 247, 289], "30864": [0, 10, 140, 205, 247, 289], "niveu": [0, 10, 140, 205, 247, 289], "11891": [0, 10, 140, 205, 247, 289], "versmoldensi": [0, 10, 140, 205, 247, 289], "14857": [0, 10, 140, 205, 247, 289], "3814": [0, 10, 140, 205, 247, 289], "valvarum": [0, 10, 140, 205, 247, 289], "f0432": [0, 10, 140, 205, 247, 289], "31555": [0, 10, 140, 205, 247, 289], "americanum": [0, 10, 140, 205, 247, 289], "ccgm7": [0, 10, 140, 205, 247, 289], "chroomona": [0, 10, 140, 205, 247, 289], "mesostigmatica": [0, 10, 140, 205, 247, 289], "ccmp1168": [0, 10, 140, 205, 247, 289], "haematobact": [0, 10, 140, 205, 247, 289], "massiliensi": [0, 10, 140, 205, 247, 289], "7336": [0, 10, 140, 205, 247, 289], "6312": [0, 10, 140, 205, 247, 289], "nautili": [0, 10, 140, 205, 247, 289], "gillisia": [0, 10, 140, 205, 247, 289], "limnaea": [0, 10, 140, 205, 247, 289], "15749": [0, 10, 140, 205, 247, 289], "caldimona": [0, 10, 140, 205, 247, 289], "manganoxidan": [0, 10, 140, 205, 247, 289], "369": [0, 10, 140, 205, 247, 289], "microdochium": [0, 10, 140, 205, 247, 289], "bolleyi": [0, 10, 140, 205, 247, 289], "js614": [0, 10, 140, 205, 247, 289], "caballeronia": [0, 10, 140, 205, 247, 289], "sordidicola": [0, 10, 140, 205, 247, 289], "ai1a": [0, 10, 140, 205, 247, 289], "porphyrobact": [0, 10, 140, 205, 247, 289], "cryptu": [0, 10, 140, 205, 247, 289], "12079": [0, 10, 140, 205, 247, 289], "friuliensi": [0, 10, 140, 205, 247, 289], "7358": [0, 10, 140, 205, 247, 289], "deferribact": [0, 10, 140, 205, 247, 289], "ssm1": [0, 10, 140, 205, 247, 289], "alkanindig": [0, 10, 140, 205, 247, 289], "illinoisensi": [0, 10, 140, 205, 247, 289], "15370": [0, 10, 140, 205, 247, 289], "paraglaciecola": [0, 10, 140, 205, 247, 289], "mesophila": [0, 10, 140, 205, 247, 289], "kmm": [0, 10, 140, 205, 247, 289], "241": [0, 10, 140, 205, 247, 289, 323, 324, 325], "tropicu": [0, 10, 140, 205, 247, 289], "15496": [0, 10, 140, 205, 247, 289], "11116": [0, 10, 140, 205, 247, 289], "43144": [0, 10, 140, 205, 247, 289], "pelagibact": [0, 10, 140, 205, 247, 289], "ubiqu": [0, 10, 140, 205, 247, 289], "htcc7217": [0, 10, 140, 205, 247, 289], "gonensi": [0, 10, 140, 205, 247, 289], "verruculosu": [0, 10, 140, 205, 247, 289], "kirkii": [0, 10, 140, 205, 247, 289], "uzhbot1": [0, 10, 140, 205, 247, 289], "posadasii": [0, 10, 140, 205, 247, 289], "rmscc": [0, 10, 140, 205, 247, 289], "3488": [0, 10, 140, 205, 247, 289], "paraoxydan": [0, 10, 140, 205, 247, 289], "77mftsu3": [0, 10, 140, 205, 247, 289], "methylocella": [0, 10, 140, 205, 247, 289], "epiroticu": [0, 10, 140, 205, 247, 289], "obtusifolia": [0, 10, 140, 205, 247, 289], "caldisphaera": [0, 10, 140, 205, 247, 289], "lagunensi": [0, 10, 140, 205, 247, 289], "15908": [0, 10, 140, 205, 247, 289], "re": [0, 1, 2, 7, 9, 10, 140, 205, 247, 289, 323, 325], "odysseyi": [0, 10, 140, 205, 247, 289], "34h": [0, 10, 140, 205, 247, 289], "100172": [0, 10, 140, 205, 247, 289], "jaapia": [0, 10, 140, 205, 247, 289], "argillacea": [0, 10, 140, 205, 247, 289], "mucl": [0, 10, 140, 205, 247, 289], "33604": [0, 10, 140, 205, 247, 289], "punctularia": [0, 10, 140, 205, 247, 289], "strigosozonata": [0, 10, 140, 205, 247, 289], "16294": [0, 10, 140, 205, 247, 289], "actinobaculum": [0, 10, 140, 205, 247, 289], "massiliens": [0, 10, 140, 205, 247, 289], "171": [0, 10, 140, 205, 247, 289], "col2": [0, 10, 140, 205, 247, 289], "baylyi": [0, 10, 140, 205, 247, 289], "adp1": [0, 10, 140, 205, 247, 289], "bouvetii": [0, 10, 140, 205, 247, 289], "14964": [0, 10, 140, 205, 247, 289], "107468": [0, 10, 140, 205, 247, 289], "gerneri": [0, 10, 140, 205, 247, 289], "tandoii": [0, 10, 140, 205, 247, 289], "tjernbergia": [0, 10, 140, 205, 247, 289], "towneri": [0, 10, 140, 205, 247, 289], "tepidiphilu": [0, 10, 140, 205, 247, 289], "margaritif": [0, 10, 140, 205, 247, 289], "15129": [0, 10, 140, 205, 247, 289], "longispora": [0, 10, 140, 205, 247, 289], "44784": [0, 10, 140, 205, 247, 289], "melampsora": [0, 10, 140, 205, 247, 289], "larici": [0, 10, 140, 205, 247, 289], "populina": [0, 10, 140, 205, 247, 289], "98ag31": [0, 10, 140, 205, 247, 289], "dadantii": [0, 10, 140, 205, 247, 289], "3937": [0, 10, 140, 205, 247, 289], "ech586": [0, 10, 140, 205, 247, 289], "pomorum": [0, 10, 140, 205, 247, 289], "14955": [0, 10, 140, 205, 247, 289], "b84634": [0, 10, 140, 205, 247, 289], "timon": [0, 10, 140, 205, 247, 289], "84634": [0, 10, 140, 205, 247, 289], "17679": [0, 10, 140, 205, 247, 289], "13223": [0, 10, 140, 205, 247, 289], "roseomona": [0, 10, 140, 205, 247, 289], "cervicali": [0, 10, 140, 205, 247, 289], "49957": [0, 10, 140, 205, 247, 289], "herminiimona": [0, 10, 140, 205, 247, 289], "arsenicoxydan": [0, 10, 140, 205, 247, 289], "nitratireductor": [0, 10, 140, 205, 247, 289], "aquibiodomu": [0, 10, 140, 205, 247, 289], "nl21": [0, 10, 140, 205, 247, 289], "21793": [0, 10, 140, 205, 247, 289], "pentaromativoran": [0, 10, 140, 205, 247, 289], "us6": [0, 10, 140, 205, 247, 289], "gymnopu": [0, 10, 140, 205, 247, 289], "luxurian": [0, 10, 140, 205, 247, 289], "317": [0, 10, 140, 205, 247, 289], "sulfurovum": [0, 10, 140, 205, 247, 289], "lithotrophicum": [0, 10, 140, 205, 247, 289], "bermanella": [0, 10, 140, 205, 247, 289], "marisrubri": [0, 10, 140, 205, 247, 289], "neptuniibact": [0, 10, 140, 205, 247, 289], "caesariensi": [0, 10, 140, 205, 247, 289], "parvularcula": [0, 10, 140, 205, 247, 289], "bermudensi": [0, 10, 140, 205, 247, 289], "htcc2503": [0, 10, 140, 205, 247, 289], "metalliredigen": [0, 10, 140, 205, 247, 289], "qymf": [0, 10, 140, 205, 247, 289], "triticina": [0, 10, 140, 205, 247, 289], "bbbd": [0, 10, 140, 205, 247, 289], "race": [0, 10, 140, 205, 247, 289], "balhimycina": [0, 10, 140, 205, 247, 289], "fh": [0, 10, 140, 205, 247, 289], "1894": [0, 10, 140, 205, 247, 289], "vancoresmycina": [0, 10, 140, 205, 247, 289], "coatneyi": [0, 10, 140, 205, 247, 289], "fomitiporia": [0, 10, 140, 205, 247, 289], "albertii": [0, 10, 140, 205, 247, 289], "kf1": [0, 10, 140, 205, 247, 289], "niigatensi": [0, 10, 140, 205, 247, 289], "100131": [0, 10, 140, 205, 247, 289], "haemominutum": [0, 10, 140, 205, 247, 289], "birmingham": [0, 10, 140, 205, 247, 289], "sm19": [0, 10, 140, 205, 247, 289], "afifella": [0, 10, 140, 205, 247, 289], "pfennigii": [0, 10, 140, 205, 247, 289], "17143": [0, 10, 140, 205, 247, 289], "corchoru": [0, 10, 140, 205, 247, 289], "capsulari": [0, 10, 140, 205, 247, 289], "nymphaea": [0, 10, 140, 205, 247, 289], "colorata": [0, 10, 140, 205, 247, 289], "thiorhodococcu": [0, 10, 140, 205, 247, 289], "drewsii": [0, 10, 140, 205, 247, 289], "az1": [0, 10, 140, 205, 247, 289], "sandarakinorhabdu": [0, 10, 140, 205, 247, 289], "17366": [0, 10, 140, 205, 247, 289], "opuntia": [0, 10, 140, 205, 247, 289], "allokutzneria": [0, 10, 140, 205, 247, 289], "albata": [0, 10, 140, 205, 247, 289], "kuhnia": [0, 10, 140, 205, 247, 289], "17694": [0, 10, 140, 205, 247, 289], "637": [0, 10, 140, 205, 247, 289], "js623": [0, 10, 140, 205, 247, 289], "campaniensi": [0, 10, 140, 205, 247, 289], "waksmanii": [0, 10, 140, 205, 247, 289], "643": [0, 10, 140, 205, 247, 289], "subdoligranulum": [0, 10, 140, 205, 247, 289], "15176": [0, 10, 140, 205, 247, 289], "anaerofusti": [0, 10, 140, 205, 247, 289], "stercorihomini": [0, 10, 140, 205, 247, 289], "17244": [0, 10, 140, 205, 247, 289], "finegoldii": [0, 10, 140, 205, 247, 289], "17242": [0, 10, 140, 205, 247, 289], "rhaeticu": [0, 10, 140, 205, 247, 289], "af1": [0, 10, 140, 205, 247, 289], "oligosperma": [0, 10, 140, 205, 247, 289], "acaromyc": [0, 10, 140, 205, 247, 289], "ingoldii": [0, 10, 140, 205, 247, 289], "caldarium": [0, 10, 140, 205, 247, 289], "7334": [0, 10, 140, 205, 247, 289], "ejp617": [0, 10, 140, 205, 247, 289], "thermomona": [0, 10, 140, 205, 247, 289], "15424": [0, 10, 140, 205, 247, 289], "roseovariu": [0, 10, 140, 205, 247, 289], "17069": [0, 10, 140, 205, 247, 289], "enhygromyxa": [0, 10, 140, 205, 247, 289], "dinoroseobact": [0, 10, 140, 205, 247, 289], "shiba": [0, 10, 140, 205, 247, 289], "dfl": [0, 10, 140, 205, 247, 289], "16493": [0, 10, 140, 205, 247, 289], "rhizosphaera": [0, 10, 140, 205, 247, 289], "polaromona": [0, 10, 140, 205, 247, 289], "naphthalenivoran": [0, 10, 140, 205, 247, 289], "cj2": [0, 10, 140, 205, 247, 289], "ncc2705": [0, 10, 140, 205, 247, 289], "chrysopicola": [0, 10, 140, 205, 247, 289], "culicicola": [0, 10, 140, 205, 247, 289], "ae": [0, 10, 140, 205, 247, 289], "diminutum": [0, 10, 140, 205, 247, 289], "cua": [0, 10, 140, 205, 247, 289], "sabaudiens": [0, 10, 140, 205, 247, 289], "1343": [0, 10, 140, 205, 247, 289], "syrphidicola": [0, 10, 140, 205, 247, 289], "ea": [0, 10, 140, 205, 247, 289], "carboxidivoran": [0, 10, 140, 205, 247, 289], "microvirga": [0, 10, 140, 205, 247, 289], "817": [0, 10, 140, 205, 247, 289], "insular": [0, 10, 140, 205, 247, 289], "21763": [0, 10, 140, 205, 247, 289], "neomegalonema": [0, 10, 140, 205, 247, 289], "perideroed": [0, 10, 140, 205, 247, 289], "15528": [0, 10, 140, 205, 247, 289], "fulvimarina": [0, 10, 140, 205, 247, 289], "pelagi": [0, 10, 140, 205, 247, 289], "htcc2506": [0, 10, 140, 205, 247, 289], "anoplophora": [0, 10, 140, 205, 247, 289], "glabripenni": [0, 10, 140, 205, 247, 289], "psychraerophilum": [0, 10, 140, 205, 247, 289], "vietnamensi": [0, 10, 140, 205, 247, 289], "dialist": [0, 10, 140, 205, 247, 289], "invisu": [0, 10, 140, 205, 247, 289], "15470": [0, 10, 140, 205, 247, 289], "aquilegia": [0, 10, 140, 205, 247, 289], "coerulea": [0, 10, 140, 205, 247, 289], "ay4": [0, 10, 140, 205, 247, 289], "39149": [0, 10, 140, 205, 247, 289], "aeromicrobium": [0, 10, 140, 205, 247, 289], "15272": [0, 10, 140, 205, 247, 289], "rhodanobact": [0, 10, 140, 205, 247, 289], "jip2": [0, 10, 140, 205, 247, 289], "gemmobact": [0, 10, 140, 205, 247, 289], "nectariphilu": [0, 10, 140, 205, 247, 289], "15620": [0, 10, 140, 205, 247, 289], "bathymodiolu": [0, 10, 140, 205, 247, 289], "platifron": [0, 10, 140, 205, 247, 289], "bataviensi": [0, 10, 140, 205, 247, 289], "21833": [0, 10, 140, 205, 247, 289], "vireti": [0, 10, 140, 205, 247, 289], "21834": [0, 10, 140, 205, 247, 289], "thalassospira": [0, 10, 140, 205, 247, 289], "xiamenensi": [0, 10, 140, 205, 247, 289], "17429": [0, 10, 140, 205, 247, 289], "putidum": [0, 10, 140, 205, 247, 289], "kordia": [0, 10, 140, 205, 247, 289], "algicida": [0, 10, 140, 205, 247, 289], "roreri": [0, 10, 140, 205, 247, 289], "mastigocladopsi": [0, 10, 140, 205, 247, 289], "10914": [0, 10, 140, 205, 247, 289], "rs9916": [0, 10, 140, 205, 247, 289], "rs9917": [0, 10, 140, 205, 247, 289], "polytolypa": [0, 10, 140, 205, 247, 289], "hystrici": [0, 10, 140, 205, 247, 289], "uamh7299": [0, 10, 140, 205, 247, 289], "17395": [0, 10, 140, 205, 247, 289], "elaeagni": [0, 10, 140, 205, 247, 289], "altunens": [0, 10, 140, 205, 247, 289], "phaeoacremonium": [0, 10, 140, 205, 247, 289], "lc1": [0, 10, 140, 205, 247, 289], "hymenobact": [0, 10, 140, 205, 247, 289], "norwichensi": [0, 10, 140, 205, 247, 289], "15439": [0, 10, 140, 205, 247, 289], "oxidotoleran": [0, 10, 140, 205, 247, 289], "12280": [0, 10, 140, 205, 247, 289], "populi": [0, 10, 140, 205, 247, 289], "bj001": [0, 10, 140, 205, 247, 289], "abm4": [0, 10, 140, 205, 247, 289], "pyru": [0, 10, 140, 205, 247, 289], "bretschneideri": [0, 10, 140, 205, 247, 289], "lottia": [0, 10, 140, 205, 247, 289], "bemidjiensi": [0, 10, 140, 205, 247, 289], "bem": [0, 10, 140, 205, 247, 289], "geopsychrobact": [0, 10, 140, 205, 247, 289], "electrodiphilu": [0, 10, 140, 205, 247, 289], "16401": [0, 10, 140, 205, 247, 289], "enhydrobact": [0, 10, 140, 205, 247, 289], "aerosaccu": [0, 10, 140, 205, 247, 289], "sk60": [0, 10, 140, 205, 247, 289], "70093": [0, 10, 140, 205, 247, 289], "44683": [0, 10, 140, 205, 247, 289], "pulchra": [0, 10, 140, 205, 247, 289], "davidii": [0, 10, 140, 205, 247, 289], "indolifex": [0, 10, 140, 205, 247, 289], "hel": [0, 10, 140, 205, 247, 289], "yaniella": [0, 10, 140, 205, 247, 289], "15476": [0, 10, 140, 205, 247, 289], "2301083": [0, 10, 140, 205, 247, 289], "16941": [0, 10, 140, 205, 247, 289], "2301065": [0, 10, 140, 205, 247, 289], "16942": [0, 10, 140, 205, 247, 289], "fictibacillu": [0, 10, 140, 205, 247, 289], "gelatini": [0, 10, 140, 205, 247, 289], "15865": [0, 10, 140, 205, 247, 289], "aestuariibact": [0, 10, 140, 205, 247, 289], "15300": [0, 10, 140, 205, 247, 289], "salvia": [0, 10, 140, 205, 247, 289], "miltiorrhiza": [0, 10, 140, 205, 247, 289], "algoriphagu": [0, 10, 140, 205, 247, 289], "mannitolivoran": [0, 10, 140, 205, 247, 289], "15301": [0, 10, 140, 205, 247, 289], "heilongjiangensi": [0, 10, 140, 205, 247, 289], "054": [0, 10, 140, 205, 247, 289], "grosmannia": [0, 10, 140, 205, 247, 289], "clavigera": [0, 10, 140, 205, 247, 289], "kw1407": [0, 10, 140, 205, 247, 289], "bigelowiella": [0, 10, 140, 205, 247, 289], "ciconia": [0, 10, 140, 205, 247, 289], "44920": [0, 10, 140, 205, 247, 289], "antri": [0, 10, 140, 205, 247, 289], "16041": [0, 10, 140, 205, 247, 289], "ultunensi": [0, 10, 140, 205, 247, 289], "16047": [0, 10, 140, 205, 247, 289], "154": [0, 10, 140, 205, 247, 289], "higoensi": [0, 10, 140, 205, 247, 289], "100133": [0, 10, 140, 205, 247, 289], "100136": [0, 10, 140, 205, 247, 289], "15611": [0, 10, 140, 205, 247, 289], "12083": [0, 10, 140, 205, 247, 289], "saliva": [0, 10, 140, 205, 247, 289], "15606": [0, 10, 140, 205, 247, 289], "thermovibrio": [0, 10, 140, 205, 247, 289], "ammonifican": [0, 10, 140, 205, 247, 289], "hb": [0, 10, 140, 205, 247, 289], "certesii": [0, 10, 140, 205, 247, 289], "19833": [0, 10, 140, 205, 247, 289], "frigori": [0, 10, 140, 205, 247, 289], "ps1": [0, 10, 140, 205, 247, 289], "arsenicicoccu": [0, 10, 140, 205, 247, 289], "bolidensi": [0, 10, 140, 205, 247, 289], "15745": [0, 10, 140, 205, 247, 289], "aster": [0, 10, 140, 205, 247, 289], "aywb": [0, 10, 140, 205, 247, 289], "17118": [0, 10, 140, 205, 247, 289], "lacisalsi": [0, 10, 140, 205, 247, 289], "aj5": [0, 10, 140, 205, 247, 289], "camini": [0, 10, 140, 205, 247, 289], "sy1": [0, 10, 140, 205, 247, 289], "12091": [0, 10, 140, 205, 247, 289], "methylophaga": [0, 10, 140, 205, 247, 289], "aminisulfidivoran": [0, 10, 140, 205, 247, 289], "wiggsia": [0, 10, 140, 205, 247, 289], "f0424": [0, 10, 140, 205, 247, 289], "rossia": [0, 10, 140, 205, 247, 289], "15814": [0, 10, 140, 205, 247, 289], "saccharibact": [0, 10, 140, 205, 247, 289], "floricola": [0, 10, 140, 205, 247, 289], "15669": [0, 10, 140, 205, 247, 289], "devriesei": [0, 10, 140, 205, 247, 289], "19639": [0, 10, 140, 205, 247, 289], "18378": [0, 10, 140, 205, 247, 289], "dyella": [0, 10, 140, 205, 247, 289], "carnosa": [0, 10, 140, 205, 247, 289], "hhb": [0, 10, 140, 205, 247, 289], "10118": [0, 10, 140, 205, 247, 289], "belliella": [0, 10, 140, 205, 247, 289], "15883": [0, 10, 140, 205, 247, 289], "effusibacillu": [0, 10, 140, 205, 247, 289], "pohlia": [0, 10, 140, 205, 247, 289], "22757": [0, 10, 140, 205, 247, 289], "alkaliantarctica": [0, 10, 140, 205, 247, 289], "cb0101": [0, 10, 140, 205, 247, 289], "js42": [0, 10, 140, 205, 247, 289], "dichloroeliminan": [0, 10, 140, 205, 247, 289], "21439": [0, 10, 140, 205, 247, 289], "blastocrithidii": [0, 10, 140, 205, 247, 289], "ex": [0, 7, 9, 10, 140, 205, 247, 289], "midichloria": [0, 10, 140, 205, 247, 289], "mitochondrii": [0, 10, 140, 205, 247, 289], "iricva": [0, 10, 140, 205, 247, 289], "caspium": [0, 10, 140, 205, 247, 289], "44850": [0, 10, 140, 205, 247, 289], "sm9913": [0, 10, 140, 205, 247, 289], "thiersii": [0, 10, 140, 205, 247, 289], "skay4041": [0, 10, 140, 205, 247, 289], "jiangxiensi": [0, 10, 140, 205, 247, 289], "dg881": [0, 10, 140, 205, 247, 289], "dg893": [0, 10, 140, 205, 247, 289], "diplodia": [0, 10, 140, 205, 247, 289], "corticola": [0, 10, 140, 205, 247, 289], "formosens": [0, 10, 140, 205, 247, 289], "scalindua": [0, 10, 140, 205, 247, 289], "broda": [0, 10, 140, 205, 247, 289], "kitasatoni": [0, 10, 140, 205, 247, 289], "16761": [0, 10, 140, 205, 247, 289], "1039": [0, 10, 140, 205, 247, 289], "oribacterium": [0, 10, 140, 205, 247, 289], "f0268": [0, 10, 140, 205, 247, 289], "alkylphenolica": [0, 10, 140, 205, 247, 289], "psychrotoleran": [0, 10, 140, 205, 247, 289], "l19": [0, 10, 140, 205, 247, 289], "nap1": [0, 10, 140, 205, 247, 289], "vini": [0, 10, 140, 205, 247, 289], "20605": [0, 10, 140, 205, 247, 289], "akkermansia": [0, 10, 140, 205, 247, 289], "muciniphila": [0, 10, 140, 205, 247, 289], "835": [0, 10, 140, 205, 247, 289], "valliformi": [0, 10, 140, 205, 247, 289], "45023": [0, 10, 140, 205, 247, 289], "ganjiahuensi": [0, 10, 140, 205, 247, 289], "45031": [0, 10, 140, 205, 247, 289], "parascrofulaceum": [0, 10, 140, 205, 247, 289], "614": [0, 10, 140, 205, 247, 289], "pterocl": [0, 10, 140, 205, 247, 289], "gutturali": [0, 10, 140, 205, 247, 289], "woodsholea": [0, 10, 140, 205, 247, 289], "17123": [0, 10, 140, 205, 247, 289], "dabanensi": [0, 10, 140, 205, 247, 289], "dioxanivoran": [0, 10, 140, 205, 247, 289], "cb1190": [0, 10, 140, 205, 247, 289], "crinalium": [0, 10, 140, 205, 247, 289], "epipsammum": [0, 10, 140, 205, 247, 289], "9333": [0, 10, 140, 205, 247, 289], "sueciensi": [0, 10, 140, 205, 247, 289], "17243": [0, 10, 140, 205, 247, 289], "lucimarinu": [0, 10, 140, 205, 247, 289], "cce9901": [0, 10, 140, 205, 247, 289], "xenoturbella": [0, 10, 140, 205, 247, 289], "bocki": [0, 10, 140, 205, 247, 289], "acidilobu": [0, 10, 140, 205, 247, 289], "saccharovoran": [0, 10, 140, 205, 247, 289], "345": [0, 10, 140, 205, 247, 289], "bergensi": [0, 10, 140, 205, 247, 289], "17361": [0, 10, 140, 205, 247, 289], "thiocyanodenitrifican": [0, 10, 140, 205, 247, 289], "arhd": [0, 10, 140, 205, 247, 289], "lutea": [0, 10, 140, 205, 247, 289], "methylohalobiu": [0, 10, 140, 205, 247, 289], "crimeensi": [0, 10, 140, 205, 247, 289], "10ki": [0, 10, 140, 205, 247, 289], "variicola": [0, 10, 140, 205, 247, 289], "uci": [0, 10, 140, 205, 247, 289], "thiocapsa": [0, 10, 140, 205, 247, 289], "5811": [0, 10, 140, 205, 247, 289], "paracaedimona": [0, 10, 140, 205, 247, 289], "symbiosu": [0, 10, 140, 205, 247, 289], "hoeflea": [0, 10, 140, 205, 247, 289], "phototrophica": [0, 10, 140, 205, 247, 289], "43": [0, 9, 10, 140, 205, 247, 289], "nautilia": [0, 10, 140, 205, 247, 289], "profundicola": [0, 10, 140, 205, 247, 289], "amh": [0, 10, 140, 205, 247, 289], "macauensi": [0, 10, 140, 205, 247, 289], "zfhkf": [0, 10, 140, 205, 247, 289], "ichthyophaga": [0, 10, 140, 205, 247, 289], "yoonia": [0, 10, 140, 205, 247, 289], "vestfoldensi": [0, 10, 140, 205, 247, 289], "ska53": [0, 10, 140, 205, 247, 289], "acidomyc": [0, 10, 140, 205, 247, 289], "richmondensi": [0, 10, 140, 205, 247, 289], "15952": [0, 10, 140, 205, 247, 289], "bogoriensi": [0, 10, 140, 205, 247, 289], "922": [0, 10, 140, 205, 247, 289], "equorum": [0, 10, 140, 205, 247, 289], "mu2": [0, 10, 140, 205, 247, 289], "wh2": [0, 10, 140, 205, 247, 289], "am4": [0, 10, 140, 205, 247, 289], "serinicoccu": [0, 10, 140, 205, 247, 289], "15273": [0, 10, 140, 205, 247, 289], "jettenia": [0, 10, 140, 205, 247, 289], "caeni": [0, 10, 140, 205, 247, 289], "pinatubonensi": [0, 10, 140, 205, 247, 289], "jmp134": [0, 10, 140, 205, 247, 289], "mucispirillum": [0, 10, 140, 205, 247, 289], "schaedleri": [0, 10, 140, 205, 247, 289], "asf457": [0, 10, 140, 205, 247, 289], "testacea": [0, 10, 140, 205, 247, 289], "100365": [0, 10, 140, 205, 247, 289], "coccomyxa": [0, 10, 140, 205, 247, 289], "subellipsoidea": [0, 10, 140, 205, 247, 289], "cardinium": [0, 10, 140, 205, 247, 289], "ceper1": [0, 10, 140, 205, 247, 289], "encarsia": [0, 10, 140, 205, 247, 289], "pergandiella": [0, 10, 140, 205, 247, 289], "frigen": [0, 10, 140, 205, 247, 289], "12807": [0, 10, 140, 205, 247, 289], "marmori": [0, 10, 140, 205, 247, 289], "12784": [0, 10, 140, 205, 247, 289], "vafer": [0, 10, 140, 205, 247, 289], "bvaf": [0, 10, 140, 205, 247, 289], "chromaiod": [0, 10, 140, 205, 247, 289], "640": [0, 10, 140, 205, 247, 289], "tomato": [0, 10, 140, 205, 247, 289], "dc3000": [0, 10, 140, 205, 247, 289], "oceanicola": [0, 10, 140, 205, 247, 289], "granulosu": [0, 10, 140, 205, 247, 289], "htcc2516": [0, 10, 140, 205, 247, 289], "robiginitalea": [0, 10, 140, 205, 247, 289], "biformata": [0, 10, 140, 205, 247, 289], "htcc2501": [0, 10, 140, 205, 247, 289], "ezura": [0, 10, 140, 205, 247, 289], "102218": [0, 10, 140, 205, 247, 289], "boulardii": [0, 10, 140, 205, 247, 289], "nom": [0, 10, 140, 205, 247, 289], "inval": [0, 10, 140, 205, 247, 289], "clytia": [0, 10, 140, 205, 247, 289], "hemisphaerica": [0, 10, 140, 205, 247, 289], "mahella": [0, 10, 140, 205, 247, 289], "australiensi": [0, 10, 140, 205, 247, 289], "bon": [0, 10, 140, 205, 247, 289], "phenoliruptrix": [0, 10, 140, 205, 247, 289], "br3459a": [0, 10, 140, 205, 247, 289], "natronolimnohabitan": [0, 10, 140, 205, 247, 289], "innermongolicu": [0, 10, 140, 205, 247, 289], "12255": [0, 10, 140, 205, 247, 289], "ethanoligenen": [0, 10, 140, 205, 247, 289], "harbinens": [0, 10, 140, 205, 247, 289], "yuan": [0, 10, 140, 205, 247, 289], "owenweeksia": [0, 10, 140, 205, 247, 289], "17368": [0, 10, 140, 205, 247, 289], "verruconi": [0, 10, 140, 205, 247, 289], "gallopava": [0, 10, 140, 205, 247, 289], "monophora": [0, 10, 140, 205, 247, 289], "solimona": [0, 10, 140, 205, 247, 289], "variicolori": [0, 10, 140, 205, 247, 289], "15731": [0, 10, 140, 205, 247, 289], "fordii": [0, 10, 140, 205, 247, 289], "16014": [0, 10, 140, 205, 247, 289], "108821": [0, 10, 140, 205, 247, 289], "castoreu": [0, 10, 140, 205, 247, 289], "17536": [0, 10, 140, 205, 247, 289], "paeniglutamicibact": [0, 10, 140, 205, 247, 289], "gangotriensi": [0, 10, 140, 205, 247, 289], "lz1y": [0, 10, 140, 205, 247, 289], "21996": [0, 10, 140, 205, 247, 289], "glycomyc": [0, 10, 140, 205, 247, 289], "arizonensi": [0, 10, 140, 205, 247, 289], "44726": [0, 10, 140, 205, 247, 289], "parvibaculum": [0, 10, 140, 205, 247, 289], "lavamentivoran": [0, 10, 140, 205, 247, 289], "glutamicibact": [0, 10, 140, 205, 247, 289], "arilaitensi": [0, 10, 140, 205, 247, 289], "re117": [0, 10, 140, 205, 247, 289], "gulosibact": [0, 10, 140, 205, 247, 289], "molinativorax": [0, 10, 140, 205, 247, 289], "13485": [0, 10, 140, 205, 247, 289], "lentisphaera": [0, 10, 140, 205, 247, 289], "araneosa": [0, 10, 140, 205, 247, 289], "htcc2155": [0, 10, 140, 205, 247, 289], "phyllosphaera": [0, 10, 140, 205, 247, 289], "aobensi": [0, 10, 140, 205, 247, 289], "100429": [0, 10, 140, 205, 247, 289], "concava": [0, 10, 140, 205, 247, 289], "100430": [0, 10, 140, 205, 247, 289], "pleomorphomona": [0, 10, 140, 205, 247, 289], "23070": [0, 10, 140, 205, 247, 289], "gilardii": [0, 10, 140, 205, 247, 289], "rosea": [0, 10, 140, 205, 247, 289], "691": [0, 10, 140, 205, 247, 289], "pseudopneumonia": [0, 10, 140, 205, 247, 289], "is7493": [0, 10, 140, 205, 247, 289], "arboriphila": [0, 10, 140, 205, 247, 289], "resisten": [0, 10, 140, 205, 247, 289], "45100": [0, 10, 140, 205, 247, 289], "cosmeticum": [0, 10, 140, 205, 247, 289], "anticariensi": [0, 10, 140, 205, 247, 289], "fp35": [0, 10, 140, 205, 247, 289], "16096": [0, 10, 140, 205, 247, 289], "desulfatibacillum": [0, 10, 140, 205, 247, 289], "alkenivoran": [0, 10, 140, 205, 247, 289], "ak": [0, 10, 140, 205, 247, 289], "takedensi": [0, 10, 140, 205, 247, 289], "100417": [0, 10, 140, 205, 247, 289], "aromatica": [0, 10, 140, 205, 247, 289], "rcb": [0, 10, 140, 205, 247, 289], "microbulbif": [0, 10, 140, 205, 247, 289], "agarilyticu": [0, 10, 140, 205, 247, 289], "s89": [0, 10, 140, 205, 247, 289], "insulaenigra": [0, 10, 140, 205, 247, 289], "12927": [0, 10, 140, 205, 247, 289], "is79a3": [0, 10, 140, 205, 247, 289], "intestinibact": [0, 10, 140, 205, 247, 289], "bartlettii": [0, 10, 140, 205, 247, 289], "16795": [0, 10, 140, 205, 247, 289], "phytofirman": [0, 10, 140, 205, 247, 289], "psjn": [0, 10, 140, 205, 247, 289], "liflandii": [0, 10, 140, 205, 247, 289], "128fxt": [0, 10, 140, 205, 247, 289], "cavenderia": [0, 10, 140, 205, 247, 289], "fasciculata": [0, 10, 140, 205, 247, 289], "thermosinu": [0, 10, 140, 205, 247, 289], "carboxydivoran": [0, 10, 140, 205, 247, 289], "nor1": [0, 10, 140, 205, 247, 289], "16300": [0, 10, 140, 205, 247, 289], "kangiella": [0, 10, 140, 205, 247, 289], "16069": [0, 10, 140, 205, 247, 289], "aquimarina": [0, 10, 140, 205, 247, 289], "16071": [0, 10, 140, 205, 247, 289], "daepoensi": [0, 10, 140, 205, 247, 289], "16072": [0, 10, 140, 205, 247, 289], "concretioni": [0, 10, 140, 205, 247, 289], "ko07": [0, 10, 140, 205, 247, 289], "16239": [0, 10, 140, 205, 247, 289], "110307": [0, 10, 140, 205, 247, 289], "quinghaiensi": [0, 10, 140, 205, 247, 289], "15701": [0, 10, 140, 205, 247, 289], "salipig": [0, 10, 140, 205, 247, 289], "16094": [0, 10, 140, 205, 247, 289], "pel": [0, 10, 140, 205, 247, 289], "viridibacillu": [0, 10, 140, 205, 247, 289], "arenosi": [0, 10, 140, 205, 247, 289], "r5": [0, 10, 140, 205, 247, 289], "crocosphaera": [0, 10, 140, 205, 247, 289], "watsonii": [0, 10, 140, 205, 247, 289], "8501": [0, 10, 140, 205, 247, 289], "murina": [0, 10, 140, 205, 247, 289], "ushuaiensi": [0, 10, 140, 205, 247, 289], "15871": [0, 10, 140, 205, 247, 289], "effusa": [0, 10, 140, 205, 247, 289], "100432": [0, 10, 140, 205, 247, 289], "marincola": [0, 10, 140, 205, 247, 289], "16067": [0, 10, 140, 205, 247, 289], "botryobasidium": [0, 10, 140, 205, 247, 289], "botryosum": [0, 10, 140, 205, 247, 289], "grandiflora": [0, 10, 140, 205, 247, 289], "oceanimona": [0, 10, 140, 205, 247, 289], "smirnovii": [0, 10, 140, 205, 247, 289], "equifetal": [0, 10, 140, 205, 247, 289], "29724": [0, 10, 140, 205, 247, 289], "granularum": [0, 10, 140, 205, 247, 289], "19168": [0, 10, 140, 205, 247, 289], "hippikon": [0, 10, 140, 205, 247, 289], "29725": [0, 10, 140, 205, 247, 289], "trichormu": [0, 10, 140, 205, 247, 289], "29413": [0, 10, 140, 205, 247, 289], "byssochlami": [0, 10, 140, 205, 247, 289], "spectabili": [0, 10, 140, 205, 247, 289], "No": [0, 2, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 140, 205, 247, 289, 292], "salinimona": [0, 10, 140, 205, 247, 289], "chungwhensi": [0, 10, 140, 205, 247, 289], "16280": [0, 10, 140, 205, 247, 289], "pontibacillu": [0, 10, 140, 205, 247, 289], "bh030062": [0, 10, 140, 205, 247, 289], "silanimona": [0, 10, 140, 205, 247, 289], "16282": [0, 10, 140, 205, 247, 289], "desulfurispora": [0, 10, 140, 205, 247, 289], "16022": [0, 10, 140, 205, 247, 289], "alcoholivorax": [0, 10, 140, 205, 247, 289], "16058": [0, 10, 140, 205, 247, 289], "sh": [0, 10, 140, 205, 247, 289], "tepidaman": [0, 10, 140, 205, 247, 289], "ps2": [0, 10, 140, 205, 247, 289], "methylovoru": [0, 10, 140, 205, 247, 289], "glucosetrophu": [0, 10, 140, 205, 247, 289], "sip3": [0, 10, 140, 205, 247, 289], "pseudocohnilembu": [0, 10, 140, 205, 247, 289], "persalinu": [0, 10, 140, 205, 247, 289], "gingivicani": [0, 10, 140, 205, 247, 289], "chelativoran": [0, 10, 140, 205, 247, 289], "bnc1": [0, 10, 140, 205, 247, 289], "700307": [0, 10, 140, 205, 247, 289], "thalassobact": [0, 10, 140, 205, 247, 289], "stenotrophicu": [0, 10, 140, 205, 247, 289], "granulicoccu": [0, 10, 140, 205, 247, 289], "phenolivoran": [0, 10, 140, 205, 247, 289], "17626": [0, 10, 140, 205, 247, 289], "107789": [0, 10, 140, 205, 247, 289], "15570": [0, 10, 140, 205, 247, 289], "kefiranofacien": [0, 10, 140, 205, 247, 289], "zw3": [0, 10, 140, 205, 247, 289], "wynnii": [0, 10, 140, 205, 247, 289], "nitratifractor": [0, 10, 140, 205, 247, 289], "salsugini": [0, 10, 140, 205, 247, 289], "16511": [0, 10, 140, 205, 247, 289], "marimammalium": [0, 10, 140, 205, 247, 289], "18627": [0, 10, 140, 205, 247, 289], "11697": [0, 10, 140, 205, 247, 289], "atopococcu": [0, 10, 140, 205, 247, 289], "17538": [0, 10, 140, 205, 247, 289], "rattimassiliensi": [0, 10, 140, 205, 247, 289], "elb17": [0, 10, 140, 205, 247, 289], "fangia": [0, 10, 140, 205, 247, 289], "fsc776": [0, 10, 140, 205, 247, 289], "21703": [0, 10, 140, 205, 247, 289], "alcaliphilum": [0, 10, 140, 205, 247, 289], "20z": [0, 10, 140, 205, 247, 289], "sedimini": [0, 10, 140, 205, 247, 289], "haw": [0, 10, 140, 205, 247, 289], "eb3": [0, 10, 140, 205, 247, 289], "halifaxensi": [0, 10, 140, 205, 247, 289], "eb4": [0, 10, 140, 205, 247, 289], "19726": [0, 10, 140, 205, 247, 289], "castelli": [0, 10, 140, 205, 247, 289], "16402": [0, 10, 140, 205, 247, 289], "punctiform": [0, 10, 140, 205, 247, 289], "73102": [0, 10, 140, 205, 247, 289], "olleya": [0, 10, 140, 205, 247, 289], "marilimosa": [0, 10, 140, 205, 247, 289], "cam030": [0, 10, 140, 205, 247, 289], "19115": [0, 10, 140, 205, 247, 289], "hyaloperonospora": [0, 10, 140, 205, 247, 289], "arabidopsidi": [0, 10, 140, 205, 247, 289], "bh030004": [0, 10, 140, 205, 247, 289], "16465": [0, 10, 140, 205, 247, 289], "orthopsilosi": [0, 10, 140, 205, 247, 289], "co": [0, 10, 140, 205, 247, 289], "metapsilosi": [0, 10, 140, 205, 247, 289], "sphaerochaeta": [0, 10, 140, 205, 247, 289], "coccoid": [0, 10, 140, 205, 247, 289], "17374": [0, 10, 140, 205, 247, 289], "16307": [0, 10, 140, 205, 247, 289], "ncib": [0, 10, 140, 205, 247, 289], "8327": [0, 10, 140, 205, 247, 289], "limimaricola": [0, 10, 140, 205, 247, 289], "17492": [0, 10, 140, 205, 247, 289], "opitutacea": [0, 10, 140, 205, 247, 289], "tav1": [0, 10, 140, 205, 247, 289], "acidobacteriacea": [0, 10, 140, 205, 247, 289], "taa": [0, 10, 140, 205, 247, 289], "166": [0, 10, 140, 205, 247, 289], "arena": [0, 10, 140, 205, 247, 289], "19832": [0, 10, 140, 205, 247, 289], "gramella": [0, 10, 140, 205, 247, 289], "echinicola": [0, 10, 140, 205, 247, 289], "19838": [0, 10, 140, 205, 247, 289], "novosphingopyxi": [0, 10, 140, 205, 247, 289], "baekryungensi": [0, 10, 140, 205, 247, 289], "16222": [0, 10, 140, 205, 247, 289], "agromyc": [0, 10, 140, 205, 247, 289], "16388": [0, 10, 140, 205, 247, 289], "antrostomu": [0, 10, 140, 205, 247, 289], "baichengensi": [0, 10, 140, 205, 247, 289], "90130": [0, 10, 140, 205, 247, 289], "pochonia": [0, 10, 140, 205, 247, 289], "chlamydosporia": [0, 10, 140, 205, 247, 289], "170": [0, 10, 140, 167, 205, 247, 289], "doebereinera": [0, 10, 140, 205, 247, 289], "ufla1": [0, 10, 140, 205, 247, 289], "amoebophilu": [0, 10, 140, 205, 247, 289], "5a2": [0, 10, 140, 205, 247, 289], "rozella": [0, 10, 140, 205, 247, 289], "allomyci": [0, 10, 140, 205, 247, 289], "csf55": [0, 10, 140, 205, 247, 289], "uenoni": [0, 10, 140, 205, 247, 289], "16608": [0, 10, 140, 205, 247, 289], "101359": [0, 10, 140, 205, 247, 289], "kosakonia": [0, 10, 140, 205, 247, 289], "radicincitan": [0, 10, 140, 205, 247, 289], "16656": [0, 10, 140, 205, 247, 289], "bsw20308": [0, 10, 140, 205, 247, 289], "pseudintermediu": [0, 10, 140, 205, 247, 289], "ed99": [0, 10, 140, 205, 247, 289], "stackebrandtia": [0, 10, 140, 205, 247, 289], "nassauensi": [0, 10, 140, 205, 247, 289], "44728": [0, 10, 140, 205, 247, 289], "capitella": [0, 10, 140, 205, 247, 289], "teleta": [0, 10, 140, 205, 247, 289], "phenylobacterium": [0, 10, 140, 205, 247, 289], "zucineum": [0, 10, 140, 205, 247, 289], "hlk1": [0, 10, 140, 205, 247, 289], "flavovariabili": [0, 10, 140, 205, 247, 289], "dieselolei": [0, 10, 140, 205, 247, 289], "b5": [0, 10, 140, 205, 247, 289], "thioclava": [0, 10, 140, 205, 247, 289], "10166": [0, 10, 140, 205, 247, 289], "nitrogenifigen": [0, 10, 140, 205, 247, 289], "23921": [0, 10, 140, 205, 247, 289], "23498": [0, 10, 140, 205, 247, 289], "roseochromogenu": [0, 10, 140, 205, 247, 289], "oscitan": [0, 10, 140, 205, 247, 289], "976": [0, 10, 140, 205, 247, 289], "xylophagu": [0, 10, 140, 205, 247, 289], "sviceu": [0, 10, 140, 205, 247, 289], "29083": [0, 10, 140, 205, 247, 289], "fulvoviolaceu": [0, 10, 140, 205, 247, 289], "thermolilacinu": [0, 10, 140, 205, 247, 289], "spc6": [0, 10, 140, 205, 247, 289], "lupini": [0, 10, 140, 205, 247, 289], "lupac": [0, 10, 140, 205, 247, 289], "ganghwensi": [0, 10, 140, 205, 247, 289], "17046": [0, 10, 140, 205, 247, 289], "episyrphu": [0, 10, 140, 205, 247, 289], "balteatu": [0, 10, 140, 205, 247, 289], "alkaliflexu": [0, 10, 140, 205, 247, 289], "imshenetskii": [0, 10, 140, 205, 247, 289], "15055": [0, 10, 140, 205, 247, 289], "segniliparu": [0, 10, 140, 205, 247, 289], "rotundu": [0, 10, 140, 205, 247, 289], "44985": [0, 10, 140, 205, 247, 289], "rugosu": [0, 10, 140, 205, 247, 289], "974": [0, 10, 140, 205, 247, 289], "hellea": [0, 10, 140, 205, 247, 289], "balneolensi": [0, 10, 140, 205, 247, 289], "19091": [0, 10, 140, 205, 247, 289], "haliea": [0, 10, 140, 205, 247, 289], "19537": [0, 10, 140, 205, 247, 289], "balneola": [0, 10, 140, 205, 247, 289], "17893": [0, 10, 140, 205, 247, 289], "rifamycinica": [0, 10, 140, 205, 247, 289], "btai1": [0, 10, 140, 205, 247, 289], "kordiimona": [0, 10, 140, 205, 247, 289], "gwangyangensi": [0, 10, 140, 205, 247, 289], "19435": [0, 10, 140, 205, 247, 289], "12864": [0, 10, 140, 205, 247, 289], "lychnidi": [0, 10, 140, 205, 247, 289], "dioica": [0, 10, 140, 205, 247, 289], "p1a1": [0, 10, 140, 205, 247, 289], "lamol": [0, 10, 140, 205, 247, 289], "clariflavum": [0, 10, 140, 205, 247, 289], "19732": [0, 10, 140, 205, 247, 289], "aff": [0, 10, 140, 205, 247, 289], "tub": [0, 10, 140, 205, 247, 289], "011817": [0, 10, 140, 205, 247, 289], "helcogen": [0, 10, 140, 205, 247, 289], "108": [0, 10, 140, 205, 247, 289, 324, 325], "exalbida": [0, 10, 140, 205, 247, 289], "100660": [0, 10, 140, 205, 247, 289], "occitani": [0, 10, 140, 205, 247, 289], "granuli": [0, 10, 140, 205, 247, 289], "101663": [0, 10, 140, 205, 247, 289], "fb24": [0, 10, 140, 205, 247, 289], "jannaschia": [0, 10, 140, 205, 247, 289], "ccs1": [0, 10, 140, 205, 247, 289], "aminiphilu": [0, 10, 140, 205, 247, 289], "circumscriptu": [0, 10, 140, 205, 247, 289], "16581": [0, 10, 140, 205, 247, 289], "photorhabdu": [0, 10, 140, 205, 247, 289], "asymbiotica": [0, 10, 140, 205, 247, 289], "melophagi": [0, 10, 140, 205, 247, 289], "2c": [0, 10, 140, 205, 247, 289], "salyersia": [0, 10, 140, 205, 247, 289], "wal": [0, 10, 140, 205, 247, 289], "10018": [0, 10, 140, 205, 247, 289], "18765": [0, 10, 140, 205, 247, 289], "12988": [0, 10, 140, 205, 247, 289], "nordii": [0, 10, 140, 205, 247, 289], "cl02t12c05": [0, 10, 140, 205, 247, 289], "acaricom": [0, 10, 140, 205, 247, 289], "phytoseiuli": [0, 10, 140, 205, 247, 289], "14247": [0, 10, 140, 205, 247, 289], "thermosediminibact": [0, 10, 140, 205, 247, 289], "16646": [0, 10, 140, 205, 247, 289], "tm1040": [0, 10, 140, 205, 247, 289], "dactylococcopsi": [0, 10, 140, 205, 247, 289], "8305": [0, 10, 140, 205, 247, 289], "flavonifractor": [0, 10, 140, 205, 247, 289], "plautii": [0, 10, 140, 205, 247, 289], "1_3_50afaa": [0, 10, 140, 205, 247, 289], "4400831": [0, 10, 140, 205, 247, 289], "108448": [0, 10, 140, 205, 247, 289], "49529": [0, 10, 140, 205, 247, 289], "martelella": [0, 10, 140, 205, 247, 289], "17316": [0, 10, 140, 205, 247, 289], "haloquadratum": [0, 10, 140, 205, 247, 289], "walsbyi": [0, 10, 140, 205, 247, 289], "j07hqw2": [0, 10, 140, 205, 247, 289], "cyphellophora": [0, 10, 140, 205, 247, 289], "alkalitoleran": [0, 10, 140, 205, 247, 289], "16529": [0, 10, 140, 205, 247, 289], "subbeticu": [0, 10, 140, 205, 247, 289], "16689": [0, 10, 140, 205, 247, 289], "proteiniphilum": [0, 10, 140, 205, 247, 289], "acetatigen": [0, 10, 140, 205, 247, 289], "18083": [0, 10, 140, 205, 247, 289], "rubellimicrobium": [0, 10, 140, 205, 247, 289], "16684": [0, 10, 140, 205, 247, 289], "hepatoplasma": [0, 10, 140, 205, 247, 289], "crinochetorum": [0, 10, 140, 205, 247, 289], "av": [0, 10, 140, 205, 247, 289], "commoda": [0, 10, 140, 205, 247, 289], "js666": [0, 10, 140, 205, 247, 289], "caldalkalibacillu": [0, 10, 140, 205, 247, 289], "ta2": [0, 10, 140, 205, 247, 289], "patulibact": [0, 10, 140, 205, 247, 289], "minatonensi": [0, 10, 140, 205, 247, 289], "18081": [0, 10, 140, 205, 247, 289], "ean1pec": [0, 10, 140, 205, 247, 289], "inefficax": [0, 10, 140, 205, 247, 289], "saprophytica": [0, 10, 140, 205, 247, 289], "spongia": [0, 10, 140, 205, 247, 289], "ust010723": [0, 10, 140, 205, 247, 289], "006": [0, 10, 140, 205, 247, 289], "leptotrombidium": [0, 10, 140, 205, 247, 289], "deliens": [0, 10, 140, 205, 247, 289], "adhaeribact": [0, 10, 140, 205, 247, 289], "16391": [0, 10, 140, 205, 247, 289], "toba": [0, 10, 140, 205, 247, 289], "triatoma": [0, 10, 140, 205, 247, 289], "bk": [0, 10, 140, 205, 247, 289], "fr1064": [0, 10, 140, 205, 247, 289], "meyersii": [0, 10, 140, 205, 247, 289], "8951": [0, 10, 140, 205, 247, 289], "catellicoccu": [0, 10, 140, 205, 247, 289], "m35": [0, 10, 140, 205, 247, 289], "lehensi": [0, 10, 140, 205, 247, 289], "g1": [0, 10, 140, 205, 247, 289], "methanosaeta": [0, 10, 140, 205, 247, 289], "harundinacea": [0, 10, 140, 205, 247, 289], "6ac": [0, 10, 140, 205, 247, 289], "advenella": [0, 10, 140, 205, 247, 289], "mimigardefordensi": [0, 10, 140, 205, 247, 289], "dpn7": [0, 10, 140, 205, 247, 289], "tuscaniens": [0, 10, 140, 205, 247, 289], "dnf00037": [0, 10, 140, 205, 247, 289], "kuroshimensi": [0, 10, 140, 205, 247, 289], "18393": [0, 10, 140, 205, 247, 289], "harbinensi": [0, 10, 140, 205, 247, 289], "16991": [0, 10, 140, 205, 247, 289], "catenulispora": [0, 10, 140, 205, 247, 289], "44928": [0, 10, 140, 205, 247, 289], "actinospica": [0, 10, 140, 205, 247, 289], "robinia": [0, 10, 140, 205, 247, 289], "44927": [0, 10, 140, 205, 247, 289], "endozoicomona": [0, 10, 140, 205, 247, 289], "elysicola": [0, 10, 140, 205, 247, 289], "pusillimona": [0, 10, 140, 205, 247, 289], "noertemannii": [0, 10, 140, 205, 247, 289], "bs8": [0, 10, 140, 205, 247, 289], "marinimicrobium": [0, 10, 140, 205, 247, 289], "agarilyticum": [0, 10, 140, 205, 247, 289], "16975": [0, 10, 140, 205, 247, 289], "timidu": [0, 10, 140, 205, 247, 289], "17022": [0, 10, 140, 205, 247, 289], "apodemi": [0, 10, 140, 205, 247, 289], "16634": [0, 10, 140, 205, 247, 289], "16172": [0, 10, 140, 205, 247, 289], "vrystaatens": [0, 10, 140, 205, 247, 289], "gracilibacillu": [0, 10, 140, 205, 247, 289], "boraciitoleran": [0, 10, 140, 205, 247, 289], "21714": [0, 10, 140, 205, 247, 289], "boroniphilu": [0, 10, 140, 205, 247, 289], "21738": [0, 10, 140, 205, 247, 289], "microaerophilu": [0, 10, 140, 205, 247, 289], "upii": [0, 10, 140, 205, 247, 289], "chrysiogen": [0, 10, 140, 205, 247, 289], "arsenati": [0, 10, 140, 205, 247, 289], "11915": [0, 10, 140, 205, 247, 289], "persephonella": [0, 10, 140, 205, 247, 289], "h1": [0, 10, 140, 205, 247, 289], "azorens": [0, 10, 140, 205, 247, 289], "az": [0, 10, 140, 205, 247, 289], "fu1": [0, 10, 140, 205, 247, 289], "sao": [0, 10, 140, 205, 247, 289], "paulo": [0, 10, 140, 205, 247, 289], "apachensi": [0, 10, 140, 205, 247, 289], "19763": [0, 10, 140, 205, 247, 289], "maricopensi": [0, 10, 140, 205, 247, 289], "21211": [0, 10, 140, 205, 247, 289], "pimensi": [0, 10, 140, 205, 247, 289], "21231": [0, 10, 140, 205, 247, 289], "plebeiu": [0, 10, 140, 205, 247, 289], "17135": [0, 10, 140, 205, 247, 289], "coprocola": [0, 10, 140, 205, 247, 289], "17136": [0, 10, 140, 205, 247, 289], "10003": [0, 10, 140, 205, 247, 289], "neofusicoccum": [0, 10, 140, 205, 247, 289], "multisaccharivorax": [0, 10, 140, 205, 247, 289], "17128": [0, 10, 140, 205, 247, 289], "kashmirensi": [0, 10, 140, 205, 247, 289], "w13003": [0, 10, 140, 205, 247, 289], "deserti": [0, 10, 140, 205, 247, 289], "vcd115": [0, 10, 140, 205, 247, 289], "modiolu": [0, 10, 140, 205, 247, 289], "philippinarum": [0, 10, 140, 205, 247, 289], "linnemannia": [0, 10, 140, 205, 247, 289], "ag": [0, 9, 10, 140, 205, 247, 289], "77": [0, 10, 140, 205, 247, 289, 324, 325], "100964": [0, 10, 140, 205, 247, 289], "kodakarensi": [0, 10, 140, 205, 247, 289], "kod1": [0, 10, 140, 205, 247, 289], "mimosarum": [0, 10, 140, 205, 247, 289], "23256": [0, 10, 140, 205, 247, 289], "106338": [0, 10, 140, 205, 247, 289], "gptsa100": [0, 10, 140, 205, 247, 289], "17447": [0, 10, 140, 205, 247, 289], "emticicia": [0, 10, 140, 205, 247, 289], "oligotrophica": [0, 10, 140, 205, 247, 289], "17448": [0, 10, 140, 205, 247, 289], "entomophila": [0, 10, 140, 205, 247, 289], "l48": [0, 10, 140, 205, 247, 289], "18628": [0, 10, 140, 205, 247, 289], "croceibact": [0, 10, 140, 205, 247, 289], "atlanticu": [0, 10, 140, 205, 247, 289], "htcc2559": [0, 10, 140, 205, 247, 289], "janibact": [0, 10, 140, 205, 247, 289], "htcc2649": [0, 10, 140, 205, 247, 289], "dokdonia": [0, 10, 140, 205, 247, 289], "med134": [0, 10, 140, 205, 247, 289], "med152": [0, 10, 140, 205, 247, 289], "maribact": [0, 10, 140, 205, 247, 289], "htcc2170": [0, 10, 140, 205, 247, 289], "lyngbya": [0, 10, 140, 205, 247, 289], "8106": [0, 10, 140, 205, 247, 289], "bl107": [0, 10, 140, 205, 247, 289], "14911": [0, 10, 140, 205, 247, 289], "lovleyi": [0, 10, 140, 205, 247, 289], "sz": [0, 10, 140, 205, 247, 289], "drechslerella": [0, 10, 140, 205, 247, 289], "stenobrocha": [0, 10, 140, 205, 247, 289], "248": [0, 10, 140, 205, 247, 289], "311a": [0, 10, 140, 205, 247, 289], "htcc2633": [0, 10, 140, 205, 247, 289], "pseudooceanicola": [0, 10, 140, 205, 247, 289], "batsensi": [0, 10, 140, 205, 247, 289], "htcc2597": [0, 10, 140, 205, 247, 289], "med193": [0, 10, 140, 205, 247, 289], "nubinhiben": [0, 10, 140, 205, 247, 289], "ism": [0, 10, 140, 205, 247, 289], "217": [0, 10, 140, 205, 247, 289], "ska58": [0, 10, 140, 205, 247, 289], "rhodobacteracea": [0, 10, 140, 205, 247, 289], "htcc2083": [0, 10, 140, 205, 247, 289], "med121": [0, 10, 140, 205, 247, 289], "tunicata": [0, 10, 140, 205, 247, 289], "d2": [0, 10, 140, 205, 247, 289], "psychromona": [0, 10, 140, 205, 247, 289], "cnpt3": [0, 10, 140, 205, 247, 289], "med222": [0, 10, 140, 205, 247, 289], "prolixibact": [0, 10, 140, 205, 247, 289], "bellariivoran": [0, 10, 140, 205, 247, 289], "1284": [0, 10, 140, 205, 247, 289], "mariprofundu": [0, 10, 140, 205, 247, 289], "ferrooxydan": [0, 10, 140, 205, 247, 289], "pseudoxanthomona": [0, 10, 140, 205, 247, 289], "suwonensi": [0, 10, 140, 205, 247, 289], "gallolyticu": [0, 10, 140, 205, 247, 289], "2069": [0, 10, 140, 205, 247, 289], "belgica": [0, 10, 140, 205, 247, 289], "leadbetterella": [0, 10, 140, 205, 247, 289], "byssophila": [0, 10, 140, 205, 247, 289], "17132": [0, 10, 140, 205, 247, 289], "syntrophu": [0, 10, 140, 205, 247, 289], "aciditrophicu": [0, 10, 140, 205, 247, 289], "rcc307": [0, 10, 140, 205, 247, 289], "cc9902": [0, 10, 140, 205, 247, 289], "microbispora": [0, 10, 140, 205, 247, 289], "pta": [0, 10, 140, 205, 247, 289], "5024": [0, 10, 140, 205, 247, 289], "benzoatilyticu": [0, 10, 140, 205, 247, 289], "ja2": [0, 10, 140, 205, 247, 289], "35": [0, 10, 140, 205, 247, 289], "kuraishia": [0, 10, 140, 205, 247, 289], "1240": [0, 10, 140, 205, 247, 289], "7107": [0, 10, 140, 205, 247, 289], "rufum": [0, 10, 140, 205, 247, 289], "js19b1": [0, 10, 140, 205, 247, 289], "16368": [0, 10, 140, 205, 247, 289], "sulfidigen": [0, 10, 140, 205, 247, 289], "wsm1743": [0, 10, 140, 205, 247, 289], "wsm1253": [0, 10, 140, 205, 247, 289], "wsm471": [0, 10, 140, 205, 247, 289], "nonlaben": [0, 10, 140, 205, 247, 289], "lundens": [0, 10, 140, 205, 247, 289], "17049": [0, 10, 140, 205, 247, 289], "agariphila": [0, 10, 140, 205, 247, 289], "3901": [0, 10, 140, 205, 247, 289], "soli": [0, 10, 140, 205, 247, 289], "108243": [0, 10, 140, 205, 247, 289], "eumusa": [0, 10, 140, 205, 247, 289], "ja": [0, 10, 140, 205, 247, 289], "3ab": [0, 10, 140, 205, 247, 289], "3b": [0, 10, 140, 205, 247, 289], "r28": [0, 10, 140, 205, 247, 289], "simia": [0, 10, 140, 205, 247, 289], "wheat": [0, 10, 140, 205, 247, 289], "blue": [0, 2, 10, 140, 205, 221, 247, 289, 323], "dwarf": [0, 10, 140, 205, 247, 289], "23386": [0, 10, 140, 205, 247, 289], "sharpea": [0, 10, 140, 205, 247, 289], "azabuensi": [0, 10, 140, 205, 247, 289], "18934": [0, 10, 140, 205, 247, 289], "bhc": [0, 10, 140, 205, 247, 289], "valderiana": [0, 10, 140, 205, 247, 289], "bdu": [0, 10, 140, 205, 247, 289], "20041": [0, 10, 140, 205, 247, 289], "jdr": [0, 10, 140, 205, 247, 289], "kwoniella": [0, 10, 140, 205, 247, 289], "bestiola": [0, 10, 140, 205, 247, 289], "dejecticola": [0, 10, 140, 205, 247, 289], "10117": [0, 10, 140, 205, 247, 289], "moelleriella": [0, 10, 140, 205, 247, 289], "libera": [0, 10, 140, 205, 247, 289], "2490": [0, 10, 140, 205, 247, 289], "kernovia": [0, 10, 140, 205, 247, 289], "amblyomma": [0, 10, 140, 205, 247, 289], "pseudozyma": [0, 10, 140, 205, 247, 289], "hubeiensi": [0, 10, 140, 205, 247, 289], "accumulibact": [0, 10, 140, 205, 247, 289], "phosphati": [0, 10, 140, 205, 247, 289], "clade": [0, 10, 140, 205, 247, 289], "iia": [0, 10, 140, 205, 247, 289], "crudilacti": [0, 10, 140, 205, 247, 289], "syntrophorhabdu": [0, 10, 140, 205, 247, 289], "ui": [0, 10, 140, 205, 247, 289], "dokdonensi": [0, 10, 140, 205, 247, 289], "dsw": [0, 10, 140, 205, 247, 289], "goldsteinii": [0, 10, 140, 205, 247, 289], "dnlkv18": [0, 10, 140, 205, 247, 289], "onderdonkii": [0, 10, 140, 205, 247, 289], "8169": [0, 10, 140, 205, 247, 289], "19147": [0, 10, 140, 205, 247, 289], "8301": [0, 10, 140, 205, 247, 289], "rhizoclosmatium": [0, 10, 140, 205, 247, 289], "saliperosum": [0, 10, 140, 205, 247, 289], "s13": [0, 10, 140, 205, 247, 289], "17393": [0, 10, 140, 205, 247, 289], "jejuensi": [0, 10, 140, 205, 247, 289], "nitrospira": [0, 10, 140, 205, 247, 289], "cryohalolenti": [0, 10, 140, 205, 247, 289], "kamptonema": [0, 10, 140, 205, 247, 289], "formosum": [0, 10, 140, 205, 247, 289], "6407": [0, 10, 140, 205, 247, 289], "ut26": [0, 10, 140, 205, 247, 289], "drakei": [0, 10, 140, 205, 247, 289], "vin7": [0, 10, 140, 205, 247, 289], "solibact": [0, 10, 140, 205, 247, 289], "usitatu": [0, 10, 140, 205, 247, 289], "ellin6076": [0, 10, 140, 205, 247, 289], "hamelinensi": [0, 10, 140, 205, 247, 289], "100a6": [0, 10, 140, 205, 247, 289], "truepera": [0, 10, 140, 205, 247, 289], "radiovictrix": [0, 10, 140, 205, 247, 289], "17093": [0, 10, 140, 205, 247, 289], "sibiricum": [0, 10, 140, 205, 247, 289], "hirsutella": [0, 10, 140, 205, 247, 289], "minnesotensi": [0, 10, 140, 205, 247, 289], "3608": [0, 10, 140, 205, 247, 289], "alkalihalobacillu": [0, 10, 140, 205, 247, 289], "okhensi": [0, 10, 140, 205, 247, 289], "tamura": [0, 10, 140, 205, 247, 289], "ignisphaera": [0, 10, 140, 205, 247, 289], "17230": [0, 10, 140, 205, 247, 289], "cbmb20": [0, 10, 140, 205, 247, 289], "13552": [0, 10, 140, 205, 247, 289], "thermovirga": [0, 10, 140, 205, 247, 289], "lienii": [0, 10, 140, 205, 247, 289], "17291": [0, 10, 140, 205, 247, 289], "sulcia": [0, 10, 140, 205, 247, 289], "pspu": [0, 10, 140, 205, 247, 289], "rhodonellum": [0, 10, 140, 205, 247, 289], "gcm71": [0, 10, 140, 205, 247, 289], "17998": [0, 10, 140, 205, 247, 289], "kitahara": [0, 10, 140, 205, 247, 289], "17330": [0, 10, 140, 205, 247, 289], "pyronema": [0, 10, 140, 205, 247, 289], "omphalod": [0, 10, 140, 205, 247, 289], "chlorochromatii": [0, 10, 140, 205, 247, 289], "cad3": [0, 10, 140, 205, 247, 289], "ktr9": [0, 10, 140, 205, 247, 289], "ezzemoulens": [0, 10, 140, 205, 247, 289], "17463": [0, 10, 140, 205, 247, 289], "pseudodonghicola": [0, 10, 140, 205, 247, 289], "18339": [0, 10, 140, 205, 247, 289], "17565": [0, 10, 140, 205, 247, 289], "scm1": [0, 10, 140, 205, 247, 289], "tasmaniensi": [0, 10, 140, 205, 247, 289], "et1": [0, 10, 140, 205, 247, 289], "cect": [0, 10, 140, 205, 247, 289], "3035": [0, 10, 140, 205, 247, 289], "youngia": [0, 10, 140, 205, 247, 289], "17734": [0, 10, 140, 205, 247, 289], "criblamydia": [0, 10, 140, 205, 247, 289], "sequanensi": [0, 10, 140, 205, 247, 289], "crib": [0, 10, 140, 205, 247, 289], "thiophilu": [0, 10, 140, 205, 247, 289], "17215": [0, 10, 140, 205, 247, 289], "tuberibacillu": [0, 10, 140, 205, 247, 289], "calidu": [0, 10, 140, 205, 247, 289], "17572": [0, 10, 140, 205, 247, 289], "spathaspora": [0, 10, 140, 205, 247, 289], "passalidarum": [0, 10, 140, 205, 247, 289], "27907": [0, 10, 140, 205, 247, 289], "amorphu": [0, 10, 140, 205, 247, 289], "coral": [0, 10, 140, 205, 247, 289], "19760": [0, 10, 140, 205, 247, 289], "frigidu": [0, 10, 140, 205, 247, 289], "17176": [0, 10, 140, 205, 247, 289], "ascodesmi": [0, 10, 140, 205, 247, 289], "nigrican": [0, 10, 140, 205, 247, 289], "stomati": [0, 10, 140, 205, 247, 289], "17678": [0, 10, 140, 205, 247, 289], "agrococcu": [0, 10, 140, 205, 247, 289], "lahaulensi": [0, 10, 140, 205, 247, 289], "17612": [0, 10, 140, 205, 247, 289], "methylophilacea": [0, 10, 140, 205, 247, 289], "oklahomensi": [0, 10, 140, 205, 247, 289], "onnurineu": [0, 10, 140, 205, 247, 289], "na1": [0, 10, 140, 205, 247, 289], "na2": [0, 10, 140, 205, 247, 289], "barengoltzii": [0, 10, 140, 205, 247, 289], "g22": [0, 10, 140, 205, 247, 289], "htcc2601": [0, 10, 140, 205, 247, 289], "19725": [0, 10, 140, 205, 247, 289], "744": [0, 10, 140, 205, 247, 289], "podicep": [0, 10, 140, 205, 247, 289], "pickeringii": [0, 10, 140, 205, 247, 289], "benzoatilytica": [0, 10, 140, 205, 247, 289], "gh1": [0, 10, 140, 205, 247, 289], "19836": [0, 10, 140, 205, 247, 289], "boevrei": [0, 10, 140, 205, 247, 289], "14165": [0, 10, 140, 205, 247, 289], "benevestitu": [0, 10, 140, 205, 247, 289], "16100": [0, 10, 140, 205, 247, 289], "896": [0, 10, 140, 205, 247, 289], "spathiphylli": [0, 10, 140, 205, 247, 289], "b39": [0, 10, 140, 205, 247, 289], "davaonensi": [0, 10, 140, 205, 247, 289], "4913": [0, 10, 140, 205, 247, 289], "xenobiotica": [0, 10, 140, 205, 247, 289], "th49": [0, 10, 140, 205, 247, 289], "favelukesii": [0, 10, 140, 205, 247, 289], "spironucleu": [0, 10, 140, 205, 247, 289], "desulfovirgula": [0, 10, 140, 205, 247, 289], "thermocuniculi": [0, 10, 140, 205, 247, 289], "16036": [0, 10, 140, 205, 247, 289], "zeina": [0, 10, 140, 205, 247, 289], "prwf": [0, 10, 140, 205, 247, 289], "micavibrio": [0, 10, 140, 205, 247, 289], "aeruginosavoru": [0, 10, 140, 205, 247, 289], "arl": [0, 10, 140, 205, 247, 289], "44953": [0, 10, 140, 205, 247, 289], "daejeonens": [0, 10, 140, 205, 247, 289], "17708": [0, 10, 140, 205, 247, 289], "suncheonens": [0, 10, 140, 205, 247, 289], "gh29": [0, 10, 140, 205, 247, 289], "17707": [0, 10, 140, 205, 247, 289], "azwk": [0, 10, 140, 205, 247, 289], "alkalilimnicola": [0, 10, 140, 205, 247, 289], "ehrlichii": [0, 10, 140, 205, 247, 289], "mlhe": [0, 10, 140, 205, 247, 289], "oscillibact": [0, 10, 140, 205, 247, 289], "valericigen": [0, 10, 140, 205, 247, 289], "sjm18": [0, 10, 140, 205, 247, 289], "cnt003": [0, 10, 140, 205, 247, 289], "uraniireducen": [0, 10, 140, 205, 247, 289], "rf4": [0, 10, 140, 205, 247, 289], "doucetia": [0, 10, 140, 205, 247, 289], "w3": [0, 10, 140, 205, 247, 289], "halostagnicola": [0, 10, 140, 205, 247, 289], "larsenii": [0, 10, 140, 205, 247, 289], "xh": [0, 10, 140, 205, 247, 289], "arenimona": [0, 10, 140, 205, 247, 289], "maltha": [0, 10, 140, 205, 247, 289], "cc": [0, 10, 140, 205, 247, 289], "jy": [0, 10, 140, 205, 247, 289], "niastella": [0, 10, 140, 205, 247, 289], "gr20": [0, 10, 140, 205, 247, 289], "tu6071": [0, 10, 140, 205, 247, 289], "limnoperna": [0, 10, 140, 205, 247, 289], "fortunei": [0, 10, 140, 205, 247, 289], "alloscardovia": [0, 10, 140, 205, 247, 289], "17774": [0, 10, 140, 205, 247, 289], "tsurumiens": [0, 10, 140, 205, 247, 289], "chokoriensi": [0, 10, 140, 205, 247, 289], "phocaeicola": [0, 10, 140, 205, 247, 289], "dorei": [0, 10, 140, 205, 247, 289], "parabrevi": [0, 10, 140, 205, 247, 289], "53295": [0, 10, 140, 205, 247, 289], "berteroa": [0, 10, 140, 205, 247, 289], "ingrahamii": [0, 10, 140, 205, 247, 289], "19969": [0, 10, 140, 205, 247, 289], "kks102": [0, 10, 140, 205, 247, 289], "methanoregula": [0, 10, 140, 205, 247, 289], "boonei": [0, 10, 140, 205, 247, 289], "6a8": [0, 10, 140, 205, 247, 289], "olindensi": [0, 10, 140, 205, 247, 289], "extremaustrali": [0, 10, 140, 205, 247, 289], "loihica": [0, 10, 140, 205, 247, 289], "smaragdicoccu": [0, 10, 140, 205, 247, 289], "44881": [0, 10, 140, 205, 247, 289], "103563": [0, 10, 140, 205, 247, 289], "methylotenera": [0, 10, 140, 205, 247, 289], "bryobact": [0, 10, 140, 205, 247, 289], "aggregatu": [0, 10, 140, 205, 247, 289], "mpl3": [0, 10, 140, 205, 247, 289], "zavarzinella": [0, 10, 140, 205, 247, 289], "19928": [0, 10, 140, 205, 247, 289], "schlesneria": [0, 10, 140, 205, 247, 289], "paludicola": [0, 10, 140, 205, 247, 289], "18645": [0, 10, 140, 205, 247, 289], "leeuwenhoekiella": [0, 10, 140, 205, 247, 289], "blandensi": [0, 10, 140, 205, 247, 289], "med217": [0, 10, 140, 205, 247, 289], "inulinivoran": [0, 10, 140, 205, 247, 289], "16841": [0, 10, 140, 205, 247, 289], "at1b": [0, 10, 140, 205, 247, 289], "rubritalea": [0, 10, 140, 205, 247, 289], "17716": [0, 10, 140, 205, 247, 289], "tieghemostelium": [0, 10, 140, 205, 247, 289], "lacteum": [0, 10, 140, 205, 247, 289], "pseudoporcinu": [0, 10, 140, 205, 247, 289], "spin": [0, 10, 140, 205, 247, 289], "20026": [0, 10, 140, 205, 247, 289], "phenanthrenivoran": [0, 10, 140, 205, 247, 289], "sphe3": [0, 10, 140, 205, 247, 289], "reichenbachii": [0, 10, 140, 205, 247, 289], "protochlamydia": [0, 10, 140, 205, 247, 289], "amoebophila": [0, 10, 140, 205, 247, 289], "uwe25": [0, 10, 140, 205, 247, 289], "kaistia": [0, 10, 140, 205, 247, 289], "23481": [0, 10, 140, 205, 247, 289], "stercorea": [0, 10, 140, 205, 247, 289], "18206": [0, 10, 140, 205, 247, 289], "ktedonobact": [0, 10, 140, 205, 247, 289], "racemif": [0, 10, 140, 205, 247, 289], "44963": [0, 10, 140, 205, 247, 289], "ginsengisoli": [0, 10, 140, 205, 247, 289], "la": [0, 10, 140, 205, 247, 289], "hoylei": [0, 10, 140, 205, 247, 289], "pva": [0, 10, 140, 205, 247, 289], "verminephrobact": [0, 10, 140, 205, 247, 289], "eisenia": [0, 10, 140, 205, 247, 289], "ef01": [0, 10, 140, 205, 247, 289], "granulibact": [0, 10, 140, 205, 247, 289], "bethesdensi": [0, 10, 140, 205, 247, 289], "cgdnih1": [0, 10, 140, 205, 247, 289], "endocarpon": [0, 10, 140, 205, 247, 289], "pusillum": [0, 10, 140, 205, 247, 289], "z07020": [0, 10, 140, 205, 247, 289], "futtsuensi": [0, 10, 140, 205, 247, 289], "18154": [0, 10, 140, 205, 247, 289], "17710": [0, 10, 140, 205, 247, 289], "pelosinu": [0, 10, 140, 205, 247, 289], "17108": [0, 10, 140, 205, 247, 289], "discaria": [0, 10, 140, 205, 247, 289], "belnapia": [0, 10, 140, 205, 247, 289], "moabensi": [0, 10, 140, 205, 247, 289], "16746": [0, 10, 140, 205, 247, 289], "sabina": [0, 10, 140, 205, 247, 289], "t27": [0, 10, 140, 205, 247, 289], "ruania": [0, 10, 140, 205, 247, 289], "albidiflava": [0, 10, 140, 205, 247, 289], "18029": [0, 10, 140, 205, 247, 289], "k31": [0, 10, 140, 205, 247, 289], "haladaptatu": [0, 10, 140, 205, 247, 289], "paucihalophilu": [0, 10, 140, 205, 247, 289], "dx253": [0, 10, 140, 205, 247, 289], "simili": [0, 10, 140, 205, 247, 289], "phycicoccu": [0, 10, 140, 205, 247, 289], "rhodobacteral": [0, 10, 140, 205, 247, 289], "htcc2255": [0, 10, 140, 205, 247, 289], "periplaneta": [0, 10, 140, 205, 247, 289], "bplan": [0, 10, 140, 205, 247, 289], "tarazona": [0, 10, 140, 205, 247, 289], "perlucida": [0, 10, 140, 205, 247, 289], "18276": [0, 10, 140, 205, 247, 289], "terrigena": [0, 10, 140, 205, 247, 289], "21567": [0, 10, 140, 205, 247, 289], "mesonia": [0, 10, 140, 205, 247, 289], "19841": [0, 10, 140, 205, 247, 289], "13563": [0, 10, 140, 205, 247, 289], "gallionella": [0, 10, 140, 205, 247, 289], "capsiferriforman": [0, 10, 140, 205, 247, 289], "composti": [0, 10, 140, 205, 247, 289], "tr7": [0, 10, 140, 205, 247, 289], "09": [0, 6, 10, 140, 205, 247, 289], "18010": [0, 10, 140, 205, 247, 289], "filum": [0, 10, 140, 205, 247, 289], "17961": [0, 10, 140, 205, 247, 289], "aveniformi": [0, 10, 140, 205, 247, 289], "17977": [0, 10, 140, 205, 247, 289], "typographi": [0, 10, 140, 205, 247, 289], "xylanisolven": [0, 10, 140, 205, 247, 289], "xb1a": [0, 10, 140, 205, 247, 289], "sw2": [0, 10, 140, 205, 247, 289], "7521": [0, 10, 140, 205, 247, 289], "tamia": [0, 10, 140, 205, 247, 289], "th239": [0, 10, 140, 205, 247, 289], "rivularia": [0, 10, 140, 205, 247, 289], "7116": [0, 10, 140, 205, 247, 289], "cuniculorum": [0, 10, 140, 205, 247, 289], "23162": [0, 10, 140, 205, 247, 289], "24588": [0, 10, 140, 205, 247, 289], "reinekea": [0, 10, 140, 205, 247, 289], "med297": [0, 10, 140, 205, 247, 289], "marseil": [0, 10, 140, 205, 247, 289], "nanhaiensi": [0, 10, 140, 205, 247, 289], "18065": [0, 10, 140, 205, 247, 289], "natranaerobiu": [0, 10, 140, 205, 247, 289], "wn": [0, 10, 140, 205, 247, 289], "lf": [0, 10, 140, 205, 247, 289], "haloplanu": [0, 10, 140, 205, 247, 289], "17983": [0, 10, 140, 205, 247, 289], "shandongensi": [0, 10, 140, 205, 247, 289], "45094": [0, 10, 140, 205, 247, 289], "olivibact": [0, 10, 140, 205, 247, 289], "sitiensi": [0, 10, 140, 205, 247, 289], "17696": [0, 10, 140, 205, 247, 289], "zhouia": [0, 10, 140, 205, 247, 289], "ad3": [0, 10, 140, 205, 247, 289], "barnesia": [0, 10, 140, 205, 247, 289], "18169": [0, 10, 140, 205, 247, 289], "13652": [0, 10, 140, 205, 247, 289], "salanitroni": [0, 10, 140, 205, 247, 289], "18170": [0, 10, 140, 205, 247, 289], "thermobacillu": [0, 10, 140, 205, 247, 289], "kwc4": [0, 10, 140, 205, 247, 289], "methyloversatili": [0, 10, 140, 205, 247, 289], "universali": [0, 10, 140, 205, 247, 289], "fam5": [0, 10, 140, 205, 247, 289], "19370": [0, 10, 140, 205, 247, 289], "aponinum": [0, 10, 140, 205, 247, 289], "10605": [0, 10, 140, 205, 247, 289], "bingchenggensi": [0, 10, 140, 205, 247, 289], "bcw": [0, 10, 140, 205, 247, 289], "sinaloensi": [0, 10, 140, 205, 247, 289], "21326": [0, 10, 140, 205, 247, 289], "aciduliprofundum": [0, 10, 140, 205, 247, 289], "t469": [0, 10, 140, 205, 247, 289], "21315": [0, 10, 140, 205, 247, 289], "niabella": [0, 10, 140, 205, 247, 289], "17617": [0, 10, 140, 205, 247, 289], "protegen": [0, 10, 140, 205, 247, 289], "cha0": [0, 10, 140, 205, 247, 289], "cohnella": [0, 10, 140, 205, 247, 289], "laeviribosi": [0, 10, 140, 205, 247, 289], "21336": [0, 10, 140, 205, 247, 289], "namurensi": [0, 10, 140, 205, 247, 289], "chizuka": [0, 10, 140, 205, 247, 289], "707": [0, 10, 140, 205, 247, 289], "05": [0, 6, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 140, 143, 205, 247, 289, 292], "hydrogenobaculum": [0, 10, 140, 205, 247, 289], "y04aas1": [0, 10, 140, 205, 247, 289], "thermotoleran": [0, 10, 140, 205, 247, 289], "csc17ta": [0, 10, 140, 205, 247, 289], "algiphilu": [0, 10, 140, 205, 247, 289], "dg1253": [0, 10, 140, 205, 247, 289], "verrucomicrobia": [0, 10, 140, 205, 247, 289], "dg1235": [0, 10, 140, 205, 247, 289], "jl475": [0, 10, 140, 205, 247, 289], "ornithinimicrobium": [0, 10, 140, 205, 247, 289], "pekingens": [0, 10, 140, 205, 247, 289], "21552": [0, 10, 140, 205, 247, 289], "aidingensi": [0, 10, 140, 205, 247, 289], "18341": [0, 10, 140, 205, 247, 289], "cycloclasticu": [0, 10, 140, 205, 247, 289], "p1": [0, 10, 140, 205, 247, 289], "pseudophaeobact": [0, 10, 140, 205, 247, 289], "23566": [0, 10, 140, 205, 247, 289], "thermophagu": [0, 10, 140, 205, 247, 289], "ferraria": [0, 10, 140, 205, 247, 289], "106233": [0, 10, 140, 205, 247, 289], "timonensi": [0, 10, 140, 205, 247, 289], "4401737": [0, 10, 140, 205, 247, 289], "22865": [0, 10, 140, 205, 247, 289], "15640": [0, 10, 140, 205, 247, 289], "methanobacterium": [0, 10, 140, 205, 247, 289], "arcticum": [0, 10, 140, 205, 247, 289], "ruthia": [0, 10, 140, 205, 247, 289], "magnifica": [0, 10, 140, 205, 247, 289], "calyptogena": [0, 10, 140, 205, 247, 289], "coprophilu": [0, 10, 140, 205, 247, 289], "18228": [0, 10, 140, 205, 247, 289], "13818": [0, 10, 140, 205, 247, 289], "nitratiruptor": [0, 10, 140, 205, 247, 289], "sb155": [0, 10, 140, 205, 247, 289], "nbc37": [0, 10, 140, 205, 247, 289], "halovivax": [0, 10, 140, 205, 247, 289], "halopig": [0, 10, 140, 205, 247, 289], "xanaduensi": [0, 10, 140, 205, 247, 289], "cl02t12c29": [0, 10, 140, 205, 247, 289], "amp6": [0, 10, 140, 205, 247, 289], "sulfidifacien": [0, 10, 140, 205, 247, 289], "14089": [0, 10, 140, 205, 247, 289], "htcc2150": [0, 10, 140, 205, 247, 289], "machipongonensi": [0, 10, 140, 205, 247, 289], "aust": [0, 10, 140, 205, 247, 289], "nh1": [0, 10, 140, 205, 247, 289], "sk209": [0, 10, 140, 205, 247, 289], "hydnomeruliu": [0, 10, 140, 205, 247, 289], "pinastri": [0, 10, 140, 205, 247, 289], "312": [0, 10, 140, 205, 247, 289], "chlorohalonata": [0, 10, 140, 205, 247, 289], "40285": [0, 10, 140, 205, 247, 289], "wenxinia": [0, 10, 140, 205, 247, 289], "24838": [0, 10, 140, 205, 247, 289], "farragini": [0, 10, 140, 205, 247, 289], "18382": [0, 10, 140, 205, 247, 289], "14108": [0, 10, 140, 205, 247, 289], "parafarragini": [0, 10, 140, 205, 247, 289], "f0439": [0, 10, 140, 205, 247, 289], "17526": [0, 10, 140, 205, 247, 289], "actinocatenispora": [0, 10, 140, 205, 247, 289], "sera": [0, 10, 140, 205, 247, 289], "hf": [0, 10, 140, 205, 247, 289], "gai101": [0, 10, 140, 205, 247, 289], "ccs2": [0, 10, 140, 205, 247, 289], "bal39": [0, 10, 140, 205, 247, 289], "bal38": [0, 10, 140, 205, 247, 289], "bal3": [0, 10, 140, 205, 247, 289], "ska14": [0, 10, 140, 205, 247, 289], "flavobacterial": [0, 10, 140, 205, 247, 289], "alc": [0, 10, 140, 205, 247, 289], "tm1035": [0, 10, 140, 205, 247, 289], "immib": [0, 10, 140, 205, 247, 289], "apb": [0, 10, 140, 205, 247, 289], "18482": [0, 10, 140, 205, 247, 289], "macrosporangiidu": [0, 10, 140, 205, 247, 289], "cpp55": [0, 10, 140, 205, 247, 289], "contaminan": [0, 10, 140, 205, 247, 289], "17975": [0, 10, 140, 205, 247, 289], "nodosa": [0, 10, 140, 205, 247, 289], "21604": [0, 10, 140, 205, 247, 289], "jaspsi": [0, 10, 140, 205, 247, 289], "18422": [0, 10, 140, 205, 247, 289], "misasensi": [0, 10, 140, 205, 247, 289], "22328": [0, 10, 140, 205, 247, 289], "thiooxydan": [0, 10, 140, 205, 247, 289], "dms010": [0, 10, 140, 205, 247, 289], "perlucidibaca": [0, 10, 140, 205, 247, 289], "piscina": [0, 10, 140, 205, 247, 289], "21586": [0, 10, 140, 205, 247, 289], "terriglobu": [0, 10, 140, 205, 247, 289], "18391": [0, 10, 140, 205, 247, 289], "uliginosibacterium": [0, 10, 140, 205, 247, 289], "gangwonens": [0, 10, 140, 205, 247, 289], "18521": [0, 10, 140, 205, 247, 289], "halalkalibacillu": [0, 10, 140, 205, 247, 289], "18494": [0, 10, 140, 205, 247, 289], "mesoflavibact": [0, 10, 140, 205, 247, 289], "s86": [0, 10, 140, 205, 247, 289], "19029": [0, 10, 140, 205, 247, 289], "pestalotiopsi": [0, 10, 140, 205, 247, 289], "fici": [0, 10, 140, 205, 247, 289], "congregibact": [0, 10, 140, 205, 247, 289], "kt71": [0, 10, 140, 205, 247, 289], "crevioricani": [0, 10, 140, 205, 247, 289], "bhargavaea": [0, 10, 140, 205, 247, 289], "cecembensi": [0, 10, 140, 205, 247, 289], "dse10": [0, 10, 140, 205, 247, 289], "cylindrobasidium": [0, 10, 140, 205, 247, 289], "torrendii": [0, 10, 140, 205, 247, 289], "fp15055": [0, 10, 140, 205, 247, 289], "22408": [0, 10, 140, 205, 247, 289], "coraliomargarita": [0, 10, 140, 205, 247, 289], "akajimensi": [0, 10, 140, 205, 247, 289], "45221": [0, 10, 140, 205, 247, 289], "rochalima": [0, 10, 140, 205, 247, 289], "1498": [0, 10, 140, 205, 247, 289], "cyanothec": [0, 10, 140, 205, 247, 289], "7425": [0, 10, 140, 205, 247, 289], "gilvimarinu": [0, 10, 140, 205, 247, 289], "19667": [0, 10, 140, 205, 247, 289], "phenoliresisten": [0, 10, 140, 205, 247, 289], "135680": [0, 10, 140, 205, 247, 289], "brisouii": [0, 10, 140, 205, 247, 289], "4119": [0, 10, 140, 205, 247, 289], "aestuariimicrobium": [0, 10, 140, 205, 247, 289], "kwangyangens": [0, 10, 140, 205, 247, 289], "21549": [0, 10, 140, 205, 247, 289], "k90mix": [0, 10, 140, 205, 247, 289], "hayakitensi": [0, 10, 140, 205, 247, 289], "18933": [0, 10, 140, 205, 247, 289], "14209": [0, 10, 140, 205, 247, 289], "andreprevotia": [0, 10, 140, 205, 247, 289], "chitinilytica": [0, 10, 140, 205, 247, 289], "18519": [0, 10, 140, 205, 247, 289], "sanxanigenen": [0, 10, 140, 205, 247, 289], "19645": [0, 10, 140, 205, 247, 289], "nx02": [0, 10, 140, 205, 247, 289], "marmoricola": [0, 10, 140, 205, 247, 289], "aequoreu": [0, 10, 140, 205, 247, 289], "lachnospiracea": [0, 10, 140, 205, 247, 289], "barnesiella": [0, 10, 140, 205, 247, 289], "viscericola": [0, 10, 140, 205, 247, 289], "18177": [0, 10, 140, 205, 247, 289], "segetibact": [0, 10, 140, 205, 247, 289], "18137": [0, 10, 140, 205, 247, 289], "proteiniclasticum": [0, 10, 140, 205, 247, 289], "24773": [0, 10, 140, 205, 247, 289], "agrilactobacillu": [0, 10, 140, 205, 247, 289], "18527": [0, 10, 140, 205, 247, 289], "14202": [0, 10, 140, 205, 247, 289], "gamsii": [0, 10, 140, 205, 247, 289], "zunongwangia": [0, 10, 140, 205, 247, 289], "profunda": [0, 10, 140, 205, 247, 289], "sm": [0, 10, 140, 205, 247, 289], "a87": [0, 10, 140, 205, 247, 289], "desulfocurvu": [0, 10, 140, 205, 247, 289], "vexinensi": [0, 10, 140, 205, 247, 289], "17965": [0, 10, 140, 205, 247, 289], "x514": [0, 10, 140, 205, 247, 289], "638": [0, 10, 140, 205, 247, 289], "merioni": [0, 10, 140, 205, 247, 289], "19192": [0, 10, 140, 205, 247, 289], "pontibact": [0, 10, 140, 205, 247, 289], "korlensi": [0, 10, 140, 205, 247, 289], "mwyl1": [0, 10, 140, 205, 247, 289], "amphimedon": [0, 10, 140, 205, 247, 289], "queenslandica": [0, 10, 140, 205, 247, 289], "wohlfahrtiimona": [0, 10, 140, 205, 247, 289], "chitiniclastica": [0, 10, 140, 205, 247, 289], "18708": [0, 10, 140, 205, 247, 289], "ureicelerivoran": [0, 10, 140, 205, 247, 289], "aureimona": [0, 10, 140, 205, 247, 289], "ureilytica": [0, 10, 140, 205, 247, 289], "18598": [0, 10, 140, 205, 247, 289], "106430": [0, 10, 140, 205, 247, 289], "riesia": [0, 10, 140, 205, 247, 289], "pediculicola": [0, 10, 140, 205, 247, 289], "actinomycetospora": [0, 10, 140, 205, 247, 289], "chiangmaiensi": [0, 10, 140, 205, 247, 289], "45062": [0, 10, 140, 205, 247, 289], "mucosum": [0, 10, 140, 205, 247, 289], "1512": [0, 10, 140, 205, 247, 289], "pm2": [0, 10, 140, 205, 247, 289], "sk37": [0, 10, 140, 205, 247, 289], "piezotoleran": [0, 10, 140, 205, 247, 289], "wp3": [0, 10, 140, 205, 247, 289], "maritimibact": [0, 10, 140, 205, 247, 289], "htcc2654": [0, 10, 140, 205, 247, 289], "nonomuraea": [0, 10, 140, 205, 247, 289], "coxensi": [0, 10, 140, 205, 247, 289], "45129": [0, 10, 140, 205, 247, 289], "fw109": [0, 10, 140, 205, 247, 289], "23545": [0, 10, 140, 205, 247, 289], "geminicoccu": [0, 10, 140, 205, 247, 289], "18922": [0, 10, 140, 205, 247, 289], "tc": [0, 10, 140, 205, 247, 289], "daeponensi": [0, 10, 140, 205, 247, 289], "23529": [0, 10, 140, 205, 247, 289], "m3": [0, 10, 140, 205, 247, 289], "j7": [0, 10, 140, 205, 247, 289], "astaxanthinifacien": [0, 10, 140, 205, 247, 289], "22298": [0, 10, 140, 205, 247, 289], "stegodyphu": [0, 10, 140, 205, 247, 289], "pleuritidi": [0, 10, 140, 205, 247, 289], "14110": [0, 10, 140, 205, 247, 289], "coahuilensi": [0, 10, 140, 205, 247, 289], "m4": [0, 10, 140, 205, 247, 289], "nocardioidacea": [0, 10, 140, 205, 247, 289], "broad": [0, 10, 140, 205, 247, 289], "clostridiisalibact": [0, 10, 140, 205, 247, 289], "22131": [0, 10, 140, 205, 247, 289], "pedi": [0, 10, 140, 205, 247, 289], "blastobotri": [0, 10, 140, 205, 247, 289], "adeninivoran": [0, 10, 140, 205, 247, 289], "27758": [0, 10, 140, 205, 247, 289], "malaqua": [0, 10, 140, 205, 247, 289], "108250": [0, 10, 140, 205, 247, 289], "forsetii": [0, 10, 140, 205, 247, 289], "kt0803": [0, 10, 140, 205, 247, 289], "14848": [0, 10, 140, 205, 247, 289], "ss2": [0, 10, 140, 205, 247, 289], "m62": [0, 10, 140, 205, 247, 289], "daeguens": [0, 10, 140, 205, 247, 289], "19388": [0, 10, 140, 205, 247, 289], "nuttal": [0, 10, 140, 205, 247, 289], "p19": [0, 10, 140, 205, 247, 289], "trp": [0, 10, 140, 205, 247, 289], "24470": [0, 10, 140, 205, 247, 289], "hydrothermal": [0, 10, 140, 205, 247, 289], "lam5": [0, 10, 140, 205, 247, 289], "18033": [0, 10, 140, 205, 247, 289], "mycetohabitan": [0, 10, 140, 205, 247, 289], "rhizoxinica": [0, 10, 140, 205, 247, 289], "hki": [0, 10, 140, 205, 247, 289], "454": [0, 10, 140, 205, 247, 289], "vesicomyosociu": [0, 10, 140, 205, 247, 289], "okutanii": [0, 10, 140, 205, 247, 289], "21787": [0, 10, 140, 205, 247, 289], "z3032": [0, 10, 140, 205, 247, 289], "halalkalicoccu": [0, 10, 140, 205, 247, 289], "jeotgali": [0, 10, 140, 205, 247, 289], "b3": [0, 10, 140, 205, 247, 289], "halophilum": [0, 10, 140, 205, 247, 289], "kronotskyensi": [0, 10, 140, 205, 247, 289], "2002": [0, 10, 140, 205, 247, 289], "58": [0, 10, 140, 169, 205, 247, 289], "donghaensi": [0, 10, 140, 205, 247, 289], "mpa1u2": [0, 10, 140, 205, 247, 289], "spadix": [0, 10, 140, 205, 247, 289], "bd": [0, 10, 140, 205, 247, 289], "a59": [0, 10, 140, 205, 247, 289], "18980": [0, 10, 140, 205, 247, 289], "nodosilinea": [0, 10, 140, 205, 247, 289], "nodulosa": [0, 10, 140, 205, 247, 289], "7104": [0, 10, 140, 205, 247, 289], "lcs2": [0, 10, 140, 205, 247, 289], "moolapensi": [0, 10, 140, 205, 247, 289], "kj006": [0, 10, 140, 205, 247, 289], "23594": [0, 10, 140, 205, 247, 289], "notospermu": [0, 10, 140, 205, 247, 289], "geniculatu": [0, 10, 140, 205, 247, 289], "neptunomona": [0, 10, 140, 205, 247, 289], "18939": [0, 10, 140, 205, 247, 289], "horonobensi": [0, 10, 140, 205, 247, 289], "15518": [0, 10, 140, 205, 247, 289], "wexlera": [0, 10, 140, 205, 247, 289], "19850": [0, 10, 140, 205, 247, 289], "salinicoccu": [0, 10, 140, 205, 247, 289], "19776": [0, 10, 140, 205, 247, 289], "19509": [0, 10, 140, 205, 247, 289], "cri": [0, 10, 140, 205, 247, 289], "21a": [0, 10, 140, 205, 247, 289], "omnicolen": [0, 10, 140, 205, 247, 289], "21503": [0, 10, 140, 205, 247, 289], "53443": [0, 10, 140, 205, 247, 289], "equicursori": [0, 10, 140, 205, 247, 289], "19284": [0, 10, 140, 205, 247, 289], "110162": [0, 10, 140, 205, 247, 289], "seriata": [0, 10, 140, 205, 247, 289], "methanolobu": [0, 10, 140, 205, 247, 289], "r15": [0, 10, 140, 205, 247, 289], "bryophila": [0, 10, 140, 205, 247, 289], "376mfsha3": [0, 10, 140, 205, 247, 289], "ummariens": [0, 10, 140, 205, 247, 289], "rl": [0, 10, 140, 205, 247, 289], "donghicola": [0, 10, 140, 205, 247, 289], "14565": [0, 10, 140, 205, 247, 289], "oranimens": [0, 10, 140, 205, 247, 289], "halpernia": [0, 10, 140, 205, 247, 289], "luteum": [0, 10, 140, 205, 247, 289], "stenoxybact": [0, 10, 140, 205, 247, 289], "19021": [0, 10, 140, 205, 247, 289], "mucilaginibact": [0, 10, 140, 205, 247, 289], "paludi": [0, 10, 140, 205, 247, 289], "18603": [0, 10, 140, 205, 247, 289], "basidiobolu": [0, 10, 140, 205, 247, 289], "meristosporu": [0, 10, 140, 205, 247, 289], "931": [0, 10, 140, 205, 247, 289], "elusimicrobium": [0, 10, 140, 205, 247, 289], "pei191": [0, 10, 140, 205, 247, 289], "irbg74": [0, 10, 140, 205, 247, 289], "arsenitoxydan": [0, 10, 140, 205, 247, 289], "46": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "subsaxonicum": [0, 10, 140, 205, 247, 289], "wb": [0, 10, 140, 205, 247, 289], "42": [0, 10, 140, 205, 247, 289], "21790": [0, 10, 140, 205, 247, 289], "vanfongensi": [0, 10, 140, 205, 247, 289], "17529": [0, 10, 140, 205, 247, 289], "rhamnosiphila": [0, 10, 140, 205, 247, 289], "chagannorensi": [0, 10, 140, 205, 247, 289], "18086": [0, 10, 140, 205, 247, 289], "salsuginibacillu": [0, 10, 140, 205, 247, 289], "kocurii": [0, 10, 140, 205, 247, 289], "18087": [0, 10, 140, 205, 247, 289], "humibact": [0, 10, 140, 205, 247, 289], "18994": [0, 10, 140, 205, 247, 289], "desulfurivibrio": [0, 10, 140, 205, 247, 289], "aht": [0, 10, 140, 205, 247, 289], "dethiobact": [0, 10, 140, 205, 247, 289], "dasanensi": [0, 10, 140, 205, 247, 289], "arb": [0, 10, 140, 205, 247, 289], "0140": [0, 10, 140, 205, 247, 289], "pediculischaeffi": [0, 10, 140, 205, 247, 289], "ptsu": [0, 10, 140, 205, 247, 289], "jonquetella": [0, 10, 140, 205, 247, 289], "e3_33": [0, 10, 140, 205, 247, 289], "e1": [0, 10, 140, 205, 247, 289], "dactylellina": [0, 10, 140, 205, 247, 289], "haptotyla": [0, 10, 140, 205, 247, 289], "tiamatea": [0, 10, 140, 205, 247, 289], "sarl4b": [0, 10, 140, 205, 247, 289], "baudoinia": [0, 10, 140, 205, 247, 289], "compniacensi": [0, 10, 140, 205, 247, 289], "19990": [0, 10, 140, 205, 247, 289], "spitsbergens": [0, 10, 140, 205, 247, 289], "19989": [0, 10, 140, 205, 247, 289], "ginsengihumi": [0, 10, 140, 205, 247, 289], "21568": [0, 10, 140, 205, 247, 289], "kazachstania": [0, 10, 140, 205, 247, 289], "2517": [0, 10, 140, 205, 247, 289], "peraridilitori": [0, 10, 140, 205, 247, 289], "19664": [0, 10, 140, 205, 247, 289], "19273": [0, 10, 140, 205, 247, 289], "c150": [0, 10, 140, 205, 247, 289], "fibularhizoctonia": [0, 10, 140, 205, 247, 289], "109695": [0, 10, 140, 205, 247, 289], "yo3aop1": [0, 10, 140, 205, 247, 289], "jeojiens": [0, 10, 140, 205, 247, 289], "robiginitomaculum": [0, 10, 140, 205, 247, 289], "21748": [0, 10, 140, 205, 247, 289], "uk1": [0, 10, 140, 205, 247, 289], "f23": [0, 10, 140, 205, 247, 289], "f96": [0, 10, 140, 205, 247, 289], "uk40": [0, 10, 140, 205, 247, 289], "f8": [0, 10, 140, 205, 247, 289], "f5": [0, 10, 140, 205, 247, 289], "funiformi": [0, 10, 140, 205, 247, 289], "yit": [0, 10, 140, 205, 247, 289], "11815": [0, 10, 140, 205, 247, 289], "parvirubra": [0, 10, 140, 205, 247, 289], "11816": [0, 10, 140, 205, 247, 289], "gauvreauii": [0, 10, 140, 205, 247, 289], "19829": [0, 10, 140, 205, 247, 289], "henryi": [0, 10, 140, 205, 247, 289], "19005": [0, 10, 140, 205, 247, 289], "cabal": [0, 10, 140, 205, 247, 289], "19004": [0, 10, 140, 205, 247, 289], "htcc7211": [0, 10, 140, 205, 247, 289], "pseudovibrio": [0, 10, 140, 205, 247, 289], "je062": [0, 10, 140, 205, 247, 289], "y4i": [0, 10, 140, 205, 247, 289], "r11": [0, 10, 140, 205, 247, 289], "maculosa": [0, 10, 140, 205, 247, 289], "19339": [0, 10, 140, 205, 247, 289], "15638": [0, 10, 140, 205, 247, 289], "promicromonospora": [0, 10, 140, 205, 247, 289], "19349": [0, 10, 140, 205, 247, 289], "chol1": [0, 10, 140, 205, 247, 289], "timonens": [0, 10, 140, 205, 247, 289], "5401744": [0, 10, 140, 205, 247, 289], "45435": [0, 10, 140, 205, 247, 289], "hofstenia": [0, 10, 140, 205, 247, 289], "miamia": [0, 10, 140, 205, 247, 289], "aerolata": [0, 10, 140, 205, 247, 289], "18566": [0, 10, 140, 205, 247, 289], "m18": [0, 10, 140, 205, 247, 289], "m21": [0, 10, 140, 205, 247, 289], "cp5": [0, 10, 140, 205, 247, 289], "microti": [0, 10, 140, 205, 247, 289], "ccm": [0, 10, 140, 205, 247, 289], "4915": [0, 10, 140, 205, 247, 289], "vinea": [0, 10, 140, 205, 247, 289], "21990": [0, 10, 140, 205, 247, 289], "sl153": [0, 10, 140, 205, 247, 289], "18668": [0, 10, 140, 205, 247, 289], "gryllotalpicola": [0, 10, 140, 205, 247, 289], "22003": [0, 10, 140, 205, 247, 289], "ossibalaena": [0, 10, 140, 205, 247, 289], "1528": [0, 10, 140, 205, 247, 289], "reyranella": [0, 10, 140, 205, 247, 289], "adlercreutzia": [0, 10, 140, 205, 247, 289], "equolifacien": [0, 10, 140, 205, 247, 289], "19450": [0, 10, 140, 205, 247, 289], "eudoraea": [0, 10, 140, 205, 247, 289], "adriatica": [0, 10, 140, 205, 247, 289], "19308": [0, 10, 140, 205, 247, 289], "19437": [0, 10, 140, 205, 247, 289], "gansuensi": [0, 10, 140, 205, 247, 289], "simiduia": [0, 10, 140, 205, 247, 289], "sa1": [0, 10, 140, 205, 247, 289], "21679": [0, 10, 140, 205, 247, 289], "selenitireducen": [0, 10, 140, 205, 247, 289], "1503": [0, 10, 140, 205, 247, 289], "profundi": [0, 10, 140, 205, 247, 289], "5_u_42afaa": [0, 10, 140, 205, 247, 289], "6_1_27": [0, 10, 140, 205, 247, 289], "rudanella": [0, 10, 140, 205, 247, 289], "19387": [0, 10, 140, 205, 247, 289], "luticocti": [0, 10, 140, 205, 247, 289], "19459": [0, 10, 140, 205, 247, 289], "scopuliridi": [0, 10, 140, 205, 247, 289], "rb72": [0, 10, 140, 205, 247, 289], "pseudoclavibact": [0, 10, 140, 205, 247, 289], "23366": [0, 10, 140, 205, 247, 289], "amphritea": [0, 10, 140, 205, 247, 289], "1530": [0, 10, 140, 205, 247, 289], "aerilata": [0, 10, 140, 205, 247, 289], "19363": [0, 10, 140, 205, 247, 289], "desulfarculu": [0, 10, 140, 205, 247, 289], "baarsii": [0, 10, 140, 205, 247, 289], "2075": [0, 10, 140, 205, 247, 289], "pini": [0, 10, 140, 205, 247, 289], "10737": [0, 10, 140, 205, 247, 289], "exovoru": [0, 10, 140, 205, 247, 289], "jss": [0, 10, 140, 205, 247, 289], "d43": [0, 10, 140, 205, 247, 289], "henriciella": [0, 10, 140, 205, 247, 289], "19595": [0, 10, 140, 205, 247, 289], "joostella": [0, 10, 140, 205, 247, 289], "19592": [0, 10, 140, 205, 247, 289], "23508": [0, 10, 140, 205, 247, 289], "paraprevotella": [0, 10, 140, 205, 247, 289], "clara": [0, 10, 140, 205, 247, 289], "11840": [0, 10, 140, 205, 247, 289], "xylaniphila": [0, 10, 140, 205, 247, 289], "11841": [0, 10, 140, 205, 247, 289], "kiloniella": [0, 10, 140, 205, 247, 289], "laminaria": [0, 10, 140, 205, 247, 289], "19542": [0, 10, 140, 205, 247, 289], "chthonomona": [0, 10, 140, 205, 247, 289], "calidirosea": [0, 10, 140, 205, 247, 289], "t49": [0, 10, 140, 205, 247, 289], "gracilimona": [0, 10, 140, 205, 247, 289], "19535": [0, 10, 140, 205, 247, 289], "spongiibact": [0, 10, 140, 205, 247, 289], "19543": [0, 10, 140, 205, 247, 289], "htcc2999": [0, 10, 140, 205, 247, 289], "gregarium": [0, 10, 140, 205, 247, 289], "bizionia": [0, 10, 140, 205, 247, 289], "argentinensi": [0, 10, 140, 205, 247, 289], "jub59": [0, 10, 140, 205, 247, 289], "saccharibacillu": [0, 10, 140, 205, 247, 289], "19268": [0, 10, 140, 205, 247, 289], "cloacimona": [0, 10, 140, 205, 247, 289], "evri": [0, 10, 140, 205, 247, 289], "plurextorum": [0, 10, 140, 205, 247, 289], "22810": [0, 10, 140, 205, 247, 289], "rhizoctonia": [0, 10, 140, 205, 247, 289], "solani": [0, 10, 140, 205, 247, 289], "wac10335": [0, 10, 140, 205, 247, 289], "1_1_30": [0, 10, 140, 205, 247, 289], "3_1_23": [0, 10, 140, 205, 247, 289], "3_1_33faa": [0, 10, 140, 205, 247, 289], "3_2_5": [0, 10, 140, 205, 247, 289], "4_1_36": [0, 10, 140, 205, 247, 289], "4_3_47faa": [0, 10, 140, 205, 247, 289], "9_1_42faa": [0, 10, 140, 205, 247, 289], "7_2_43faa": [0, 10, 140, 205, 247, 289], "3_1_syn3": [0, 10, 140, 205, 247, 289], "1_1_43": [0, 10, 140, 205, 247, 289], "4_1_40b": [0, 10, 140, 205, 247, 289], "3_1_31": [0, 10, 140, 205, 247, 289], "m42": [0, 10, 140, 205, 247, 289], "5_1_39bfaa": [0, 10, 140, 205, 247, 289], "3_1_syn1": [0, 10, 140, 205, 247, 289], "3_1_44": [0, 10, 140, 205, 247, 289], "clostridial": [0, 10, 140, 205, 247, 289], "1_7_47faa": [0, 10, 140, 205, 247, 289], "erysipelotrichacea": [0, 10, 140, 205, 247, 289], "2_2_44a": [0, 10, 140, 205, 247, 289], "elioraea": [0, 10, 140, 205, 247, 289], "tepidiphila": [0, 10, 140, 205, 247, 289], "17972": [0, 10, 140, 205, 247, 289], "chloracidobacterium": [0, 10, 140, 205, 247, 289], "planomicrobium": [0, 10, 140, 205, 247, 289], "glaciei": [0, 10, 140, 205, 247, 289], "chr43": [0, 10, 140, 205, 247, 289], "kuerlensi": [0, 10, 140, 205, 247, 289], "22868": [0, 10, 140, 205, 247, 289], "catacumba": [0, 10, 140, 205, 247, 289], "19601": [0, 10, 140, 205, 247, 289], "gs115": [0, 10, 140, 205, 247, 289], "ogataea": [0, 10, 140, 205, 247, 289], "ncyc": [0, 10, 140, 205, 247, 289], "495": [0, 10, 140, 205, 247, 289], "leu1": [0, 10, 140, 205, 247, 289], "nodensi": [0, 10, 140, 205, 247, 289], "19682": [0, 10, 140, 205, 247, 289], "14932": [0, 10, 140, 205, 247, 289], "107160": [0, 10, 140, 205, 247, 289], "f0489": [0, 10, 140, 205, 247, 289], "oremlandii": [0, 10, 140, 205, 247, 289], "ohila": [0, 10, 140, 205, 247, 289], "xinjiang": [0, 10, 140, 205, 247, 289], "yanchengensi": [0, 10, 140, 205, 247, 289], "y32": [0, 10, 140, 205, 247, 289], "rubicundulu": [0, 10, 140, 205, 247, 289], "ve08": [0, 10, 140, 205, 247, 289], "2h10": [0, 10, 140, 205, 247, 289], "19857": [0, 10, 140, 205, 247, 289], "hemiselmi": [0, 10, 140, 205, 247, 289], "andersenii": [0, 10, 140, 205, 247, 289], "mg1": [0, 10, 140, 205, 247, 289], "spb074": [0, 10, 140, 205, 247, 289], "ver3": [0, 10, 140, 205, 247, 289], "singulisphaera": [0, 10, 140, 205, 247, 289], "18658": [0, 10, 140, 205, 247, 289], "ilumatobact": [0, 10, 140, 205, 247, 289], "coccineu": [0, 10, 140, 205, 247, 289], "ym16": [0, 10, 140, 205, 247, 289], "304": [0, 10, 140, 205, 247, 289], "lachnoanaerobaculum": [0, 10, 140, 205, 247, 289], "saburreum": [0, 10, 140, 205, 247, 289], "f0468": [0, 10, 140, 205, 247, 289], "klh11": [0, 10, 140, 205, 247, 289], "suecicum": [0, 10, 140, 205, 247, 289], "hhb10207": [0, 10, 140, 205, 247, 289], "1_1_14": [0, 10, 140, 205, 247, 289], "2_1_22": [0, 10, 140, 205, 247, 289], "2_1_33b": [0, 10, 140, 205, 247, 289], "2_2_4": [0, 10, 140, 205, 247, 289], "20_3": [0, 10, 140, 205, 247, 289], "3_1_19": [0, 10, 140, 205, 247, 289], "3_1_40a": [0, 10, 140, 205, 247, 289], "coprobacillu": [0, 10, 140, 205, 247, 289], "8_2_54bfaa": [0, 10, 140, 205, 247, 289], "2_1_36faa": [0, 10, 140, 205, 247, 289], "burkholderial": [0, 10, 140, 205, 247, 289], "1_1_47": [0, 10, 140, 205, 247, 289], "6_1_45": [0, 10, 140, 205, 247, 289], "histicola": [0, 10, 140, 205, 247, 289], "15637": [0, 10, 140, 205, 247, 289], "dnf00424": [0, 10, 140, 205, 247, 289], "yegresii": [0, 10, 140, 205, 247, 289], "c55": [0, 10, 140, 205, 247, 289], "salinimicrobium": [0, 10, 140, 205, 247, 289], "17865": [0, 10, 140, 205, 247, 289], "vagan": [0, 10, 140, 205, 247, 289], "c9": [0, 10, 140, 205, 247, 289], "gordonibact": [0, 10, 140, 205, 247, 289], "pamelaea": [0, 10, 140, 205, 247, 289], "wch70": [0, 10, 140, 205, 247, 289], "dasania": [0, 10, 140, 205, 247, 289], "21967": [0, 10, 140, 205, 247, 289], "bombi": [0, 10, 140, 205, 247, 289], "19703": [0, 10, 140, 205, 247, 289], "haloplasma": [0, 10, 140, 205, 247, 289], "contractil": [0, 10, 140, 205, 247, 289], "ssd": [0, 10, 140, 205, 247, 289], "17b": [0, 10, 140, 205, 247, 289], "desulforudi": [0, 10, 140, 205, 247, 289], "audaxvi": [0, 10, 140, 205, 247, 289], "mp104c": [0, 10, 140, 205, 247, 289], "basalti": [0, 10, 140, 205, 247, 289], "113": [0, 10, 140, 205, 247, 289], "gloeosporioid": [0, 10, 140, 205, 247, 289], "methanosphaerula": [0, 10, 140, 205, 247, 289], "9c": [0, 10, 140, 205, 247, 289], "19626": [0, 10, 140, 205, 247, 289], "pseudohaliea": [0, 10, 140, 205, 247, 289], "19751": [0, 10, 140, 205, 247, 289], "24565": [0, 10, 140, 205, 247, 289], "modestobact": [0, 10, 140, 205, 247, 289], "graminisolven": [0, 10, 140, 205, 247, 289], "19988": [0, 10, 140, 205, 247, 289], "15093": [0, 10, 140, 205, 247, 289], "aliiglaciecola": [0, 10, 140, 205, 247, 289], "e3": [0, 10, 140, 205, 247, 289], "calditerrivibrio": [0, 10, 140, 205, 247, 289], "19672": [0, 10, 140, 205, 247, 289], "lp2a": [0, 10, 140, 205, 247, 289], "haematomicrobium": [0, 10, 140, 205, 247, 289], "21259": [0, 10, 140, 205, 247, 289], "ravenspurgens": [0, 10, 140, 205, 247, 289], "5401308": [0, 10, 140, 205, 247, 289], "53855": [0, 10, 140, 205, 247, 289], "morbif": [0, 10, 140, 205, 247, 289], "g707": [0, 10, 140, 205, 247, 289], "commensalibact": [0, 10, 140, 205, 247, 289], "a911": [0, 10, 140, 205, 247, 289], "rattaustraliani": [0, 10, 140, 205, 247, 289], "nh4": [0, 10, 140, 205, 247, 289], "otakiensi": [0, 10, 140, 205, 247, 289], "19908": [0, 10, 140, 205, 247, 289], "15040": [0, 10, 140, 205, 247, 289], "kisonensi": [0, 10, 140, 205, 247, 289], "f0435": [0, 10, 140, 205, 247, 289], "y412mc10": [0, 10, 140, 205, 247, 289], "galeopteru": [0, 10, 140, 205, 247, 289], "nigro": [0, 10, 140, 205, 247, 289], "fabifermentan": [0, 10, 140, 205, 247, 289], "t30pcm01": [0, 10, 140, 205, 247, 289], "cystoisospora": [0, 10, 140, 205, 247, 289], "geoalkalibact": [0, 10, 140, 205, 247, 289], "riograndensi": [0, 10, 140, 205, 247, 289], "sbr5": [0, 10, 140, 205, 247, 289], "ybl2": [0, 10, 140, 205, 247, 289], "ufo1": [0, 10, 140, 205, 247, 289], "succinatiphilu": [0, 10, 140, 205, 247, 289], "11850": [0, 10, 140, 205, 247, 289], "intestinihomini": [0, 10, 140, 205, 247, 289], "11860": [0, 10, 140, 205, 247, 289], "parasutterella": [0, 10, 140, 205, 247, 289], "excrementihomini": [0, 10, 140, 205, 247, 289], "11859": [0, 10, 140, 205, 247, 289], "capsosiphoni": [0, 10, 140, 205, 247, 289], "23843": [0, 10, 140, 205, 247, 289], "15074": [0, 10, 140, 205, 247, 289], "ulceribovi": [0, 10, 140, 205, 247, 289], "45146": [0, 10, 140, 205, 247, 289], "ms024": [0, 10, 140, 205, 247, 289], "scbi": [0, 10, 140, 205, 247, 289], "peloridi": [0, 10, 140, 205, 247, 289], "23910": [0, 10, 140, 205, 247, 289], "desulfonatronospira": [0, 10, 140, 205, 247, 289], "thiodismutan": [0, 10, 140, 205, 247, 289], "aso3": [0, 10, 140, 205, 247, 289], "halarchaeum": [0, 10, 140, 205, 247, 289], "mh1": [0, 10, 140, 205, 247, 289], "stm": [0, 10, 140, 205, 247, 289], "2683": [0, 10, 140, 205, 247, 289], "45148": [0, 10, 140, 205, 247, 289], "bss20148": [0, 10, 140, 205, 247, 289], "litoreibact": [0, 10, 140, 205, 247, 289], "19593": [0, 10, 140, 205, 247, 289], "leucobact": [0, 10, 140, 205, 247, 289], "chironomi": [0, 10, 140, 205, 247, 289], "19883": [0, 10, 140, 205, 247, 289], "brachymona": [0, 10, 140, 205, 247, 289], "19884": [0, 10, 140, 205, 247, 289], "rupellensi": [0, 10, 140, 205, 247, 289], "19944": [0, 10, 140, 205, 247, 289], "velezensi": [0, 10, 140, 205, 247, 289], "fzb42": [0, 10, 140, 205, 247, 289], "23607": [0, 10, 140, 205, 247, 289], "alamii": [0, 10, 140, 205, 247, 289], "palustr": [0, 10, 140, 205, 247, 289], "21579": [0, 10, 140, 205, 247, 289], "tb15": [0, 10, 140, 205, 247, 289], "tb": [0, 10, 140, 205, 247, 289], "panaciterra": [0, 10, 140, 205, 247, 289], "21099": [0, 10, 140, 205, 247, 289], "pseudethanolicu": [0, 10, 140, 205, 247, 289], "33223": [0, 10, 140, 205, 247, 289], "subantarcticu": [0, 10, 140, 205, 247, 289], "24377": [0, 10, 140, 205, 247, 289], "nitrososphaera": [0, 10, 140, 205, 247, 289], "gargensi": [0, 10, 140, 205, 247, 289], "ga9": [0, 10, 140, 205, 247, 289], "panacihumi": [0, 10, 140, 205, 247, 289], "w25": [0, 10, 140, 205, 247, 289], "oryziterra": [0, 10, 140, 205, 247, 289], "21050": [0, 10, 140, 205, 247, 289], "yc6267": [0, 10, 140, 205, 247, 289], "rivuli": [0, 10, 140, 205, 247, 289], "21788": [0, 10, 140, 205, 247, 289], "finlandensi": [0, 10, 140, 205, 247, 289], "opf8": [0, 10, 140, 205, 247, 289], "tepidanaerobact": [0, 10, 140, 205, 247, 289], "acetatoxydan": [0, 10, 140, 205, 247, 289], "re1": [0, 10, 140, 205, 247, 289], "brunneum": [0, 10, 140, 205, 247, 289], "3297": [0, 10, 140, 205, 247, 289], "avicennia": [0, 10, 140, 205, 247, 289], "glaciibact": [0, 10, 140, 205, 247, 289], "superst": [0, 10, 140, 205, 247, 289], "21135": [0, 10, 140, 205, 247, 289], "citreicella": [0, 10, 140, 205, 247, 289], "se45": [0, 10, 140, 205, 247, 289], "bennoni": [0, 10, 140, 205, 247, 289], "23058": [0, 10, 140, 205, 247, 289], "16335": [0, 10, 140, 205, 247, 289], "21156": [0, 10, 140, 205, 247, 289], "butyricicoccu": [0, 10, 140, 205, 247, 289], "pullicaecorum": [0, 10, 140, 205, 247, 289], "profundimari": [0, 10, 140, 205, 247, 289], "wp0211": [0, 10, 140, 205, 247, 289], "gobiensi": [0, 10, 140, 205, 247, 289], "yy7918": [0, 10, 140, 205, 247, 289], "porci": [0, 10, 140, 205, 247, 289], "23759": [0, 10, 140, 205, 247, 289], "diversa": [0, 10, 140, 205, 247, 289], "2478": [0, 10, 140, 205, 247, 289], "salisaeta": [0, 10, 140, 205, 247, 289], "longa": [0, 10, 140, 205, 247, 289], "21114": [0, 10, 140, 205, 247, 289], "sasangens": [0, 10, 140, 205, 247, 289], "21067": [0, 10, 140, 205, 247, 289], "kushneria": [0, 10, 140, 205, 247, 289], "21353": [0, 10, 140, 205, 247, 289], "jejuia": [0, 10, 140, 205, 247, 289], "pallidilutea": [0, 10, 140, 205, 247, 289], "13891": [0, 10, 140, 205, 247, 289], "19966": [0, 10, 140, 205, 247, 289], "chromera": [0, 10, 140, 205, 247, 289], "velia": [0, 10, 140, 205, 247, 289], "ccmp2878": [0, 10, 140, 205, 247, 289], "a13l": [0, 10, 140, 205, 247, 289], "caerulea": [0, 10, 140, 205, 247, 289], "24564": [0, 10, 140, 205, 247, 289], "duerdenii": [0, 10, 140, 205, 247, 289], "1640": [0, 10, 140, 205, 247, 289], "cloacibacillu": [0, 10, 140, 205, 247, 289], "evryensi": [0, 10, 140, 205, 247, 289], "19522": [0, 10, 140, 205, 247, 289], "genosp": [0, 10, 140, 205, 247, 289], "cb756": [0, 10, 140, 205, 247, 289], "v48": [0, 10, 140, 205, 247, 289], "gk1": [0, 10, 140, 205, 247, 289], "azobacteroid": [0, 10, 140, 205, 247, 289], "pseudotrichonympha": [0, 10, 140, 205, 247, 289], "genomovar": [0, 10, 140, 205, 247, 289], "cfp2": [0, 10, 140, 205, 247, 289], "methylacidiphilum": [0, 10, 140, 205, 247, 289], "infernorum": [0, 10, 140, 205, 247, 289], "v4": [0, 10, 140, 205, 247, 289], "azureu": [0, 10, 140, 205, 247, 289], "104587": [0, 10, 140, 205, 247, 289], "6724": [0, 10, 140, 205, 247, 289], "caloram": [0, 10, 140, 205, 247, 289], "australicu": [0, 10, 140, 205, 247, 289], "rc3": [0, 10, 140, 205, 247, 289], "lacticigenium": [0, 10, 140, 205, 247, 289], "naphta": [0, 10, 140, 205, 247, 289], "19658": [0, 10, 140, 205, 247, 289], "22864": [0, 10, 140, 205, 247, 289], "15124": [0, 10, 140, 205, 247, 289], "nesterenkonia": [0, 10, 140, 205, 247, 289], "19423": [0, 10, 140, 205, 247, 289], "lutaonensi": [0, 10, 140, 205, 247, 289], "burhodogranariea": [0, 10, 140, 205, 247, 289], "19968": [0, 10, 140, 205, 247, 289], "sneebia": [0, 10, 140, 205, 247, 289], "19967": [0, 10, 140, 205, 247, 289], "19772": [0, 10, 140, 205, 247, 289], "jsm": [0, 10, 140, 205, 247, 289], "072002": [0, 10, 140, 205, 247, 289], "076056": [0, 10, 140, 205, 247, 289], "19796": [0, 10, 140, 205, 247, 289], "jlt1363": [0, 10, 140, 205, 247, 289], "mongoliens": [0, 10, 140, 205, 247, 289], "21395": [0, 10, 140, 205, 247, 289], "sucicola": [0, 10, 140, 205, 247, 289], "21376": [0, 10, 140, 205, 247, 289], "15457": [0, 10, 140, 205, 247, 289], "hongdengensi": [0, 10, 140, 205, 247, 289], "23025": [0, 10, 140, 205, 247, 289], "elaphomyc": [0, 10, 140, 205, 247, 289], "granulatu": [0, 10, 140, 205, 247, 289], "ectothiorhodospira": [0, 10, 140, 205, 247, 289], "ph": [0, 10, 140, 205, 247, 289], "nvsl": [0, 10, 140, 205, 247, 289], "07": [0, 6, 10, 140, 205, 247, 289], "0026": [0, 10, 140, 205, 247, 289], "83": [0, 10, 140, 205, 247, 289], "24390": [0, 10, 140, 205, 247, 289], "lactosuten": [0, 10, 140, 205, 247, 289], "ds20": [0, 10, 140, 205, 247, 289], "mentagrophyt": [0, 10, 140, 205, 247, 289], "santoriniensi": [0, 10, 140, 205, 247, 289], "nksg1": [0, 10, 140, 205, 247, 289], "27244": [0, 10, 140, 205, 247, 289], "21227": [0, 10, 140, 205, 247, 289], "haloglycomyc": [0, 10, 140, 205, 247, 289], "45210": [0, 10, 140, 205, 247, 289], "oceanibaculum": [0, 10, 140, 205, 247, 289], "p24": [0, 10, 140, 205, 247, 289], "marthii": [0, 10, 140, 205, 247, 289], "thecamona": [0, 10, 140, 205, 247, 289], "trahen": [0, 10, 140, 205, 247, 289], "rhodoluna": [0, 10, 140, 205, 247, 289], "lacicola": [0, 10, 140, 205, 247, 289], "pelagibacterium": [0, 10, 140, 205, 247, 289], "flavobacteriacea": [0, 10, 140, 205, 247, 289], "3519": [0, 9, 10, 140, 205, 247, 289], "actinopolymorpha": [0, 10, 140, 205, 247, 289], "45243": [0, 10, 140, 205, 247, 289], "australicum": [0, 10, 140, 205, 247, 289], "wsm2073": [0, 10, 140, 205, 247, 289], "lutiphoca": [0, 10, 140, 205, 247, 289], "21542": [0, 10, 140, 205, 247, 289], "rudaea": [0, 10, 140, 205, 247, 289], "22992": [0, 10, 140, 205, 247, 289], "21543": [0, 10, 140, 205, 247, 289], "lubricanti": [0, 10, 140, 205, 247, 289], "45231": [0, 10, 140, 205, 247, 289], "peronospora": [0, 10, 140, 205, 247, 289], "subtropicu": [0, 10, 140, 205, 247, 289], "y412mc61": [0, 10, 140, 205, 247, 289], "f0510": [0, 10, 140, 205, 247, 289], "butyricimona": [0, 10, 140, 205, 247, 289], "synergistica": [0, 10, 140, 205, 247, 289], "23225": [0, 10, 140, 205, 247, 289], "akl11": [0, 10, 140, 205, 247, 289], "alj24": [0, 10, 140, 205, 247, 289], "alishewanella": [0, 10, 140, 205, 247, 289], "22429": [0, 10, 140, 205, 247, 289], "paraoerskovia": [0, 10, 140, 205, 247, 289], "21750": [0, 10, 140, 205, 247, 289], "5110": [0, 10, 140, 205, 247, 289], "3684": [0, 10, 140, 205, 247, 289], "ho": [0, 10, 140, 205, 247, 289], "sn": [0, 10, 140, 205, 247, 289], "phycisphaera": [0, 10, 140, 205, 247, 289], "mikurensi": [0, 10, 140, 205, 247, 289], "102666": [0, 10, 140, 205, 247, 289], "pseudogulbenkiania": [0, 10, 140, 205, 247, 289], "y412mc52": [0, 10, 140, 205, 247, 289], "acacia": [0, 10, 140, 205, 247, 289], "45401": [0, 10, 140, 205, 247, 289], "aromatoleum": [0, 10, 140, 205, 247, 289], "aromaticum": [0, 10, 140, 205, 247, 289], "ebn1": [0, 10, 140, 205, 247, 289], "caldicoprobact": [0, 10, 140, 205, 247, 289], "21659": [0, 10, 140, 205, 247, 289], "sediminimona": [0, 10, 140, 205, 247, 289], "qiaohouensi": [0, 10, 140, 205, 247, 289], "21189": [0, 10, 140, 205, 247, 289], "salinarimona": [0, 10, 140, 205, 247, 289], "21201": [0, 10, 140, 205, 247, 289], "5_2_54faa": [0, 10, 140, 205, 247, 289], "ruminococcacea": [0, 10, 140, 205, 247, 289], "d16": [0, 10, 140, 205, 247, 289], "vgiii": [0, 10, 140, 205, 247, 289], "dehalogenimona": [0, 10, 140, 205, 247, 289], "lykanthroporepellen": [0, 10, 140, 205, 247, 289], "bl": [0, 10, 140, 205, 247, 289], "pelagia": [0, 10, 140, 205, 247, 289], "cl": [0, 10, 140, 205, 247, 289], "ap6": [0, 10, 140, 205, 247, 289], "breoganii": [0, 10, 140, 205, 247, 289], "1c10": [0, 10, 140, 205, 247, 289], "agri": [0, 10, 140, 205, 247, 289], "bl06": [0, 10, 140, 205, 247, 289], "crustatorum": [0, 10, 140, 205, 247, 289], "hwa": [0, 10, 140, 205, 247, 289], "leiognathi": [0, 10, 140, 205, 247, 289], "lrivu": [0, 10, 140, 205, 247, 289], "chlorella": [0, 10, 140, 205, 247, 289], "cb2": [0, 10, 140, 205, 247, 289], "chungangens": [0, 10, 140, 205, 247, 289], "26729": [0, 10, 140, 205, 247, 289], "galbibact": [0, 10, 140, 205, 247, 289], "s46": [0, 10, 140, 205, 247, 289], "rr": [0, 10, 140, 205, 247, 289], "d1": [0, 9, 10, 140, 205, 247, 289], "d5": [0, 10, 140, 205, 247, 289], "d7": [0, 10, 140, 205, 247, 289], "clso": [0, 10, 140, 205, 247, 289], "acidifacien": [0, 10, 140, 205, 247, 289], "21887": [0, 10, 140, 205, 247, 289], "freiburgens": [0, 10, 140, 205, 247, 289], "45254": [0, 10, 140, 205, 247, 289], "piperi": [0, 10, 140, 205, 247, 289], "lentibacillu": [0, 10, 140, 205, 247, 289], "carnicancri": [0, 10, 140, 205, 247, 289], "crm": [0, 10, 140, 205, 247, 289], "lacu": [0, 10, 140, 205, 247, 289], "namibia": [0, 10, 140, 205, 247, 289], "147": [0, 10, 140, 165, 205, 247, 289], "sinduriensi": [0, 10, 140, 205, 247, 289], "blb": [0, 10, 140, 205, 247, 289], "15800": [0, 10, 140, 205, 247, 289], "aliagarivoran": [0, 10, 140, 205, 247, 289], "22990": [0, 10, 140, 205, 247, 289], "c561": [0, 10, 140, 205, 247, 289], "c300": [0, 10, 140, 205, 247, 289], "m143": [0, 10, 140, 205, 247, 289], "m334": [0, 10, 140, 205, 247, 289], "acidianu": [0, 10, 140, 205, 247, 289], "c41b8": [0, 10, 140, 205, 247, 289], "d13": [0, 10, 140, 205, 247, 289], "scedosporium": [0, 10, 140, 205, 247, 289], "apiospermum": [0, 10, 140, 205, 247, 289], "saccharomycetacea": [0, 10, 140, 205, 247, 289], "aceri": [0, 10, 140, 205, 247, 289], "robertsii": [0, 10, 140, 205, 247, 289], "poaceiphila": [0, 10, 140, 205, 247, 289], "immunda": [0, 10, 140, 205, 247, 289], "scsio": [0, 10, 140, 205, 247, 289], "04301": [0, 10, 140, 205, 247, 289], "methanocella": [0, 10, 140, 205, 247, 289], "sana": [0, 10, 140, 205, 247, 289], "sjy1": [0, 10, 140, 205, 247, 289], "romalea": [0, 10, 140, 205, 247, 289], "idahoensi": [0, 10, 140, 205, 247, 289], "x513": [0, 10, 140, 205, 247, 289], "hodgkinia": [0, 10, 140, 205, 247, 289], "cicadicola": [0, 10, 140, 205, 247, 289], "dsem": [0, 10, 140, 205, 247, 289], "oxalativoran": [0, 10, 140, 205, 247, 289], "gaemokensi": [0, 10, 140, 205, 247, 289], "manliponensi": [0, 10, 140, 205, 247, 289], "23371": [0, 10, 140, 205, 247, 289], "taeanensi": [0, 10, 140, 205, 247, 289], "45190": [0, 10, 140, 205, 247, 289], "subalpina": [0, 10, 140, 205, 247, 289], "polynucleobact": [0, 10, 140, 205, 247, 289], "necessariu": [0, 10, 140, 205, 247, 289], "stir1": [0, 10, 140, 205, 247, 289], "asymbioticu": [0, 10, 140, 205, 247, 289], "qlw": [0, 10, 140, 205, 247, 289], "p1dmwa": [0, 10, 140, 205, 247, 289], "iranensi": [0, 10, 140, 205, 247, 289], "indibact": [0, 10, 140, 205, 247, 289], "lw1": [0, 10, 140, 205, 247, 289], "enterorhabdu": [0, 10, 140, 205, 247, 289], "mucosicola": [0, 10, 140, 205, 247, 289], "19490": [0, 10, 140, 205, 247, 289], "cytotoxicu": [0, 10, 140, 205, 247, 289], "nvh": [0, 10, 140, 205, 247, 289], "391": [0, 10, 140, 205, 247, 289], "y4": [0, 10, 140, 205, 247, 289], "1mc1": [0, 10, 140, 205, 247, 289], "paralvinella": [0, 10, 140, 205, 247, 289], "rubidibact": [0, 10, 140, 205, 247, 289], "lacuna": [0, 10, 140, 205, 247, 289], "kordi": [0, 10, 140, 205, 247, 289], "51": [0, 9, 10, 140, 169, 205, 247, 289], "mathranii": [0, 10, 140, 205, 247, 289], "49": [0, 10, 140, 165, 205, 247, 289], "d20": [0, 10, 140, 205, 247, 289], "d22": [0, 10, 140, 205, 247, 289], "nematocida": [0, 10, 140, 205, 247, 289], "parisii": [0, 10, 140, 205, 247, 289], "manasiensi": [0, 10, 140, 205, 247, 289], "terribacillu": [0, 10, 140, 205, 247, 289], "chlororaphi": [0, 10, 140, 205, 247, 289], "16676": [0, 10, 140, 205, 247, 289], "naganishii": [0, 10, 140, 205, 247, 289], "naejangsanensi": [0, 10, 140, 205, 247, 289], "17724": [0, 10, 140, 205, 247, 289], "scopo": [0, 10, 140, 205, 247, 289], "17725": [0, 10, 140, 205, 247, 289], "australica": [0, 10, 140, 205, 247, 289], "fumariolicum": [0, 10, 140, 205, 247, 289], "solv": [0, 2, 10, 140, 205, 247, 289], "spb78": [0, 10, 140, 205, 247, 289], "aa4": [0, 10, 140, 205, 247, 289], "ignavibacterium": [0, 10, 140, 205, 247, 289], "isopora": [0, 10, 140, 205, 247, 289], "25204": [0, 10, 140, 205, 247, 289], "9b": [0, 10, 140, 205, 247, 289], "sc1": [0, 10, 140, 205, 247, 289], "opportunistum": [0, 10, 140, 205, 247, 289], "wsm2075": [0, 10, 140, 205, 247, 289], "allofrancisella": [0, 10, 140, 205, 247, 289], "guangzhouensi": [0, 10, 140, 205, 247, 289], "swk7": [0, 10, 140, 205, 247, 289], "15754": [0, 10, 140, 205, 247, 289], "u5l": [0, 10, 140, 205, 247, 289], "brenneria": [0, 10, 140, 205, 247, 289], "enid312": [0, 10, 140, 205, 247, 289], "pyruviciproducen": [0, 10, 140, 205, 247, 289], "1742": [0, 10, 140, 205, 247, 289], "fibroporia": [0, 10, 140, 205, 247, 289], "radiculosa": [0, 10, 140, 205, 247, 289], "rufu": [0, 10, 140, 205, 247, 289], "22234": [0, 10, 140, 205, 247, 289], "wadsworthii": [0, 10, 140, 205, 247, 289], "9715": [0, 10, 140, 205, 247, 289], "shayeganii": [0, 10, 140, 205, 247, 289], "871": [0, 10, 140, 205, 247, 289], "dinoponera": [0, 10, 140, 205, 247, 289], "quadricep": [0, 10, 140, 205, 247, 289], "asaia": [0, 10, 140, 205, 247, 289], "platycodi": [0, 10, 140, 205, 247, 289], "sf2": [0, 10, 140, 205, 247, 289], "harpegnatho": [0, 10, 140, 205, 247, 289], "saltat": [0, 10, 140, 205, 247, 289], "polycyclovoran": [0, 10, 140, 205, 247, 289], "tg408": [0, 10, 140, 205, 247, 289], "49242": [0, 10, 140, 205, 247, 289], "bge": [0, 10, 140, 205, 247, 289], "12056": [0, 10, 140, 205, 247, 289], "fluxu": [0, 10, 140, 205, 247, 289], "12057": [0, 10, 140, 205, 247, 289], "oleiciplenu": [0, 10, 140, 205, 247, 289], "12058": [0, 10, 140, 205, 247, 289], "indistinctu": [0, 10, 140, 205, 247, 289], "12060": [0, 10, 140, 205, 247, 289], "laneu": [0, 10, 140, 205, 247, 289], "12061": [0, 10, 140, 205, 247, 289], "piriformi": [0, 10, 140, 205, 247, 289], "12062": [0, 10, 140, 205, 247, 289], "tanakaei": [0, 10, 140, 205, 247, 289], "12063": [0, 10, 140, 205, 247, 289], "succinatimona": [0, 10, 140, 205, 247, 289], "hippei": [0, 10, 140, 205, 247, 289], "12066": [0, 10, 140, 205, 247, 289], "phascolarctobacterium": [0, 10, 140, 205, 247, 289], "succinatuten": [0, 10, 140, 205, 247, 289], "12067": [0, 10, 140, 205, 247, 289], "syk": [0, 10, 140, 205, 247, 289], "mn802worker": [0, 10, 140, 205, 247, 289], "tomitella": [0, 10, 140, 205, 247, 289], "ahu": [0, 10, 140, 205, 247, 289], "1821": [0, 10, 140, 205, 247, 289], "thiorhodovibrio": [0, 10, 140, 205, 247, 289], "xmu15": [0, 10, 140, 205, 247, 289], "rudi": [0, 10, 140, 205, 247, 289], "110305": [0, 10, 140, 205, 247, 289], "thalassobium": [0, 10, 140, 205, 247, 289], "r2a62": [0, 10, 140, 205, 247, 289], "saccharolytica": [0, 10, 140, 205, 247, 289], "f0055": [0, 10, 140, 205, 247, 289], "bohemicum": [0, 10, 140, 205, 247, 289], "22767": [0, 10, 140, 205, 247, 289], "actinocoloniiform": [0, 10, 140, 205, 247, 289], "22766": [0, 10, 140, 205, 247, 289], "pyramidobact": [0, 10, 140, 205, 247, 289], "piscolen": [0, 10, 140, 205, 247, 289], "w5455": [0, 10, 140, 205, 247, 289], "kb": [0, 10, 140, 205, 247, 289], "hoyosella": [0, 10, 140, 205, 247, 289], "dqs3": [0, 10, 140, 205, 247, 289], "9a1": [0, 10, 140, 205, 247, 289], "2f": [0, 10, 140, 205, 247, 289], "ccge1001": [0, 10, 140, 205, 247, 289], "ccge1003": [0, 10, 140, 205, 247, 289], "dl": [0, 10, 140, 205, 247, 289], "viii": [0, 10, 140, 205, 247, 289], "oral": [0, 10, 140, 205, 247, 289], "014": [0, 9, 10, 140, 205, 247, 289], "f0314": [0, 10, 140, 205, 247, 289], "morbirosei": [0, 10, 140, 205, 247, 289], "silicibact": [0, 10, 140, 205, 247, 289], "trichch4b": [0, 10, 140, 205, 247, 289], "fs406": [0, 10, 140, 205, 247, 289], "e14": [0, 10, 140, 205, 247, 289], "hepatopenaei": [0, 10, 140, 205, 247, 289], "gaboni": [0, 10, 140, 205, 247, 289], "mb200": [0, 10, 140, 205, 247, 289], "l5": [0, 10, 140, 205, 247, 289], "cesiribact": [0, 10, 140, 205, 247, 289], "andamanensi": [0, 10, 140, 205, 247, 289], "amv16": [0, 10, 140, 205, 247, 289], "848": [0, 10, 140, 205, 247, 289], "f0332": [0, 10, 140, 205, 247, 289], "hydrogeniforman": [0, 10, 140, 205, 247, 289], "1850": [0, 10, 140, 205, 247, 289], "hadru": [0, 10, 140, 205, 247, 289], "3319": [0, 10, 140, 205, 247, 289], "n902": [0, 10, 140, 205, 247, 289], "109": [0, 10, 140, 205, 247, 289], "sulfuricella": [0, 10, 140, 205, 247, 289], "skb26": [0, 10, 140, 205, 247, 289], "fibrella": [0, 10, 140, 205, 247, 289], "aestuarina": [0, 10, 140, 205, 247, 289], "buz": [0, 10, 140, 205, 247, 289], "aurantimona": [0, 10, 140, 205, 247, 289], "manganoxydan": [0, 10, 140, 205, 247, 289], "si85": [0, 10, 140, 205, 247, 289], "kosmotoga": [0, 10, 140, 205, 247, 289], "olearia": [0, 10, 140, 205, 247, 289], "tbf": [0, 10, 140, 205, 247, 289], "f0310": [0, 10, 140, 205, 247, 289], "fretibacterium": [0, 10, 140, 205, 247, 289], "fastidiosum": [0, 10, 140, 205, 247, 289], "078": [0, 10, 140, 205, 247, 289], "f0262": [0, 10, 140, 205, 247, 289], "bacteroidet": [0, 10, 140, 205, 247, 289], "274": [0, 10, 140, 205, 247, 289], "f0058": [0, 10, 140, 205, 247, 289], "386": [0, 10, 140, 205, 247, 289], "f0131": [0, 10, 140, 205, 247, 289], "786": [0, 10, 140, 205, 247, 289], "d14": [0, 10, 140, 205, 247, 289], "299": [0, 10, 140, 205, 247, 289], "f0039": [0, 10, 140, 205, 247, 289], "f0108": [0, 10, 140, 205, 247, 289], "849": [0, 10, 140, 205, 247, 289], "f0330": [0, 10, 140, 205, 247, 289], "albugo": [0, 10, 140, 205, 247, 289], "laibachii": [0, 10, 140, 205, 247, 289], "472": [0, 10, 140, 205, 247, 289], "f0295": [0, 10, 140, 205, 247, 289], "pseudogymnoascu": [0, 10, 140, 205, 247, 289], "destructan": [0, 10, 140, 205, 247, 289], "20631": [0, 10, 140, 205, 247, 289], "vervacti": [0, 10, 140, 205, 247, 289], "sr1": [0, 10, 140, 205, 247, 289], "beibuens": [0, 10, 140, 205, 247, 289], "f44": [0, 10, 140, 205, 247, 289], "koribact": [0, 10, 140, 205, 247, 289], "versatili": [0, 10, 140, 205, 247, 289], "ellin345": [0, 10, 140, 205, 247, 289], "5_2_56faa": [0, 10, 140, 205, 247, 289], "1_1_57faa": [0, 10, 140, 205, 247, 289], "2_1_58faa": [0, 10, 140, 205, 247, 289], "6_1_63faa": [0, 10, 140, 205, 247, 289], "5_1_57faa": [0, 10, 140, 205, 247, 289], "3_1_57faa_ct1": [0, 10, 140, 205, 247, 289], "7_1_58faa": [0, 10, 140, 205, 247, 289], "9_1_43bfaa": [0, 10, 140, 205, 247, 289], "5_1_63faa": [0, 10, 140, 205, 247, 289], "h2": [0, 10, 140, 205, 247, 289], "1_4_56faa": [0, 10, 140, 205, 247, 289], "6_1_37faa": [0, 10, 140, 205, 247, 289], "21_3": [0, 10, 140, 205, 247, 289], "3_1_53": [0, 10, 140, 205, 247, 289], "d25": [0, 10, 140, 205, 247, 289], "31_2": [0, 10, 140, 205, 247, 289], "acidipaludi": [0, 10, 140, 205, 247, 289], "101816": [0, 10, 140, 205, 247, 289], "809": [0, 10, 140, 205, 247, 289], "f0356": [0, 10, 140, 205, 247, 289], "squillarum": [0, 10, 140, 205, 247, 289], "parvarchaeum": [0, 10, 140, 205, 247, 289], "arman": [0, 10, 140, 205, 247, 289], "4_": [0, 10, 140, 205, 247, 289], "wai": [0, 1, 2, 5, 6, 9, 10, 140, 205, 247, 289, 323, 324, 325], "5_": [0, 10, 140, 205, 247, 289], "fibrisoma": [0, 10, 140, 205, 247, 289], "limi": [0, 10, 140, 205, 247, 289], "aurea": [0, 10, 140, 205, 247, 289], "salsiciu": [0, 10, 140, 205, 247, 289], "bavariensi": [0, 10, 140, 205, 247, 289], "pbi": [0, 10, 140, 205, 247, 289], "oceanisedimini": [0, 10, 140, 205, 247, 289], "2691": [0, 10, 140, 205, 247, 289], "dietzia": [0, 10, 140, 205, 247, 289], "alimentaria": [0, 10, 140, 205, 247, 289], "72": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "10_1_50": [0, 10, 140, 205, 247, 289], "7_3_54faa": [0, 10, 140, 205, 247, 289], "3_3_56faa": [0, 10, 140, 205, 247, 289], "6_1_46afaa": [0, 10, 140, 205, 247, 289], "1_3_56faa": [0, 10, 140, 205, 247, 289], "4_1_44faa": [0, 10, 140, 205, 247, 289], "gt4a_ct1": [0, 10, 140, 205, 247, 289], "6_1_58faa_ct1": [0, 10, 140, 205, 247, 289], "3_1_46faa": [0, 10, 140, 205, 247, 289], "8_1_57faa": [0, 10, 140, 205, 247, 289], "4_3_54a2faa": [0, 10, 140, 205, 247, 289], "7_6_55cfaa_ct2": [0, 10, 140, 205, 247, 289], "bt1b_ct2": [0, 10, 140, 205, 247, 289], "2_a_57_ct2": [0, 10, 140, 205, 247, 289], "macrocephali": [0, 10, 140, 205, 247, 289], "jamb": [0, 10, 140, 205, 247, 289], "n27": [0, 10, 140, 205, 247, 289], "1nls2": [0, 10, 140, 205, 247, 289], "1nla3e": [0, 10, 140, 205, 247, 289], "raphidiopsi": [0, 10, 140, 205, 247, 289], "brookii": [0, 10, 140, 205, 247, 289], "d9": [0, 10, 140, 205, 247, 289], "thelohanellu": [0, 10, 140, 205, 247, 289], "kitauei": [0, 10, 140, 205, 247, 289], "geminocysti": [0, 10, 140, 205, 247, 289], "herdmanii": [0, 10, 140, 205, 247, 289], "6308": [0, 10, 140, 205, 247, 289], "16418": [0, 10, 140, 205, 247, 289], "profftella": [0, 10, 140, 205, 247, 289], "armatura": [0, 10, 140, 205, 247, 289], "uzinura": [0, 10, 140, 205, 247, 289], "diaspidicola": [0, 10, 140, 205, 247, 289], "asner": [0, 10, 140, 205, 247, 289], "methylomirabili": [0, 10, 140, 205, 247, 289], "oxyfera": [0, 10, 140, 205, 247, 289], "f0581": [0, 10, 140, 205, 247, 289], "rava": [0, 10, 140, 205, 247, 289], "f0323": [0, 10, 140, 205, 247, 289], "192": [0, 10, 140, 205, 247, 289], "f0372": [0, 10, 140, 205, 247, 289], "artemidi": [0, 10, 140, 205, 247, 289], "f0399": [0, 10, 140, 205, 247, 289], "158": [0, 10, 140, 166, 205, 247, 289], "f0412": [0, 10, 140, 205, 247, 289], "780": [0, 10, 140, 205, 247, 289], "f0422": [0, 10, 140, 205, 247, 289], "caecimuri": [0, 10, 140, 205, 247, 289], "sartorii": [0, 10, 140, 205, 247, 289], "dnlkv3": [0, 10, 140, 205, 247, 289], "yannicii": [0, 10, 140, 205, 247, 289], "ps01": [0, 10, 140, 205, 247, 289], "cbtq1": [0, 10, 140, 205, 247, 289], "mar08": [0, 10, 140, 205, 247, 289], "babela": [0, 10, 140, 205, 247, 289], "faeci": [0, 10, 140, 205, 247, 289], "maj27": [0, 10, 140, 205, 247, 289], "rc586": [0, 10, 140, 205, 247, 289], "nothofagi": [0, 10, 140, 205, 247, 289], "fervidicoccu": [0, 10, 140, 205, 247, 289], "fonti": [0, 10, 140, 205, 247, 289], "kam940": [0, 10, 140, 205, 247, 289], "pr090111": [0, 10, 140, 205, 247, 289], "t3t": [0, 10, 140, 205, 247, 289], "s9": [0, 10, 140, 205, 247, 289], "nk2b42": [0, 10, 140, 205, 247, 289], "fructicola": [0, 10, 140, 205, 247, 289], "nara": [0, 10, 140, 205, 247, 289], "gc5": [0, 10, 140, 205, 247, 289], "t3": [0, 10, 140, 205, 247, 289], "fonticula": [0, 10, 140, 205, 247, 289], "caldisericum": [0, 10, 140, 205, 247, 289], "exil": [0, 10, 140, 205, 247, 289], "azm16c01": [0, 10, 140, 205, 247, 289], "lgp32": [0, 10, 140, 205, 247, 289], "enterobacteriacea": [0, 10, 140, 205, 247, 289], "fgi": [0, 10, 140, 205, 247, 289], "halogranum": [0, 10, 140, 205, 247, 289], "salarium": [0, 10, 140, 205, 247, 289], "4_1_30": [0, 10, 140, 205, 247, 289], "marssonina": [0, 10, 140, 205, 247, 289], "brunnea": [0, 10, 140, 205, 247, 289], "multigermtubi": [0, 10, 140, 205, 247, 289], "mb_m1": [0, 10, 140, 205, 247, 289], "alimentariu": [0, 10, 140, 205, 247, 289], "type_1": [0, 10, 140, 205, 247, 289], "28l": [0, 10, 140, 205, 247, 289], "caribbeanicu": [0, 10, 140, 205, 247, 289], "2122": [0, 10, 140, 165, 166, 205, 247, 289], "n418": [0, 10, 140, 205, 247, 289], "pp1y": [0, 10, 140, 205, 247, 289], "329": [0, 10, 140, 205, 247, 289], "f0087": [0, 10, 140, 205, 247, 289], "f0337": [0, 10, 140, 205, 247, 289], "chlorophyti": [0, 10, 140, 205, 247, 289], "tofieldia": [0, 10, 140, 205, 247, 289], "bradyrhizobiacea": [0, 10, 140, 205, 247, 289], "sg": [0, 10, 140, 205, 247, 289], "6c": [0, 10, 140, 205, 247, 289], "qa3": [0, 10, 140, 205, 247, 289], "178": [0, 10, 140, 205, 247, 289], "f0338": [0, 10, 140, 205, 247, 289], "338": [0, 10, 140, 205, 247, 289], "f0234": [0, 10, 140, 205, 247, 289], "fiorinia": [0, 10, 140, 205, 247, 289], "gxt6": [0, 10, 140, 205, 247, 289], "f0386": [0, 10, 140, 205, 247, 289], "172": [0, 10, 140, 205, 247, 289], "f0311": [0, 10, 140, 205, 247, 289], "175": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "f0384": [0, 10, 140, 205, 247, 289], "f0379": [0, 10, 140, 205, 247, 289], "448": [0, 10, 140, 205, 247, 289], "f0400": [0, 10, 140, 205, 247, 289], "458": [0, 10, 140, 205, 247, 289], "w10330": [0, 10, 140, 205, 247, 289], "199": [0, 10, 140, 205, 247, 289], "f0494": [0, 10, 140, 205, 247, 289], "810": [0, 10, 140, 205, 247, 289], "f0209": [0, 10, 140, 205, 247, 289], "324": [0, 10, 140, 205, 247, 289], "f0483": [0, 10, 140, 205, 247, 289], "326": [0, 10, 140, 205, 247, 289], "f0382": [0, 10, 140, 205, 247, 289], "332": [0, 10, 140, 205, 247, 289], "f0381": [0, 10, 140, 205, 247, 289], "336": [0, 10, 140, 205, 247, 289], "f0502": [0, 10, 140, 205, 247, 289], "380": [0, 10, 140, 205, 247, 289], "f0488": [0, 10, 140, 205, 247, 289], "370": [0, 10, 140, 205, 247, 289], "f0437": [0, 10, 140, 205, 247, 289], "215": [0, 10, 140, 205, 247, 289], "w9775": [0, 10, 140, 205, 247, 289], "186": [0, 10, 140, 205, 247, 289, 324, 325], "f0373": [0, 10, 140, 205, 247, 289], "f0370": [0, 10, 140, 205, 247, 289], "f0425": [0, 10, 140, 205, 247, 289], "375": [0, 10, 140, 205, 247, 289], "f0436": [0, 10, 140, 205, 247, 289], "w7784": [0, 10, 140, 205, 247, 289], "f0472": [0, 10, 140, 205, 247, 289], "473": [0, 10, 140, 205, 247, 289], "f0040": [0, 10, 140, 205, 247, 289], "137": [0, 10, 140, 205, 247, 289], "f0430": [0, 10, 140, 205, 247, 289], "138": [0, 10, 140, 205, 247, 289], "f0429": [0, 10, 140, 205, 247, 289], "67h29bp": [0, 10, 140, 205, 247, 289], "056": [0, 10, 140, 205, 247, 289], "f0418": [0, 10, 140, 205, 247, 289], "058": [0, 10, 140, 205, 247, 289], "f0407": [0, 10, 140, 205, 247, 289], "071": [0, 10, 140, 205, 247, 289], "73h25ap": [0, 10, 140, 205, 247, 289], "f0552": [0, 10, 140, 205, 247, 289], "082": [0, 10, 140, 205, 247, 289], "f0431": [0, 10, 140, 205, 247, 289], "107": [0, 10, 140, 168, 205, 247, 289], "f0167": [0, 10, 140, 205, 247, 289], "f0440": [0, 10, 140, 205, 247, 289], "atelocyanobacterium": [0, 10, 140, 205, 247, 289], "thalassa": [0, 10, 140, 205, 247, 289], "sio64986": [0, 10, 140, 205, 247, 289], "ccbau": [0, 10, 140, 205, 247, 289], "05684": [0, 10, 140, 205, 247, 289], "obsidiansi": [0, 10, 140, 205, 247, 289], "ob47": [0, 10, 140, 205, 247, 289], "hyphopichia": [0, 10, 140, 205, 247, 289], "1933": [0, 10, 140, 205, 247, 289], "mc1": [0, 10, 140, 205, 247, 289], "drc": [0, 10, 140, 205, 247, 289], "itaito": [0, 10, 140, 205, 247, 289], "c115": [0, 10, 140, 205, 247, 289], "ebreu": [0, 10, 140, 205, 247, 289], "tpsy": [0, 10, 140, 205, 247, 289], "f10": [0, 10, 140, 205, 247, 289], "zf": [0, 10, 140, 205, 247, 289], "129": [0, 10, 140, 205, 247, 289], "anncaliia": [0, 10, 140, 205, 247, 289], "algera": [0, 10, 140, 205, 247, 289], "pra109": [0, 10, 140, 205, 247, 289], "y9602": [0, 10, 140, 205, 247, 289], "cs1": [0, 10, 140, 205, 247, 289], "melanaphi": [0, 10, 140, 205, 247, 289], "4_8_47faa": [0, 10, 140, 205, 247, 289], "2_1_46faa": [0, 10, 140, 205, 247, 289], "sb2": [0, 10, 140, 205, 247, 289], "ahrensia": [0, 10, 140, 205, 247, 289], "r2a130": [0, 10, 140, 205, 247, 289], "roseibium": [0, 10, 140, 205, 247, 289], "trichskd4": [0, 10, 140, 205, 247, 289], "vcsm12": [0, 10, 140, 205, 247, 289], "mobilicoccu": [0, 10, 140, 205, 247, 289], "pelagiu": [0, 10, 140, 205, 247, 289], "104925": [0, 10, 140, 205, 247, 289], "fumigatu": [0, 10, 140, 205, 247, 289], "af293": [0, 10, 140, 205, 247, 289], "x50": [0, 10, 140, 205, 247, 289], "azoarcu": [0, 10, 140, 205, 247, 289], "kh32c": [0, 10, 140, 205, 247, 289], "nh8b": [0, 10, 140, 205, 247, 289], "alsr1": [0, 10, 140, 205, 247, 289], "sulfuritalea": [0, 10, 140, 205, 247, 289], "hydrogenivoran": [0, 10, 140, 205, 247, 289], "sk43h": [0, 10, 140, 205, 247, 289], "art55": [0, 10, 140, 205, 247, 289], "dl1": [0, 10, 140, 205, 247, 289], "tw09308": [0, 10, 140, 205, 247, 289], "winogradskyella": [0, 10, 140, 205, 247, 289], "aphoticum": [0, 10, 140, 205, 247, 289], "nitratireducenticrescen": [0, 10, 140, 205, 247, 289], "frappieri": [0, 10, 140, 205, 247, 289], "bnl1100": [0, 10, 140, 205, 247, 289], "wp8": [0, 10, 140, 205, 247, 289], "110367": [0, 10, 140, 205, 247, 289], "rpe67": [0, 10, 140, 205, 247, 289], "newyorkensi": [0, 10, 140, 205, 247, 289], "2681": [0, 10, 140, 205, 247, 289], "consociata": [0, 10, 140, 205, 247, 289], "callitricho": [0, 10, 140, 205, 247, 289], "23973": [0, 10, 140, 205, 247, 289], "stellenboschens": [0, 10, 140, 205, 247, 289], "biavatii": [0, 10, 140, 205, 247, 289], "23969": [0, 10, 140, 205, 247, 289], "siansivirga": [0, 10, 140, 205, 247, 289], "samt": [0, 10, 140, 205, 247, 289], "851": [0, 10, 140, 205, 247, 289], "f0397": [0, 10, 140, 205, 247, 289], "bannensi": [0, 10, 140, 205, 247, 289], "103871": [0, 10, 140, 205, 247, 289], "0408225": [0, 10, 140, 205, 247, 289], "pyrenochaeta": [0, 10, 140, 205, 247, 289], "ds3say3a": [0, 10, 140, 205, 247, 289], "stagonospora": [0, 10, 140, 205, 247, 289], "src1lsm3a": [0, 10, 140, 205, 247, 289], "jasicida": [0, 10, 140, 205, 247, 289], "mwb": [0, 10, 140, 205, 247, 289], "357": [0, 9, 10, 140, 205, 247, 289], "puniceispirillum": [0, 10, 140, 205, 247, 289], "imcc1322": [0, 10, 140, 205, 247, 289], "as12": [0, 10, 140, 205, 247, 289], "as13": [0, 10, 140, 205, 247, 289], "05631": [0, 10, 140, 205, 247, 289], "tav5": [0, 10, 140, 205, 247, 289], "burkholderiacea": [0, 10, 140, 205, 247, 289], "pba": [0, 10, 140, 205, 247, 289], "sugiyamaella": [0, 10, 140, 205, 247, 289], "lignohabitan": [0, 10, 140, 205, 247, 289], "peptoanaerobact": [0, 10, 140, 205, 247, 289], "stomatobaculum": [0, 10, 140, 205, 247, 289], "kipferlia": [0, 10, 140, 205, 247, 289], "bialata": [0, 10, 140, 205, 247, 289], "nubica": [0, 10, 140, 205, 247, 289], "ubiquitum": [0, 10, 140, 205, 247, 289], "parareesei": [0, 10, 140, 205, 247, 289], "caenispirillum": [0, 10, 140, 205, 247, 289], "ak4": [0, 10, 140, 205, 247, 289], "h13": [0, 10, 140, 205, 247, 289], "gemmatirosa": [0, 10, 140, 205, 247, 289], "kalamazoonesi": [0, 10, 140, 205, 247, 289], "sirexaa": [0, 10, 140, 205, 247, 289], "thermincola": [0, 10, 140, 205, 247, 289], "poten": [0, 10, 140, 205, 247, 289], "jr": [0, 10, 140, 205, 247, 289], "joshi_001": [0, 10, 140, 205, 247, 289], "lotononidi": [0, 10, 140, 205, 247, 289], "oscillatorial": [0, 10, 140, 205, 247, 289], "c42_a2020_001": [0, 10, 140, 205, 247, 289], "cryophilu": [0, 10, 140, 205, 247, 289], "cat2": [0, 10, 140, 205, 247, 289], "396": [0, 10, 140, 205, 247, 289], "angusta": [0, 10, 140, 205, 247, 289], "saanensi": [0, 10, 140, 205, 247, 289], "sp1pr4": [0, 10, 140, 205, 247, 289], "stercorirosori": [0, 10, 140, 205, 247, 289], "17103": [0, 10, 140, 205, 247, 289], "pasteurii": [0, 10, 140, 205, 247, 289], "23907": [0, 10, 140, 205, 247, 289], "crbip": [0, 10, 140, 205, 247, 289], "76": [0, 10, 140, 168, 205, 247, 289], "celeribact": [0, 10, 140, 205, 247, 289], "baekdonensi": [0, 10, 140, 205, 247, 289], "b30": [0, 10, 140, 205, 247, 289], "mycolicibact": [0, 10, 140, 205, 247, 289], "methyloferula": [0, 10, 140, 205, 247, 289], "ar4": [0, 10, 140, 205, 247, 289], "nk3a76": [0, 10, 140, 205, 247, 289], "nk3b98": [0, 10, 140, 205, 247, 289], "nk3d112": [0, 10, 140, 205, 247, 289], "nk4a136": [0, 10, 140, 205, 247, 289], "nk4a144": [0, 10, 140, 205, 247, 289], "nk4a179": [0, 10, 140, 205, 247, 289], "strb126": [0, 10, 140, 205, 247, 289], "piezophilu": [0, 10, 140, 205, 247, 289], "c1tlv30": [0, 10, 140, 205, 247, 289], "cutaneotrichosporon": [0, 10, 140, 205, 247, 289], "oleaginosum": [0, 10, 140, 205, 247, 289], "g2": [0, 10, 140, 205, 247, 289], "fulvivirga": [0, 10, 140, 205, 247, 289], "imtechensi": [0, 10, 140, 205, 247, 289], "ak7": [0, 10, 140, 205, 247, 289], "formicica": [0, 10, 140, 205, 247, 289], "smsp": [0, 10, 140, 205, 247, 289], "schleiferia": [0, 10, 140, 205, 247, 289], "yellowston": [0, 10, 140, 205, 247, 289], "zinderia": [0, 10, 140, 205, 247, 289], "mageeibacillu": [0, 10, 140, 205, 247, 289], "upii9": [0, 10, 140, 205, 247, 289], "acidiphilu": [0, 10, 140, 205, 247, 289], "sj4": [0, 10, 140, 205, 247, 289], "mp688": [0, 10, 140, 205, 247, 289], "nanosalina": [0, 10, 140, 205, 247, 289], "j07ab43": [0, 10, 140, 205, 247, 289], "nanosalinarum": [0, 10, 140, 205, 247, 289], "j07ab56": [0, 10, 140, 205, 247, 289], "plautia": [0, 10, 140, 205, 247, 289], "stali": [0, 10, 140, 205, 247, 289], "ulvanivoran": [0, 10, 140, 205, 247, 289], "phytopythium": [0, 10, 140, 205, 247, 289], "vexan": [0, 10, 140, 205, 247, 289], "br484": [0, 10, 140, 205, 247, 289], "hgf2": [0, 10, 140, 205, 247, 289], "hgb5": [0, 10, 140, 205, 247, 289], "fosc": [0, 10, 140, 205, 247, 289], "spheciospongia": [0, 10, 140, 205, 247, 289], "sar116": [0, 10, 140, 205, 247, 289], "alpha": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 140, 194, 205, 221, 247, 289, 292, 325], "proteobacterium": [0, 10, 140, 205, 247, 289], "himb100": [0, 10, 140, 205, 247, 289], "fo": [0, 10, 140, 205, 247, 289], "beg1": [0, 10, 140, 205, 247, 289], "caldanaerobact": [0, 10, 140, 205, 247, 289], "tengcongensi": [0, 10, 140, 205, 247, 289], "mb4": [0, 10, 140, 205, 247, 289], "iranicum": [0, 10, 140, 205, 247, 289], "um_tjl": [0, 10, 140, 205, 247, 289], "tl1": [0, 10, 140, 205, 247, 289], "geojedonensi": [0, 10, 140, 205, 247, 289], "agropyri": [0, 10, 140, 205, 247, 289], "asinibacterium": [0, 10, 140, 205, 247, 289], "or53": [0, 10, 140, 205, 247, 289], "regulorum": [0, 10, 140, 205, 247, 289], "7509": [0, 10, 140, 205, 247, 289], "florenca": [0, 10, 140, 205, 247, 289], "brassicacearum": [0, 10, 140, 205, 247, 289], "s1": [0, 10, 140, 205, 247, 289], "m24t3": [0, 10, 140, 205, 247, 289], "desulfosarcina": [0, 10, 140, 205, 247, 289], "bus5": [0, 10, 140, 205, 247, 289], "aminobact": [0, 10, 140, 205, 247, 289], "j41": [0, 10, 140, 205, 247, 289], "j33": [0, 10, 140, 205, 247, 289], "j37": [0, 10, 140, 205, 247, 289], "j32": [0, 10, 140, 205, 247, 289], "j14": [0, 10, 140, 205, 247, 289], "j39": [0, 10, 140, 205, 247, 289], "luteimona": [0, 10, 140, 205, 247, 289], "j29": [0, 10, 140, 205, 247, 289], "j54": [0, 10, 140, 205, 247, 289], "delemar": [0, 10, 140, 205, 247, 289], "mogibacterium": [0, 10, 140, 205, 247, 289], "cm50": [0, 10, 140, 205, 247, 289], "desulfurispirillum": [0, 10, 140, 205, 247, 289], "s5": [0, 10, 140, 205, 247, 289], "posidonica": [0, 10, 140, 205, 247, 289], "ivia": [0, 10, 140, 205, 247, 289], "po": [0, 10, 140, 191, 205, 214, 247, 276, 289], "icm47": [0, 10, 140, 205, 247, 289], "bs2": [0, 10, 140, 205, 247, 289], "fobrc6": [0, 10, 140, 205, 247, 289], "fobrc9": [0, 10, 140, 205, 247, 289], "msx8b": [0, 10, 140, 205, 247, 289], "cm6": [0, 10, 140, 205, 247, 289], "as16": [0, 10, 140, 205, 247, 289], "obrc5": [0, 10, 140, 205, 247, 289], "msx33": [0, 10, 140, 205, 247, 289], "casaltella": [0, 10, 140, 205, 247, 289], "fenollaria": [0, 10, 140, 205, 247, 289], "levyella": [0, 10, 140, 205, 247, 289], "provencensi": [0, 10, 140, 205, 247, 289], "scgc": [0, 10, 140, 205, 247, 289], "aaa027": [0, 10, 140, 205, 247, 289], "n21": [0, 10, 140, 205, 247, 289], "granulicella": [0, 10, 140, 205, 247, 289], "mallensi": [0, 10, 140, 205, 247, 289], "mp5actx8": [0, 10, 140, 205, 247, 289], "tundricola": [0, 10, 140, 205, 247, 289], "mp5actx9": [0, 10, 140, 205, 247, 289], "x2": [0, 10, 140, 205, 247, 289], "wsm2230": [0, 10, 140, 205, 247, 289], "jasonia": [0, 10, 140, 205, 247, 289], "km1": [0, 10, 140, 205, 247, 289], "neofelifaeci": [0, 10, 140, 205, 247, 289], "59395": [0, 10, 140, 205, 247, 289], "diplocarpon": [0, 10, 140, 205, 247, 289], "salpingoeca": [0, 10, 140, 205, 247, 289], "rosetta": [0, 10, 140, 205, 247, 289], "metal": [0, 10, 140, 205, 247, 289], "cf5": [0, 10, 140, 205, 247, 289], "dilworthii": [0, 10, 140, 205, 247, 289], "proliferatum": [0, 10, 140, 205, 247, 289], "palaeococcu": [0, 10, 140, 205, 247, 289], "dy20341": [0, 10, 140, 205, 247, 289], "17376": [0, 10, 140, 205, 247, 289], "multimorphosa": [0, 10, 140, 205, 247, 289], "102226": [0, 10, 140, 205, 247, 289], "wulumuqiensi": [0, 10, 140, 205, 247, 289], "r12": [0, 10, 140, 205, 247, 289], "moru": [0, 10, 140, 205, 247, 289], "concha": [0, 10, 140, 205, 247, 289], "lacinutrix": [0, 10, 140, 205, 247, 289], "5h": [0, 10, 140, 205, 247, 289], "4h": [0, 10, 140, 205, 247, 289], "ye": [0, 2, 10, 140, 205, 247, 289, 323], "23975": [0, 10, 140, 205, 247, 289], "heterobasidion": [0, 10, 140, 205, 247, 289], "indiana": [0, 10, 140, 205, 247, 289], "argenteu": [0, 10, 140, 205, 247, 289], "m21126": [0, 10, 140, 205, 247, 289], "moutnovskia": [0, 10, 140, 205, 247, 289], "cal575": [0, 10, 140, 205, 247, 289], "agneti": [0, 10, 140, 205, 247, 289], "lebetimona": [0, 10, 140, 205, 247, 289], "js170": [0, 10, 140, 205, 247, 289], "polymorphum": [0, 10, 140, 205, 247, 289], "sl003b": [0, 10, 140, 205, 247, 289], "26a1": [0, 10, 140, 205, 247, 289], "henc": [0, 10, 140, 205, 247, 289], "03": [0, 6, 10, 140, 205, 247, 289], "erosia": [0, 10, 140, 205, 247, 289], "biolep03": [0, 10, 140, 205, 247, 289], "desouzaii": [0, 10, 140, 205, 247, 289], "tcc079e": [0, 10, 140, 205, 247, 289], "galatii": [0, 10, 140, 205, 247, 289], "tcc219": [0, 10, 140, 205, 247, 289], "oncopeltii": [0, 10, 140, 205, 247, 289], "tcc290e": [0, 10, 140, 205, 247, 289], "desmospora": [0, 10, 140, 205, 247, 289], "8437": [0, 10, 140, 205, 247, 289], "kle": [0, 10, 140, 205, 247, 289], "1280": [0, 10, 140, 205, 247, 289], "himastatinicu": [0, 10, 140, 205, 247, 289], "53653": [0, 10, 140, 205, 247, 289], "td01": [0, 10, 140, 205, 247, 289], "lonarensi": [0, 10, 140, 205, 247, 289], "mpl": [0, 10, 140, 205, 247, 289], "f0473": [0, 10, 140, 205, 247, 289], "f0441": [0, 10, 140, 205, 247, 289], "f0442": [0, 10, 140, 205, 247, 289], "sedimentitalea": [0, 10, 140, 205, 247, 289], "24252": [0, 10, 140, 205, 247, 289], "135": [0, 10, 140, 167, 205, 247, 289], "cryobacterium": [0, 10, 140, 205, 247, 289], "roopkundens": [0, 10, 140, 205, 247, 289], "daldinia": [0, 10, 140, 205, 247, 289], "ec12": [0, 10, 140, 205, 247, 289], "ci": [0, 10, 140, 205, 247, 289], "4a": [0, 10, 140, 205, 247, 289], "1501": [0, 10, 140, 205, 247, 289], "ang1": [0, 10, 140, 205, 247, 289], "imcc9063": [0, 10, 140, 205, 247, 289], "verrucosispora": [0, 10, 140, 205, 247, 289], "fimbriimona": [0, 10, 140, 205, 247, 289], "gsoil": [0, 10, 140, 205, 247, 289], "348": [0, 10, 140, 205, 247, 289], "parapolymorpha": [0, 10, 140, 205, 247, 289], "weihenstephanensi": [0, 10, 140, 205, 247, 289], "r9": [0, 10, 140, 205, 247, 289], "0317": [0, 10, 140, 205, 247, 289], "defluviitoga": [0, 10, 140, 205, 247, 289], "tunisiensi": [0, 10, 140, 205, 247, 289], "nitrosarchaeum": [0, 10, 140, 205, 247, 289], "limnium": [0, 10, 140, 205, 247, 289], "sfb1": [0, 10, 140, 205, 247, 289], "s17": [0, 10, 140, 205, 247, 289], "t7": [0, 10, 140, 205, 247, 289], "yayanosii": [0, 10, 140, 205, 247, 289], "phenacola": [0, 10, 140, 205, 247, 289], "pave": [0, 10, 140, 205, 247, 289], "sideri": [0, 10, 140, 205, 247, 289], "montipora": [0, 10, 140, 205, 247, 289], "stflb209": [0, 10, 140, 205, 247, 289], "p8": [0, 10, 140, 205, 247, 289], "kc8": [0, 10, 140, 205, 247, 289], "ald01": [0, 10, 140, 205, 247, 289], "volucri": [0, 10, 140, 205, 247, 289], "24379": [0, 10, 140, 205, 247, 289], "nuruki": [0, 10, 140, 205, 247, 289], "s6": [0, 10, 140, 205, 247, 289], "senegalens": [0, 10, 140, 205, 247, 289], "kurthia": [0, 10, 140, 205, 247, 289], "dielmo": [0, 10, 140, 205, 247, 289], "senegalensi": [0, 10, 140, 205, 247, 289], "aquamarina": [0, 10, 140, 205, 247, 289], "119918": [0, 10, 140, 205, 247, 289], "hp15": [0, 10, 140, 205, 247, 289], "sulfidiphilu": [0, 10, 140, 205, 247, 289], "hl": [0, 10, 140, 205, 247, 289], "ebgr7": [0, 10, 140, 205, 247, 289], "viennensi": [0, 10, 140, 205, 247, 289], "en76": [0, 10, 140, 205, 247, 289], "hw567": [0, 10, 140, 205, 247, 289], "deferrisoma": [0, 10, 140, 205, 247, 289], "s3r1": [0, 10, 140, 205, 247, 289], "fth1": [0, 10, 140, 205, 247, 289], "a28l": [0, 10, 140, 205, 247, 289], "wsm2793": [0, 10, 140, 205, 247, 289], "wsm3983": [0, 10, 140, 205, 247, 289], "wsm3224": [0, 10, 140, 205, 247, 289], "wsm3626": [0, 10, 140, 205, 247, 289], "arr65": [0, 10, 140, 205, 247, 289], "rhopaloa": [0, 10, 140, 205, 247, 289], "wsm1721": [0, 10, 140, 205, 247, 289], "rat": [0, 10, 140, 205, 247, 289], "subglacial": [0, 10, 140, 205, 247, 289], "2481": [0, 10, 140, 205, 247, 289], "sy8519": [0, 10, 140, 205, 247, 289], "ibun": [0, 10, 140, 205, 247, 289], "ochrovirga": [0, 10, 140, 205, 247, 289], "4557": [0, 10, 140, 205, 247, 289], "pm": [0, 10, 140, 205, 247, 289], "demequina": [0, 10, 140, 205, 247, 289], "mangrovi": [0, 10, 140, 205, 247, 289], "citricoccu": [0, 10, 140, 205, 247, 289], "ch26a": [0, 10, 140, 205, 247, 289], "oceaniovalibu": [0, 10, 140, 205, 247, 289], "guishaninsula": [0, 10, 140, 205, 247, 289], "jlt2003": [0, 10, 140, 205, 247, 289], "aminicenant": [0, 10, 140, 205, 247, 289], "aaa252": [0, 10, 140, 205, 247, 289], "a02": [0, 10, 140, 205, 247, 289], "zymoseptoria": [0, 10, 140, 205, 247, 289], "moranella": [0, 10, 140, 205, 247, 289], "endobia": [0, 10, 140, 205, 247, 289], "lutzii": [0, 10, 140, 205, 247, 289], "anditalea": [0, 10, 140, 205, 247, 289], "andensi": [0, 10, 140, 205, 247, 289], "alo": [0, 10, 140, 205, 247, 289], "alfalfa": [0, 10, 140, 205, 247, 289], "vam": [0, 10, 140, 205, 247, 289], "acetobacteracea": [0, 10, 140, 205, 247, 289], "5844": [0, 10, 140, 205, 247, 289], "thermoplasmatal": [0, 10, 140, 205, 247, 289], "archaeon": [0, 10, 140, 205, 247, 289], "brna1": [0, 10, 140, 205, 247, 289], "tb67": [0, 10, 140, 205, 247, 289], "bmg51109": [0, 10, 140, 205, 247, 289], "br816": [0, 10, 140, 205, 247, 289], "baldaniorum": [0, 10, 140, 205, 247, 289], "93223": [0, 10, 140, 205, 247, 289], "luchuensi": [0, 10, 140, 205, 247, 289], "4308": [0, 10, 140, 205, 247, 289], "halonotiu": [0, 10, 140, 205, 247, 289], "j07hn4": [0, 10, 140, 205, 247, 289], "nsp22": [0, 10, 140, 205, 247, 289], "grimmia": [0, 10, 140, 205, 247, 289], "dasiensi": [0, 10, 140, 205, 247, 289], "10888": [0, 10, 140, 205, 247, 289], "porticoccu": [0, 10, 140, 205, 247, 289], "mctg13d": [0, 10, 140, 205, 247, 289], "solidip": [0, 10, 140, 205, 247, 289], "rwandensi": [0, 10, 140, 205, 247, 289], "thiolapillu": [0, 10, 140, 205, 247, 289], "brandeum": [0, 10, 140, 205, 247, 289], "25146": [0, 10, 140, 205, 247, 289], "hgb0015": [0, 10, 140, 205, 247, 289], "paenisporosarcina": [0, 10, 140, 205, 247, 289], "hgh0030": [0, 10, 140, 205, 247, 289], "hgb0020": [0, 10, 140, 205, 247, 289], "hgs0025": [0, 10, 140, 205, 247, 289], "hps0048": [0, 10, 140, 205, 247, 289], "hpp0074": [0, 10, 140, 205, 247, 289], "hpp0048": [0, 10, 140, 205, 247, 289], "mccc": [0, 10, 140, 205, 247, 289], "1a05965": [0, 10, 140, 205, 247, 289], "13788": [0, 10, 140, 205, 247, 289], "hgh0039": [0, 10, 140, 205, 247, 289], "hfh0082": [0, 10, 140, 205, 247, 289], "mesoamericanum": [0, 10, 140, 205, 247, 289], "stm3625": [0, 10, 140, 205, 247, 289], "chromiiresisten": [0, 10, 140, 205, 247, 289], "jg": [0, 10, 140, 205, 247, 289], "eubayanu": [0, 10, 140, 205, 247, 289], "aquiluna": [0, 10, 140, 205, 247, 289], "imcc13023": [0, 10, 140, 205, 247, 289], "hepatospora": [0, 10, 140, 205, 247, 289], "eriocheir": [0, 10, 140, 205, 247, 289], "enterospora": [0, 10, 140, 205, 247, 289], "canceri": [0, 10, 140, 205, 247, 289], "agarilytica": [0, 10, 140, 205, 247, 289], "db5": [0, 10, 140, 205, 247, 289], "sk140": [0, 10, 140, 205, 247, 289], "sk643": [0, 10, 140, 205, 247, 289], "gxf4": [0, 10, 140, 205, 247, 289], "pao19": [0, 10, 140, 205, 247, 289], "yi23": [0, 10, 140, 205, 247, 289], "coprobact": [0, 10, 140, 205, 247, 289], "fastidiosu": [0, 10, 140, 205, 247, 289], "nsb1": [0, 10, 140, 205, 247, 289], "limnohabitan": [0, 10, 140, 205, 247, 289], "rim28": [0, 10, 140, 205, 247, 289], "rim47": [0, 10, 140, 205, 247, 289], "n2": [0, 10, 140, 205, 247, 289], "n5": [0, 10, 140, 205, 247, 289], "methylopila": [0, 10, 140, 205, 247, 289], "m107": [0, 10, 140, 205, 247, 289], "icm39": [0, 10, 140, 205, 247, 289], "mste9": [0, 10, 140, 205, 247, 289], "philipii": [0, 10, 140, 205, 247, 289], "364d": [0, 10, 140, 205, 247, 289], "paenirhodobact": [0, 10, 140, 205, 247, 289], "enshiensi": [0, 10, 140, 205, 247, 289], "ruben": [0, 10, 140, 205, 247, 289], "ccb_us3_uf1": [0, 10, 140, 205, 247, 289], "yellowstonensi": [0, 10, 140, 205, 247, 289], "mk1": [0, 10, 140, 205, 247, 289], "bv3ac4": [0, 10, 140, 205, 247, 289], "bv2f7": [0, 10, 140, 205, 247, 289], "bv3c26": [0, 10, 140, 205, 247, 289], "coriobacteriacea": [0, 10, 140, 205, 247, 289], "bv3ac1": [0, 10, 140, 205, 247, 289], "bv3c16": [0, 10, 140, 205, 247, 289], "pamc": [0, 10, 140, 205, 247, 289], "21119": [0, 10, 140, 205, 247, 289], "26605": [0, 10, 140, 205, 247, 289], "26617": [0, 10, 140, 205, 247, 289], "31y": [0, 10, 140, 205, 247, 289], "ejy3": [0, 10, 140, 205, 247, 289], "anoph": [0, 10, 140, 205, 247, 289], "nuhp1": [0, 10, 140, 205, 247, 289], "ph3": [0, 10, 140, 205, 247, 289], "gfaj": [0, 10, 140, 205, 247, 289], "rue61a": [0, 10, 140, 205, 247, 289], "ccge": [0, 10, 140, 205, 247, 289], "502": [0, 10, 140, 205, 247, 289], "lc363": [0, 10, 140, 205, 247, 289], "73b": [0, 10, 140, 205, 247, 289], "141": [0, 10, 140, 166, 168, 205, 247, 289], "flavalba": [0, 10, 140, 205, 247, 289], "45200": [0, 10, 140, 205, 247, 289], "doosanens": [0, 10, 140, 205, 247, 289], "cau": [0, 10, 140, 205, 247, 289], "212": [0, 10, 140, 205, 247, 289], "45436": [0, 10, 140, 205, 247, 289], "45133": [0, 10, 140, 205, 247, 289], "fodinicurvata": [0, 10, 140, 205, 247, 289], "fenggangensi": [0, 10, 140, 205, 247, 289], "21160": [0, 10, 140, 205, 247, 289], "21159": [0, 10, 140, 205, 247, 289], "zhanjiangensi": [0, 10, 140, 205, 247, 289], "21076": [0, 10, 140, 205, 247, 289], "19733": [0, 10, 140, 205, 247, 289], "19973": [0, 10, 140, 205, 247, 289], "ponticauli": [0, 10, 140, 205, 247, 289], "19734": [0, 10, 140, 205, 247, 289], "mesophilum": [0, 10, 140, 205, 247, 289], "19309": [0, 10, 140, 205, 247, 289], "kp2": [0, 10, 140, 205, 247, 289], "gonapodya": [0, 10, 140, 205, 247, 289], "prolifera": [0, 10, 140, 205, 247, 289], "jel478": [0, 10, 140, 205, 247, 289], "sar86": [0, 10, 140, 205, 247, 289], "sar86a": [0, 10, 140, 205, 247, 289], "sar86b": [0, 10, 140, 205, 247, 289], "magnetococcu": [0, 10, 140, 205, 247, 289], "jc4": [0, 10, 140, 205, 247, 289], "p179": [0, 10, 140, 205, 247, 289], "cinnabarinu": [0, 10, 140, 205, 247, 289], "ll": [0, 10, 140, 205, 247, 289, 323], "bosea": [0, 10, 140, 205, 247, 289], "117": [0, 10, 140, 205, 247, 289], "doa9": [0, 10, 140, 205, 247, 289], "beijingensi": [0, 10, 140, 205, 247, 289], "bss20135": [0, 10, 140, 205, 247, 289], "sg25": [0, 10, 140, 205, 247, 289], "marin": [0, 10, 140, 205, 247, 289], "thaumarchaeot": [0, 10, 140, 205, 247, 289], "629": [0, 10, 140, 205, 247, 289], "i23": [0, 10, 140, 205, 247, 289], "b18": [0, 10, 140, 205, 247, 289], "buddi": [0, 10, 140, 205, 247, 289], "pleomorpha": [0, 10, 140, 205, 247, 289], "grape": [0, 10, 140, 205, 247, 289], "88a": [0, 10, 140, 205, 247, 289], "35w": [0, 10, 140, 205, 247, 289], "37ma": [0, 10, 140, 205, 247, 289], "510": [0, 10, 140, 205, 247, 289], "melioribact": [0, 10, 140, 205, 247, 289], "p3m": [0, 10, 140, 205, 247, 289], "ligniniphilu": [0, 10, 140, 205, 247, 289], "e718": [0, 10, 140, 205, 247, 289], "cnt312": [0, 10, 140, 205, 247, 289], "cnh099": [0, 10, 140, 205, 247, 289], "cnq490": [0, 10, 140, 205, 247, 289], "xanthomarina": [0, 10, 140, 205, 247, 289], "gelatinilytica": [0, 10, 140, 205, 247, 289], "numazuensi": [0, 10, 140, 205, 247, 289], "arbusti": [0, 10, 140, 205, 247, 289], "sl206": [0, 10, 140, 205, 247, 289], "paraintracellular": [0, 10, 140, 205, 247, 289], "curiea": [0, 10, 140, 205, 247, 289], "pseudomassariella": [0, 10, 140, 205, 247, 289], "vexata": [0, 10, 140, 205, 247, 289], "homolaphlycti": [0, 10, 140, 205, 247, 289], "polyrhiza": [0, 10, 140, 205, 247, 289], "ap12": [0, 10, 140, 205, 247, 289], "ap49": [0, 10, 140, 205, 247, 289], "cf080": [0, 10, 140, 205, 247, 289], "cf122": [0, 10, 140, 205, 247, 289], "cf136": [0, 10, 140, 205, 247, 289], "cf444": [0, 10, 140, 205, 247, 289], "gm21": [0, 10, 140, 205, 247, 289], "yr522": [0, 10, 140, 205, 247, 289], "phyllobacterium": [0, 10, 140, 205, 247, 289], "yr531": [0, 10, 140, 205, 247, 289], "tritrichomona": [0, 10, 140, 205, 247, 289], "foetu": [0, 10, 140, 205, 247, 289], "101934": [0, 10, 140, 205, 247, 289], "101966": [0, 10, 140, 205, 247, 289], "102082": [0, 10, 140, 205, 247, 289], "102129": [0, 10, 140, 205, 247, 289], "102136": [0, 10, 140, 205, 247, 289], "102143": [0, 10, 140, 205, 247, 289], "102159": [0, 10, 140, 205, 247, 289], "102529": [0, 10, 140, 205, 247, 289], "102637": [0, 10, 140, 205, 247, 289], "a162": [0, 10, 140, 205, 247, 289], "varian": [0, 10, 140, 205, 247, 289], "dca": [0, 10, 140, 205, 247, 289], "ornithinibacillu": [0, 10, 140, 205, 247, 289], "scapharca": [0, 10, 140, 205, 247, 289], "tw25": [0, 10, 140, 205, 247, 289], "sy8": [0, 10, 140, 205, 247, 289], "dr1": [0, 10, 140, 205, 247, 289], "geminisphaera": [0, 10, 140, 205, 247, 289], "colitermitum": [0, 10, 140, 205, 247, 289], "tav2": [0, 10, 140, 205, 247, 289], "furukawaii": [0, 10, 140, 205, 247, 289], "9mfcol3": [0, 10, 140, 205, 247, 289], "161mfsha2": [0, 10, 140, 205, 247, 289], "162mfsha1": [0, 10, 140, 205, 247, 289], "292mf": [0, 10, 140, 205, 247, 289], "ertm2": [0, 10, 140, 205, 247, 289], "lappah": [0, 10, 140, 205, 247, 289], "mspmp": [0, 10, 140, 205, 247, 289], "m5": [0, 10, 140, 205, 247, 289], "moorea": [0, 10, 140, 205, 247, 289], "producen": [0, 10, 140, 205, 247, 289], "3l": [0, 10, 140, 205, 247, 289], "p16": [0, 10, 140, 205, 247, 289], "hmica12": [0, 10, 140, 205, 247, 289], "tumebacillu": [0, 10, 140, 205, 247, 289], "amel2xe9": [0, 10, 140, 205, 247, 289], "atexab": [0, 10, 140, 205, 247, 289], "d23": [0, 10, 140, 205, 247, 289], "bolea5": [0, 10, 140, 205, 247, 289], "pstaah": [0, 10, 140, 205, 247, 289], "124": [0, 10, 140, 205, 247, 289], "fxanac1": [0, 10, 140, 205, 247, 289], "cell2": [0, 10, 140, 205, 247, 289], "2812b": [0, 10, 140, 205, 247, 289], "135mfcol5": [0, 10, 140, 205, 247, 289], "aljt": [0, 10, 140, 205, 247, 289], "ald1": [0, 10, 140, 205, 247, 289], "almg11": [0, 10, 140, 205, 247, 289], "ale31": [0, 10, 140, 205, 247, 289], "fb": [0, 10, 140, 205, 247, 289], "tc5": [0, 10, 140, 205, 247, 289], "if05": [0, 10, 140, 205, 247, 289], "l8": [0, 10, 140, 205, 247, 289], "km09": [0, 10, 140, 205, 247, 289], "lau": [0, 10, 140, 205, 247, 289], "alj7": [0, 10, 140, 205, 247, 289], "alj11": [0, 10, 140, 205, 247, 289], "alj16": [0, 10, 140, 205, 247, 289], "c75": [0, 10, 140, 205, 247, 289], "ustilaginoidea": [0, 10, 140, 205, 247, 289], "bmg111209": [0, 10, 140, 205, 247, 289], "311": [0, 10, 140, 205, 247, 289], "bicirculan": [0, 10, 140, 205, 247, 289], "nasuia": [0, 10, 140, 205, 247, 289], "deltocephalinicola": [0, 10, 140, 205, 247, 289], "alf": [0, 10, 140, 205, 247, 289], "euryhalocauli": [0, 10, 140, 205, 247, 289], "caribicu": [0, 10, 140, 205, 247, 289], "acc21": [0, 10, 140, 205, 247, 289], "champanellensi": [0, 10, 140, 205, 247, 289], "18p13": [0, 10, 140, 205, 247, 289], "17042": [0, 10, 140, 205, 247, 289], "donghuensi": [0, 10, 140, 205, 247, 289], "condimenti": [0, 10, 140, 205, 247, 289], "richelia": [0, 10, 140, 205, 247, 289], "hh01": [0, 10, 140, 205, 247, 289], "imtechella": [0, 10, 140, 205, 247, 289], "r4": [0, 10, 140, 205, 247, 289], "368": [0, 10, 140, 205, 247, 289], "draconibacterium": [0, 10, 140, 205, 247, 289], "oriental": [0, 10, 140, 205, 247, 289], "xanthobacteracea": [0, 10, 140, 205, 247, 289], "501b": [0, 10, 140, 205, 247, 289], "mott36i": [0, 10, 140, 205, 247, 289], "h4y": [0, 10, 140, 205, 247, 289], "pratensi": [0, 10, 140, 205, 247, 289], "33331": [0, 10, 140, 205, 247, 289], "123mfchir2": [0, 10, 140, 205, 247, 289], "cny236": [0, 10, 140, 205, 247, 289], "cnt372": [0, 10, 140, 205, 247, 289], "cny243": [0, 10, 140, 205, 247, 289], "kte30": [0, 10, 140, 205, 247, 289], "kte114": [0, 10, 140, 205, 247, 289], "kte151": [0, 10, 140, 205, 247, 289], "kte11": [0, 10, 140, 205, 247, 289], "kte31": [0, 10, 140, 205, 247, 289], "kte32": [0, 10, 140, 205, 247, 289], "vitrella": [0, 10, 140, 205, 247, 289], "brassicaformi": [0, 10, 140, 205, 247, 289], "ccmp3155": [0, 10, 140, 205, 247, 289], "142mfcol3": [0, 10, 140, 205, 247, 289], "351mftsu5": [0, 10, 140, 205, 247, 289], "303mfcol5": [0, 10, 140, 205, 247, 289], "348mftsu5": [0, 10, 140, 205, 247, 289], "360mftsu5": [0, 10, 140, 205, 247, 289], "terracoccu": [0, 10, 140, 205, 247, 289], "273mftsu3": [0, 10, 140, 205, 247, 289], "oxytricha": [0, 10, 140, 205, 247, 289], "trifallax": [0, 10, 140, 205, 247, 289], "catenovulum": [0, 10, 140, 205, 247, 289], "9431": [0, 10, 140, 205, 247, 289], "9605": [0, 10, 140, 205, 247, 289], "geitlerinema": [0, 10, 140, 205, 247, 289], "7407": [0, 10, 140, 205, 247, 289], "7428": [0, 10, 140, 205, 247, 289], "7113": [0, 10, 140, 205, 247, 289], "10802": [0, 10, 140, 205, 247, 289], "chamaesiphon": [0, 10, 140, 205, 247, 289], "minutu": [0, 10, 140, 205, 247, 289], "6605": [0, 10, 140, 205, 247, 289], "7502": [0, 10, 140, 205, 247, 289], "6406": [0, 10, 140, 205, 247, 289], "sublineola": [0, 10, 140, 205, 247, 289], "9339": [0, 10, 140, 205, 247, 289], "gw103": [0, 10, 140, 205, 247, 289], "conradii": [0, 10, 140, 205, 247, 289], "hz254": [0, 10, 140, 205, 247, 289], "arvoryza": [0, 10, 140, 205, 247, 289], "mre50": [0, 10, 140, 205, 247, 289], "rhinitidi": [0, 10, 140, 205, 247, 289], "gotlandica": [0, 10, 140, 205, 247, 289], "gd1": [0, 10, 140, 205, 247, 289], "fabrum": [0, 10, 140, 205, 247, 289], "c58": [0, 10, 140, 205, 247, 289], "nanhaiticu": [0, 10, 140, 205, 247, 289], "c448": [0, 10, 140, 205, 247, 289], "medellinensi": [0, 10, 140, 205, 247, 289], "3288": [0, 10, 140, 205, 247, 289], "huangheensi": [0, 10, 140, 205, 247, 289], "zhangzhouensi": [0, 10, 140, 205, 247, 289], "arenitalea": [0, 10, 140, 205, 247, 289], "blepharu": [0, 10, 140, 205, 247, 289], "feriruminatori": [0, 10, 140, 205, 247, 289], "m47t1": [0, 10, 140, 205, 247, 289], "psammophila": [0, 10, 140, 205, 247, 289], "swuensi": [0, 10, 140, 205, 247, 289], "kte52": [0, 10, 140, 205, 247, 289], "kte92": [0, 10, 140, 205, 247, 289], "kte96": [0, 10, 140, 205, 247, 289], "kte159": [0, 10, 140, 205, 247, 289], "injenensi": [0, 10, 140, 205, 247, 289], "m09": [0, 10, 140, 205, 247, 289], "0166": [0, 10, 140, 205, 247, 289], "st04": [0, 10, 140, 205, 247, 289], "mesotoga": [0, 10, 140, 205, 247, 289], "prima": [0, 10, 140, 205, 247, 289], "mesg1": [0, 10, 140, 205, 247, 289], "dalianensi": [0, 10, 140, 205, 247, 289], "blaberu": [0, 10, 140, 205, 247, 289], "giganteu": [0, 10, 140, 205, 247, 289], "ph10": [0, 10, 140, 205, 247, 289], "123": [0, 10, 140, 205, 247, 289, 323], "lig30": [0, 10, 140, 205, 247, 289], "hokkaidonensi": [0, 10, 140, 205, 247, 289], "18461": [0, 10, 140, 205, 247, 289], "snodgrassella": [0, 10, 140, 205, 247, 289], "alvi": [0, 10, 140, 205, 247, 289], "gilliamella": [0, 10, 140, 205, 247, 289], "apicola": [0, 10, 140, 205, 247, 289], "maddinglei": [0, 10, 140, 205, 247, 289], "mbc34": [0, 10, 140, 205, 247, 289], "osi": [0, 10, 140, 205, 247, 289], "mangrovimona": [0, 10, 140, 205, 247, 289], "yunxiaonensi": [0, 10, 140, 205, 247, 289], "m2012083": [0, 10, 140, 205, 247, 289], "thermogladiu": [0, 10, 140, 205, 247, 289], "caldera": [0, 10, 140, 205, 247, 289], "1633": [0, 10, 140, 205, 247, 289], "rm50": [0, 10, 140, 205, 247, 289], "ruminobact": [0, 10, 140, 205, 247, 289], "rm87": [0, 10, 140, 205, 247, 289], "bacteriovorax": [0, 10, 140, 205, 247, 289], "seq25_v": [0, 10, 140, 205, 247, 289], "bal6_x": [0, 10, 140, 205, 247, 289], "f52": [0, 10, 140, 205, 247, 289], "18671": [0, 10, 140, 205, 247, 289], "salifodina": [0, 10, 140, 205, 247, 289], "achlya": [0, 10, 140, 205, 247, 289], "hypogyna": [0, 10, 140, 205, 247, 289], "179": [0, 10, 140, 205, 247, 289], "daltonii": [0, 10, 140, 205, 247, 289], "frc": [0, 10, 140, 205, 247, 289], "hpa0509": [0, 10, 140, 205, 247, 289], "hpa0247": [0, 10, 140, 205, 247, 289], "kpl1814": [0, 10, 140, 205, 247, 289], "kpl1817": [0, 10, 140, 205, 247, 289], "kpl1818": [0, 10, 140, 205, 247, 289], "kpl1821": [0, 10, 140, 205, 247, 289], "kpl1824": [0, 10, 140, 205, 247, 289], "kpl1855": [0, 10, 140, 205, 247, 289], "kpl1856": [0, 10, 140, 205, 247, 289], "kpl1857": [0, 10, 140, 205, 247, 289], "kpl1859": [0, 10, 140, 205, 247, 289], "kpl1860": [0, 10, 140, 205, 247, 289], "hfh0086": [0, 10, 140, 205, 247, 289], "hgh0353": [0, 10, 140, 205, 247, 289], "kpl1838": [0, 10, 140, 205, 247, 289], "kpl1844": [0, 10, 140, 205, 247, 289], "kpl1852": [0, 10, 140, 205, 247, 289], "hpb0071": [0, 10, 140, 205, 247, 289], "hph0090": [0, 10, 140, 205, 247, 289], "hph0547": [0, 10, 140, 205, 247, 289], "hpa0037": [0, 10, 140, 205, 247, 289], "kpl1986": [0, 10, 140, 205, 247, 289], "kpl1989": [0, 10, 140, 205, 247, 289], "kpl1995": [0, 10, 140, 205, 247, 289], "kpl1996": [0, 10, 140, 205, 247, 289], "kpl1998": [0, 10, 140, 205, 247, 289], "kpl2004": [0, 10, 140, 205, 247, 289], "kpl2005": [0, 10, 140, 205, 247, 289], "kpl2009": [0, 10, 140, 205, 247, 289], "cnr698": [0, 10, 140, 205, 247, 289], "mbes04": [0, 10, 140, 205, 247, 289], "lz4w": [0, 10, 140, 205, 247, 289], "gallaecimona": [0, 10, 140, 205, 247, 289], "c100": [0, 10, 140, 205, 247, 289], "uw4": [0, 10, 140, 205, 247, 289], "mx01": [0, 10, 140, 205, 247, 289], "orchidophilum": [0, 10, 140, 205, 247, 289], "aa0539": [0, 10, 140, 205, 247, 289], "gemmata": [0, 10, 140, 205, 247, 289], "massiliana": [0, 10, 140, 205, 247, 289], "gw2": [0, 10, 140, 205, 247, 289], "chelatococcu": [0, 10, 140, 205, 247, 289], "gw1": [0, 10, 140, 205, 247, 289], "tibetensi": [0, 10, 140, 205, 247, 289], "y620": [0, 10, 140, 205, 247, 289], "b14": [0, 10, 140, 205, 247, 289], "mx": [0, 10, 140, 205, 247, 289], "az02": [0, 10, 140, 205, 247, 289], "ampelina": [0, 10, 140, 205, 247, 289], "tengchongensi": [0, 10, 140, 205, 247, 289], "77401": [0, 10, 140, 205, 247, 289], "jilinensi": [0, 10, 140, 205, 247, 289], "y1": [0, 10, 140, 205, 247, 289], "bornimens": [0, 10, 140, 205, 247, 289], "542": [0, 10, 140, 205, 247, 289], "1847": [0, 10, 140, 205, 247, 289], "3623": [0, 10, 140, 205, 247, 289], "110321": [0, 10, 140, 205, 247, 289], "3880": [0, 10, 140, 205, 247, 289], "1867": [0, 10, 140, 205, 247, 289], "4105": [0, 10, 140, 205, 247, 289], "284": [0, 10, 140, 205, 247, 289], "3862": [0, 10, 140, 205, 247, 289], "2168": [0, 10, 140, 166, 205, 247, 289], "3929": [0, 10, 140, 205, 247, 289], "2100": [0, 10, 140, 205, 247, 289], "713": [0, 10, 140, 205, 247, 289], "236": [0, 10, 140, 205, 247, 289], "758": [0, 10, 140, 205, 247, 289], "3789": [0, 10, 140, 205, 247, 289], "bis7": [0, 10, 140, 205, 247, 289], "xylona": [0, 10, 140, 205, 247, 289], "hevea": [0, 10, 140, 205, 247, 289], "tc161": [0, 10, 140, 205, 247, 289], "307": [0, 10, 140, 166, 205, 247, 289], "gba": [0, 10, 140, 205, 247, 289], "bo1": [0, 10, 140, 205, 247, 289], "mellif": [0, 10, 140, 205, 247, 289], "kullabergensi": [0, 10, 140, 205, 247, 289], "helsingborgensi": [0, 10, 140, 205, 247, 289], "kimbladii": [0, 10, 140, 205, 247, 289], "melliventri": [0, 10, 140, 205, 247, 289], "melli": [0, 10, 140, 205, 247, 289], "nectari": [0, 10, 140, 205, 247, 289], "110549": [0, 10, 140, 205, 247, 289], "s3pf19": [0, 10, 140, 205, 247, 289], "mv1": [0, 10, 140, 205, 247, 289], "altibact": [0, 10, 140, 205, 247, 289], "humireducen": [0, 10, 140, 205, 247, 289], "106098": [0, 10, 140, 205, 247, 289], "45392": [0, 10, 140, 205, 247, 289], "lsjc7": [0, 10, 140, 205, 247, 289], "mangrovibact": [0, 10, 140, 205, 247, 289], "mfb070": [0, 10, 140, 205, 247, 289], "dw": [0, 10, 140, 205, 247, 289], "0440": [0, 10, 140, 205, 247, 289], "1745": [0, 10, 140, 205, 247, 289], "1732": [0, 10, 140, 205, 247, 289], "1755": [0, 10, 140, 205, 247, 289], "rapamycinicu": [0, 10, 140, 205, 247, 289], "877": [0, 10, 140, 205, 247, 289], "f0543": [0, 10, 140, 205, 247, 289], "863": [0, 10, 140, 205, 247, 289], "f0517": [0, 10, 140, 205, 247, 289], "879": [0, 10, 140, 205, 247, 289], "f0557": [0, 10, 140, 205, 247, 289], "f0091": [0, 10, 140, 205, 247, 289], "689": [0, 10, 140, 205, 247, 289], "r7": [0, 10, 140, 205, 247, 289], "277": [0, 10, 140, 205, 247, 289], "kiost": [0, 10, 140, 205, 247, 289], "wg21": [0, 10, 140, 205, 247, 289], "ga3": [0, 10, 140, 205, 247, 289], "alkalibacterium": [0, 10, 140, 205, 247, 289], "ak22": [0, 10, 140, 205, 247, 289], "salimicrobium": [0, 10, 140, 205, 247, 289], "dfci": [0, 10, 140, 205, 247, 289], "flaviramulu": [0, 10, 140, 205, 247, 289], "ichthyoenteri": [0, 10, 140, 205, 247, 289], "th78": [0, 10, 140, 205, 247, 289], "6924": [0, 10, 140, 205, 247, 289], "mirantina": [0, 10, 140, 205, 247, 289], "tg": [0, 10, 140, 205, 247, 289], "pht": [0, 10, 140, 205, 247, 289], "mc24": [0, 10, 140, 205, 247, 289], "shenzhenensi": [0, 10, 140, 205, 247, 289], "clohesyomyc": [0, 10, 140, 205, 247, 289], "desulfuromona": [0, 10, 140, 205, 247, 289], "tf": [0, 10, 140, 205, 247, 289], "ihumii": [0, 10, 140, 205, 247, 289], "nosocomiicoccu": [0, 10, 140, 205, 247, 289], "enorma": [0, 10, 140, 205, 247, 289], "ve202": [0, 10, 140, 205, 247, 289], "ak27": [0, 10, 140, 205, 247, 289], "ghh01": [0, 10, 140, 205, 247, 289], "jm1": [0, 10, 140, 205, 247, 289], "fh1": [0, 10, 140, 205, 247, 289], "e463": [0, 10, 140, 205, 247, 289], "pacificimona": [0, 10, 140, 205, 247, 289], "gayadomona": [0, 10, 140, 205, 247, 289], "joobinieg": [0, 10, 140, 205, 247, 289], "g7": [0, 10, 140, 205, 247, 289], "au12": [0, 10, 140, 205, 247, 289], "md335": [0, 10, 140, 205, 247, 289], "firmicut": [0, 10, 140, 205, 247, 289], "m10": [0, 10, 140, 205, 247, 289], "md308": [0, 10, 140, 205, 247, 289], "asf519": [0, 10, 140, 205, 247, 289], "g3": [0, 10, 140, 205, 247, 289], "2012": [0, 5, 9, 10, 140, 165, 205, 247, 289], "carbekii": [0, 10, 140, 205, 247, 289], "j07hqx50": [0, 10, 140, 205, 247, 289], "j07hn6": [0, 10, 140, 205, 247, 289], "j07hr59": [0, 10, 140, 205, 247, 289], "praecaptivu": [0, 10, 140, 205, 247, 289], "pro95": [0, 10, 140, 205, 247, 289], "massiliogorilla": [0, 10, 140, 205, 247, 289], "huabeiensi": [0, 10, 140, 205, 247, 289], "hb2": [0, 10, 140, 205, 247, 289], "iguaniorum": [0, 10, 140, 205, 247, 289], "caucaseum": [0, 10, 140, 205, 247, 289], "mariniradiu": [0, 10, 140, 205, 247, 289], "ak6": [0, 10, 140, 205, 247, 289], "lanzarotensi": [0, 10, 140, 205, 247, 289], "chilensi": [0, 10, 140, 205, 247, 289], "45234": [0, 10, 140, 205, 247, 289], "2mfcol3": [0, 10, 140, 205, 247, 289], "bab": [0, 10, 140, 205, 247, 289], "paramicrosporidium": [0, 10, 140, 205, 247, 289], "saccamoeba": [0, 10, 140, 205, 247, 289], "arsenophonu": [0, 10, 140, 205, 247, 289], "hangzhou": [0, 10, 140, 205, 247, 289], "nilaparvata": [0, 10, 140, 205, 247, 289], "lugen": [0, 10, 140, 205, 247, 289], "tdu": [0, 10, 140, 205, 247, 289], "blastomona": [0, 10, 140, 205, 247, 289], "aap53": [0, 10, 140, 205, 247, 289], "aap62": [0, 10, 140, 205, 247, 289], "aap82": [0, 10, 140, 205, 247, 289], "rifrc": [0, 10, 140, 205, 247, 289], "imhoffiella": [0, 10, 140, 205, 247, 289], "hel_i_29": [0, 10, 140, 205, 247, 289], "hel_i_7": [0, 10, 140, 205, 247, 289], "hel1_85": [0, 10, 140, 205, 247, 289], "hel_i_88": [0, 10, 140, 205, 247, 289], "mar_2010_75": [0, 10, 140, 205, 247, 289], "salegentibact": [0, 10, 140, 205, 247, 289], "hel_i_6": [0, 10, 140, 205, 247, 289], "fgi182": [0, 10, 140, 205, 247, 289], "iv": [0, 10, 140, 205, 247, 289], "uba": [0, 10, 140, 205, 247, 289], "769": [0, 10, 140, 205, 247, 289], "cag": [0, 10, 140, 205, 247, 289], "207": [0, 10, 140, 205, 247, 289], "piscicida": [0, 10, 140, 205, 247, 289], "c07": [0, 10, 140, 205, 247, 289], "087": [0, 10, 140, 205, 247, 289], "endolissoclinum": [0, 10, 140, 205, 247, 289], "faulkneri": [0, 10, 140, 205, 247, 289], "urmo17wk12": [0, 10, 140, 205, 247, 289], "i8": [0, 10, 140, 205, 247, 289], "26508": [0, 10, 140, 205, 247, 289], "nafulsella": [0, 10, 140, 205, 247, 289], "turpanensi": [0, 10, 140, 205, 247, 289], "zlm": [0, 10, 140, 205, 247, 289], "manganicu": [0, 10, 140, 205, 247, 289], "26584": [0, 10, 140, 205, 247, 289], "ale6": [0, 10, 140, 205, 247, 289], "ale19": [0, 10, 140, 205, 247, 289], "akl19": [0, 10, 140, 205, 247, 289], "frischella": [0, 10, 140, 205, 247, 289], "perrara": [0, 10, 140, 205, 247, 289], "sediminibacterium": [0, 10, 140, 205, 247, 289], "c3": [0, 10, 140, 205, 247, 289], "89": [0, 10, 140, 205, 247, 289, 324, 325], "imh": [0, 10, 140, 205, 247, 289], "g5": [0, 10, 140, 205, 247, 289], "jc401": [0, 10, 140, 205, 247, 289], "aw25m09": [0, 10, 140, 205, 247, 289], "s7": [0, 10, 140, 205, 247, 289], "alr17": [0, 10, 140, 205, 247, 289], "kjj": [0, 10, 140, 205, 247, 289], "r20": [0, 10, 140, 205, 247, 289], "nm10": [0, 10, 140, 205, 247, 289], "1817d": [0, 10, 140, 205, 247, 289], "antibioticophila": [0, 10, 140, 205, 247, 289], "hepatobact": [0, 10, 140, 205, 247, 289], "penaei": [0, 10, 140, 205, 247, 289], "jhl": [0, 10, 140, 205, 247, 289], "kte172": [0, 10, 140, 205, 247, 289], "alvinia": [0, 10, 140, 205, 247, 289], "ep5": [0, 10, 140, 205, 247, 289], "gorillibacterium": [0, 10, 140, 205, 247, 289], "ae2015": [0, 10, 140, 205, 247, 289], "vcd2006": [0, 10, 140, 205, 247, 289], "ae3009": [0, 10, 140, 205, 247, 289], "xpd2006": [0, 10, 140, 205, 247, 289], "fc2001": [0, 10, 140, 205, 247, 289], "ae3006": [0, 10, 140, 205, 247, 289], "agr2160": [0, 10, 140, 205, 247, 289], "wcd3002": [0, 10, 140, 205, 247, 289], "vcb2006": [0, 10, 140, 205, 247, 289], "lc3010": [0, 10, 140, 205, 247, 289], "wcd2001": [0, 10, 140, 205, 247, 289], "xbb1001": [0, 10, 140, 205, 247, 289], "nc3005": [0, 10, 140, 205, 247, 289], "mc2013": [0, 10, 140, 205, 247, 289], "meira": [0, 10, 140, 205, 247, 289], "miltonrushii": [0, 10, 140, 205, 247, 289], "cy54": [0, 10, 140, 205, 247, 289], "beringensi": [0, 10, 140, 205, 247, 289], "chukchiensi": [0, 10, 140, 205, 247, 289], "ac460": [0, 10, 140, 205, 247, 289], "ac402": [0, 10, 140, 205, 247, 289], "ac466": [0, 10, 140, 205, 247, 289], "iso899": [0, 10, 140, 205, 247, 289], "lignilytica": [0, 10, 140, 205, 247, 289], "iso805n": [0, 10, 140, 205, 247, 289], "a9": [0, 10, 140, 205, 247, 289], "planktomarina": [0, 10, 140, 205, 247, 289], "temperata": [0, 10, 140, 205, 247, 289], "rca23": [0, 10, 140, 205, 247, 289], "spd3": [0, 10, 140, 205, 247, 289], "tissierellia": [0, 10, 140, 205, 247, 289], "sd6": [0, 10, 140, 205, 247, 289], "hampsonii": [0, 10, 140, 205, 247, 289], "30446": [0, 10, 140, 205, 247, 289], "l2c084a000": [0, 10, 140, 205, 247, 289], "lnjc398b00": [0, 10, 140, 205, 247, 289], "massiliosenegalensi": [0, 10, 140, 205, 247, 289], "jc6": [0, 10, 140, 205, 247, 289], "insuavi": [0, 10, 140, 205, 247, 289], "axx": [0, 10, 140, 205, 247, 289], "arcticibact": [0, 10, 140, 205, 247, 289], "svalbardensi": [0, 10, 140, 205, 247, 289], "mn12": [0, 10, 140, 205, 247, 289], "cnt318": [0, 10, 140, 205, 247, 289], "taa040": [0, 10, 140, 205, 247, 289], "jc48": [0, 10, 140, 205, 247, 289], "jc50": [0, 10, 140, 205, 247, 289], "23838": [0, 10, 140, 205, 247, 289], "magnetospira": [0, 10, 140, 205, 247, 289], "qh": [0, 10, 140, 205, 247, 289], "taa204": [0, 10, 140, 205, 247, 289], "methanomethylophilu": [0, 10, 140, 205, 247, 289], "alvu": [0, 10, 140, 205, 247, 289], "mx1201": [0, 10, 140, 205, 247, 289], "thp": [0, 10, 140, 205, 247, 289], "otcp": [0, 10, 140, 205, 247, 289], "thu": [0, 10, 140, 205, 247, 289], "djelfimassiliensi": [0, 10, 140, 205, 247, 289], "goleimassiliensi": [0, 10, 140, 205, 247, 289], "13867": [0, 10, 140, 205, 247, 289], "gaetbulicola": [0, 10, 140, 205, 247, 289], "gung47": [0, 10, 140, 205, 247, 289], "geofonti": [0, 10, 140, 205, 247, 289], "opf15": [0, 10, 140, 205, 247, 289], "4661": [0, 10, 140, 205, 247, 289], "intestinimona": [0, 10, 140, 205, 247, 289], "butyriciproducen": [0, 10, 140, 205, 247, 289], "hansupu": [0, 10, 140, 205, 247, 289], "ohsu_i": [0, 10, 140, 205, 247, 289], "c4": [0, 10, 140, 205, 247, 289], "ohsu_iii": [0, 10, 140, 205, 247, 289], "18900": [0, 10, 140, 205, 247, 289], "urha0056": [0, 10, 140, 205, 247, 289], "urha0036": [0, 10, 140, 205, 247, 289], "urhb0036": [0, 10, 140, 205, 247, 289], "urhd0025": [0, 10, 140, 205, 247, 289], "alt199": [0, 10, 140, 205, 247, 289], "urha0002": [0, 10, 140, 205, 247, 289], "taa486": [0, 10, 140, 205, 247, 289], "bathoardescen": [0, 10, 140, 205, 247, 289], "caldisalinibact": [0, 10, 140, 205, 247, 289], "kiritimatiensi": [0, 10, 140, 205, 247, 289], "krmcy2": [0, 10, 140, 205, 247, 289], "asbs410": [0, 10, 140, 205, 247, 289], "geovibrio": [0, 10, 140, 205, 247, 289], "l21": [0, 10, 140, 205, 247, 289], "BES": [0, 10, 140, 205, 247, 289], "krocy2": [0, 10, 140, 205, 247, 289], "d15": [0, 10, 140, 205, 247, 289], "8w": [0, 10, 140, 205, 247, 289], "eur3": [0, 10, 140, 205, 247, 289], "w11": [0, 10, 140, 205, 247, 289], "termitomyc": [0, 10, 140, 205, 247, 289], "j132": [0, 10, 140, 205, 247, 289], "hokutonensi": [0, 10, 140, 205, 247, 289], "desulfohalovibrio": [0, 10, 140, 205, 247, 289], "reitneri": [0, 10, 140, 205, 247, 289], "salinispira": [0, 10, 140, 205, 247, 289], "br18": [0, 10, 140, 205, 247, 289], "h14": [0, 10, 140, 205, 247, 289], "gb": [0, 9, 10, 140, 205, 247, 289], "aureispira": [0, 10, 140, 205, 247, 289], "ccb": [0, 10, 140, 205, 247, 289], "qb1": [0, 10, 140, 205, 247, 289], "peniophora": [0, 10, 140, 205, 247, 289], "cont": [0, 10, 140, 205, 247, 289], "perkinsela": [0, 10, 140, 205, 247, 289], "ccap": [0, 10, 140, 205, 247, 289], "1560": [0, 10, 140, 205, 247, 289], "hsism1": [0, 10, 140, 205, 247, 289], "hsisb1": [0, 10, 140, 205, 247, 289], "hsiss1": [0, 10, 140, 205, 247, 289], "hsiss2": [0, 10, 140, 205, 247, 289], "hsiss3": [0, 10, 140, 205, 247, 289], "hsieg1": [0, 10, 140, 205, 247, 289], "nauphoeta": [0, 10, 140, 205, 247, 289], "sulfaticallidu": [0, 10, 140, 205, 247, 289], "pm70": [0, 10, 140, 205, 247, 289], "girerdii": [0, 10, 140, 205, 247, 289], "nbimc_p2": [0, 10, 140, 205, 247, 289], "876": [0, 10, 140, 205, 247, 289], "f0540": [0, 10, 140, 205, 247, 289], "131": [0, 10, 140, 167, 205, 247, 289], "w9106": [0, 10, 140, 205, 247, 289], "peptostreptococcacea": [0, 10, 140, 205, 247, 289], "w5053": [0, 10, 140, 205, 247, 289], "892": [0, 10, 140, 205, 247, 289], "f0426": [0, 10, 140, 205, 247, 289], "tkk": [0, 10, 140, 205, 247, 289], "0059": [0, 10, 140, 205, 247, 289], "fs14": [0, 10, 140, 205, 247, 289], "thermoactinomyc": [0, 10, 140, 205, 247, 289], "daqu": [0, 10, 140, 205, 247, 289], "38": [0, 10, 140, 205, 247, 289], "bwh": [0, 10, 140, 205, 247, 289], "bidmc": [0, 10, 140, 205, 247, 289], "lindaniclasticum": [0, 10, 140, 205, 247, 289], "le124": [0, 10, 140, 205, 247, 289], "zancl": [0, 10, 140, 205, 247, 289], "caliditerra": [0, 10, 140, 205, 247, 289], "subglabra": [0, 10, 140, 205, 247, 289], "tfb": [0, 10, 140, 205, 247, 289], "10046": [0, 10, 140, 205, 247, 289], "ss5": [0, 10, 140, 205, 247, 289], "baderi": [0, 10, 140, 205, 247, 289], "ll03": [0, 10, 140, 205, 247, 289], "saccharimona": [0, 10, 140, 205, 247, 289], "aalborgensi": [0, 10, 140, 205, 247, 289], "salinarchaeum": [0, 10, 140, 205, 247, 289], "harcht": [0, 10, 140, 205, 247, 289], "bsk1": [0, 10, 140, 205, 247, 289], "moukalabens": [0, 10, 140, 205, 247, 289], "27321": [0, 10, 140, 205, 247, 289], "tepidicauli": [0, 10, 140, 205, 247, 289], "spiribact": [0, 10, 140, 205, 247, 289], "salinu": [0, 10, 140, 205, 247, 289], "m19": [0, 10, 140, 205, 247, 289], "bisphenolivoran": [0, 10, 140, 205, 247, 289], "hel1_33_49": [0, 10, 140, 205, 247, 289], "unc438cl73tsus30": [0, 10, 140, 205, 247, 289], "luminiphilu": [0, 10, 140, 205, 247, 289], "syltensi": [0, 10, 140, 205, 247, 289], "nor5": [0, 10, 140, 205, 247, 289], "1b": [0, 10, 140, 205, 247, 289], "enshiens": [0, 10, 140, 205, 247, 289], "dk69": [0, 10, 140, 205, 247, 289], "5288": [0, 10, 140, 205, 247, 289], "geojensi": [0, 10, 140, 205, 247, 289], "noctilucicola": [0, 10, 140, 205, 247, 289], "noctiluca": [0, 10, 140, 205, 247, 289], "am169": [0, 10, 140, 205, 247, 289], "molli": [0, 10, 140, 205, 247, 289], "a3h3": [0, 10, 140, 205, 247, 289], "eb01": [0, 10, 140, 205, 247, 289], "paucisalibacillu": [0, 10, 140, 205, 247, 289], "eb02": [0, 10, 140, 205, 247, 289], "ndiopicu": [0, 10, 140, 205, 247, 289], "dielmoensi": [0, 10, 140, 205, 247, 289], "anaerosalibact": [0, 10, 140, 205, 247, 289], "neonati": [0, 10, 140, 205, 247, 289], "piratica": [0, 10, 140, 205, 247, 289], "yn10": [0, 10, 140, 205, 247, 289], "qasimii": [0, 10, 140, 205, 247, 289], "m12": [0, 10, 140, 205, 247, 289], "utex": [0, 10, 140, 205, 247, 289], "2973": [0, 10, 140, 205, 247, 289], "bsw11_iv": [0, 10, 140, 205, 247, 289], "mikwangii": [0, 10, 140, 205, 247, 289], "mctg156": [0, 10, 140, 205, 247, 289], "af1028": [0, 10, 140, 205, 247, 289], "lanthieri": [0, 10, 140, 205, 247, 289], "pml026": [0, 10, 140, 205, 247, 289], "apr13": [0, 10, 140, 205, 247, 289], "salamandrivoran": [0, 10, 140, 205, 247, 289], "lutibaculum": [0, 10, 140, 205, 247, 289], "baratangens": [0, 10, 140, 205, 247, 289], "amv1": [0, 10, 140, 205, 247, 289], "adornatum": [0, 10, 140, 205, 247, 289], "parabailii": [0, 10, 140, 205, 247, 289], "himb11": [0, 10, 140, 205, 247, 289], "um_wgj": [0, 10, 140, 205, 247, 289], "um_wwi": [0, 10, 140, 205, 247, 289], "asf500": [0, 10, 140, 205, 247, 289], "jiangningensi": [0, 10, 140, 205, 247, 289], "desulfonauticu": [0, 10, 140, 205, 247, 289], "a7a": [0, 10, 140, 205, 247, 289], "fukuswis1": [0, 10, 140, 205, 247, 289], "mb1": [0, 10, 140, 205, 247, 289], "urha0041": [0, 10, 140, 205, 247, 289], "geodermatophilacea": [0, 10, 140, 205, 247, 289], "urhb0048": [0, 10, 140, 205, 247, 289], "urhc0008": [0, 10, 140, 205, 247, 289], "urhe0023": [0, 10, 140, 205, 247, 289], "urhd0069": [0, 10, 140, 205, 247, 289], "urhd0036": [0, 10, 140, 205, 247, 289], "23_gom": [0, 10, 140, 205, 247, 289], "1509m": [0, 10, 140, 205, 247, 289], "20_gpm": [0, 10, 140, 205, 247, 289], "intrasporangiacea": [0, 10, 140, 205, 247, 289], "urhb0013": [0, 10, 140, 205, 247, 289], "13_gom": [0, 10, 140, 205, 247, 289], "1096m": [0, 10, 140, 205, 247, 289], "47a_gom": [0, 10, 140, 205, 247, 289], "205m": [0, 10, 140, 205, 247, 289], "urhb0044": [0, 10, 140, 205, 247, 289], "43b_gom": [0, 10, 140, 205, 247, 289], "46m": [0, 10, 140, 205, 247, 289], "solirubrobacteral": [0, 10, 140, 205, 247, 289], "urhd0059": [0, 10, 140, 205, 247, 289], "dongia": [0, 10, 140, 205, 247, 289], "urhe0060": [0, 10, 140, 205, 247, 289], "urha0031": [0, 10, 140, 205, 247, 289], "rhodospirillal": [0, 10, 140, 205, 247, 289], "urhd0088": [0, 10, 140, 205, 247, 289], "darwinianu": [0, 10, 140, 205, 247, 289], "streptomycetacea": [0, 10, 140, 205, 247, 289], "mp113": [0, 10, 140, 205, 247, 289], "aliihoeflea": [0, 10, 140, 205, 247, 289], "2ww": [0, 10, 140, 205, 247, 289], "vcm10": [0, 10, 140, 205, 247, 289], "caulobacteracea": [0, 10, 140, 205, 247, 289], "pmmr1": [0, 10, 140, 205, 247, 289], "d27": [0, 10, 140, 205, 247, 289], "thermogemmatispora": [0, 10, 140, 205, 247, 289], "thermorudi": [0, 10, 140, 205, 247, 289], "pelea": [0, 10, 140, 205, 247, 289], "ailaaui": [0, 10, 140, 205, 247, 289], "methyloceanibact": [0, 10, 140, 205, 247, 289], "caenitepidi": [0, 10, 140, 205, 247, 289], "w12": [0, 10, 140, 205, 247, 289], "1067": [0, 10, 140, 205, 247, 289], "arseniciresisten": [0, 10, 140, 205, 247, 289], "zs79": [0, 10, 140, 205, 247, 289], "dg25b": [0, 10, 140, 205, 247, 289], "heron": [0, 10, 140, 205, 247, 289], "island": [0, 10, 140, 205, 247, 289], "chiriqhucha": [0, 10, 140, 205, 247, 289], "rw": [0, 10, 140, 205, 247, 289], "her1398": [0, 10, 140, 205, 247, 289], "oh31": [0, 10, 140, 205, 247, 289], "m0480": [0, 10, 140, 205, 247, 289], "ty": [0, 10, 140, 205, 247, 289], "3808": [0, 10, 140, 205, 247, 289], "kalmanozyma": [0, 10, 140, 205, 247, 289], "hun102": [0, 10, 140, 205, 247, 289], "ab3007": [0, 10, 140, 205, 247, 289], "flavimarina": [0, 10, 140, 205, 247, 289], "hel_i_48": [0, 10, 140, 205, 247, 289], "mar_2009_132": [0, 10, 140, 205, 247, 289], "sediminibact": [0, 10, 140, 205, 247, 289], "hel_i_10": [0, 10, 140, 205, 247, 289], "ae2021": [0, 10, 140, 205, 247, 289], "ac2031": [0, 10, 140, 205, 247, 289], "7101": [0, 10, 140, 205, 247, 289], "a11": [0, 10, 140, 205, 247, 289], "saccharibacteria": [0, 10, 140, 205, 247, 289], "raac3_tm7_1": [0, 10, 140, 205, 247, 289], "nk55a": [0, 10, 140, 205, 247, 289], "maepy2": [0, 10, 140, 205, 247, 289], "haloferula": [0, 10, 140, 205, 247, 289], "bvorr071": [0, 10, 140, 205, 247, 289], "bvorr034": [0, 10, 140, 205, 247, 289], "ph1c": [0, 10, 140, 205, 247, 289], "h1n": [0, 10, 140, 205, 247, 289], "p2s70": [0, 10, 140, 205, 247, 289], "pbn3": [0, 10, 140, 205, 247, 289], "micropelago": [0, 10, 140, 205, 247, 289], "thuwalensi": [0, 10, 140, 205, 247, 289], "mh3": [0, 10, 140, 205, 247, 289], "bacteroidal": [0, 10, 140, 205, 247, 289], "limnosedimini": [0, 10, 140, 205, 247, 289], "jc2902": [0, 10, 140, 205, 247, 289], "pseudonitzschia": [0, 10, 140, 205, 247, 289], "bvorr106": [0, 10, 140, 205, 247, 289], "glyciniphilum": [0, 10, 140, 205, 247, 289], "3170": [0, 10, 140, 205, 247, 289], "methanomassiliicoccu": [0, 10, 140, 205, 247, 289], "issoir": [0, 10, 140, 205, 247, 289], "mx1": [0, 10, 140, 205, 247, 289], "nkbg15041c": [0, 10, 140, 205, 247, 289], "betaproteobacteria": [0, 10, 140, 205, 247, 289], "mola814": [0, 10, 140, 205, 247, 289], "mb2021": [0, 10, 140, 205, 247, 289], "fcs014": [0, 10, 140, 205, 247, 289], "mc2021": [0, 10, 140, 205, 247, 289], "ma2016": [0, 10, 140, 205, 247, 289], "fc2011": [0, 10, 140, 205, 247, 289], "lb2011": [0, 10, 140, 205, 247, 289], "ac2028": [0, 10, 140, 205, 247, 289], "ac3007": [0, 10, 140, 205, 247, 289], "ma2020": [0, 10, 140, 205, 247, 289], "mc2017": [0, 10, 140, 205, 247, 289], "youngiibact": [0, 10, 140, 205, 247, 289], "232": [0, 10, 140, 167, 205, 247, 289], "tachikawaea": [0, 10, 140, 205, 247, 289], "gelatinosa": [0, 10, 140, 205, 247, 289], "nitrosopelagicu": [0, 10, 140, 205, 247, 289], "ga6a2": [0, 10, 140, 205, 247, 289], "c6a8": [0, 10, 140, 205, 247, 289], "p6a1": [0, 10, 140, 205, 247, 289], "p6b1": [0, 10, 140, 205, 247, 289], "md2005": [0, 10, 140, 205, 247, 289], "fc2018": [0, 10, 140, 205, 247, 289], "nd2010": [0, 10, 140, 205, 247, 289], "dd3": [0, 10, 140, 205, 247, 289], "shinella": [0, 10, 140, 205, 247, 289], "dd12": [0, 10, 140, 205, 247, 289], "c6a11": [0, 10, 140, 205, 247, 289], "fe2018": [0, 10, 140, 205, 247, 289], "md2004": [0, 10, 140, 205, 247, 289], "nc2004": [0, 10, 140, 205, 247, 289], "nd2006": [0, 10, 140, 205, 247, 289], "p6a3": [0, 10, 140, 205, 247, 289], "p6b14": [0, 10, 140, 205, 247, 289], "v9d3004": [0, 10, 140, 205, 247, 289], "ysb2008": [0, 10, 140, 205, 247, 289], "propionibacteriacea": [0, 10, 140, 205, 247, 289], "p6a17": [0, 10, 140, 205, 247, 289], "ab4001": [0, 10, 140, 205, 247, 289], "methyloglobulu": [0, 10, 140, 205, 247, 289], "morosu": [0, 10, 140, 205, 247, 289], "kom1": [0, 10, 140, 205, 247, 289], "rhizobial": [0, 10, 140, 205, 247, 289], "77505": [0, 10, 140, 205, 247, 289], "gammaproteobacteria": [0, 10, 140, 205, 247, 289], "mola455": [0, 10, 140, 205, 247, 289], "jeddahens": [0, 10, 140, 205, 247, 289], "saudiens": [0, 10, 140, 205, 247, 289], "tkp": [0, 10, 140, 205, 247, 289], "walczuchella": [0, 10, 140, 205, 247, 289], "monophlebidarum": [0, 10, 140, 205, 247, 289], "mctg268": [0, 10, 140, 205, 247, 289], "tg39a": [0, 10, 140, 205, 247, 289], "kilaueensi": [0, 10, 140, 205, 247, 289], "js1": [0, 10, 140, 205, 247, 289], "defluviimona": [0, 10, 140, 205, 247, 289], "20v17": [0, 10, 140, 205, 247, 289], "vt": [0, 10, 140, 205, 247, 289], "162": [0, 10, 140, 205, 247, 289], "3775": [0, 10, 140, 205, 247, 289], "4246": [0, 10, 140, 205, 247, 289], "4281": [0, 10, 140, 205, 247, 289], "fw": [0, 10, 140, 205, 247, 289], "2241": [0, 10, 140, 165, 166, 168, 205, 247, 289], "4513": [0, 10, 140, 205, 247, 289], "928": [0, 10, 140, 205, 247, 289], "4514": [0, 10, 140, 205, 247, 289], "929": [0, 10, 140, 205, 247, 289], "4515": [0, 10, 140, 205, 247, 289], "2607": [0, 10, 140, 205, 247, 289], "4516": [0, 10, 140, 205, 247, 289], "969": [0, 10, 140, 205, 247, 289], "4517": [0, 10, 140, 205, 247, 289], "2822": [0, 10, 140, 205, 247, 289], "4518": [0, 10, 140, 205, 247, 289], "2643": [0, 10, 140, 205, 247, 289], "4519": [0, 10, 140, 205, 247, 289], "2642": [0, 10, 140, 205, 247, 289], "4520": [0, 10, 140, 205, 247, 289], "2644": [0, 10, 140, 205, 247, 289], "salariu": [0, 10, 140, 205, 247, 289], "lam0618": [0, 10, 140, 205, 247, 289], "nitrativoran": [0, 10, 140, 205, 247, 289], "nl23": [0, 10, 140, 205, 247, 289], "entotheonella": [0, 10, 140, 205, 247, 289], "gemina": [0, 10, 140, 205, 247, 289], "p52": [0, 10, 140, 205, 247, 289], "icigianu": [0, 10, 140, 205, 247, 289], "halobonum": [0, 10, 140, 205, 247, 289], "tyrrellensi": [0, 10, 140, 205, 247, 289], "1261": [0, 9, 10, 140, 205, 247, 289], "mucinivoran": [0, 10, 140, 205, 247, 289], "hirudini": [0, 10, 140, 205, 247, 289], "kolkse": [0, 10, 140, 205, 247, 289], "mtp4": [0, 10, 140, 205, 247, 289], "wh1": [0, 10, 140, 205, 247, 289], "wwm596": [0, 10, 140, 205, 247, 289], "bohemicu": [0, 10, 140, 205, 247, 289], "3994": [0, 10, 140, 205, 247, 289], "97co": [0, 10, 140, 205, 247, 289], "symbiobact": [0, 10, 140, 205, 247, 289], "cr": [0, 10, 140, 205, 247, 289], "3557": [0, 10, 140, 205, 247, 289], "55": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "bay1663": [0, 10, 140, 205, 247, 289], "atroroseu": [0, 10, 140, 205, 247, 289], "k25": [0, 10, 140, 205, 247, 289], "xh134": [0, 10, 140, 205, 247, 289], "rubidu": [0, 10, 140, 205, 247, 289], "gynuella": [0, 10, 140, 205, 247, 289], "sunshinyii": [0, 10, 140, 205, 247, 289], "yc6258": [0, 10, 140, 205, 247, 289], "sciscionella": [0, 10, 140, 205, 247, 289], "se31": [0, 10, 140, 205, 247, 289], "dy53": [0, 10, 140, 205, 247, 289], "pc3": [0, 10, 140, 205, 247, 289], "corcagiensi": [0, 10, 140, 205, 247, 289], "halobellu": [0, 10, 140, 205, 247, 289], "unc362mftsu5": [0, 10, 140, 205, 247, 289], "unc280mftsu5": [0, 10, 140, 205, 247, 289], "unc358mftsu5": [0, 10, 140, 205, 247, 289], "knhs205": [0, 10, 140, 205, 247, 289], "unccl10": [0, 10, 140, 205, 247, 289], "unc451mf": [0, 10, 140, 205, 247, 289], "unc302mfcol5": [0, 10, 140, 205, 247, 289], "unc23mfcrub1": [0, 10, 140, 205, 247, 289], "unc363mftsu5": [0, 10, 140, 205, 247, 289], "unc305mfcol5": [0, 10, 140, 205, 247, 289], "k32": [0, 10, 140, 205, 247, 289], "k20": [0, 10, 140, 205, 247, 289], "hispalens": [0, 10, 140, 205, 247, 289], "25574": [0, 10, 140, 205, 247, 289], "hz11": [0, 10, 140, 205, 247, 289], "ba": [0, 10, 140, 205, 247, 289], "hzm": [0, 10, 140, 205, 247, 289], "10dc88": [0, 10, 140, 205, 247, 289], "gallinacea": [0, 10, 140, 205, 247, 289], "1274": [0, 10, 140, 205, 247, 289], "halapricum": [0, 10, 140, 205, 247, 289], "salinum": [0, 10, 140, 205, 247, 289], "jiangsuensi": [0, 10, 140, 205, 247, 289], "serpentinomona": [0, 10, 140, 205, 247, 289], "raichei": [0, 10, 140, 205, 247, 289], "mccroryi": [0, 10, 140, 205, 247, 289], "phaeomarinobact": [0, 10, 140, 205, 247, 289], "ectocarpi": [0, 10, 140, 205, 247, 289], "ac2029": [0, 10, 140, 205, 247, 289], "evergladensi": [0, 10, 140, 205, 247, 289], "geomicrobium": [0, 10, 140, 205, 247, 289], "19037": [0, 10, 140, 205, 247, 289], "19038": [0, 10, 140, 205, 247, 289], "19046": [0, 10, 140, 205, 247, 289], "paraphaeosphaeria": [0, 10, 140, 205, 247, 289], "sporulosa": [0, 10, 140, 205, 247, 289], "neobacillu": [0, 10, 140, 205, 247, 289], "jeddahensi": [0, 10, 140, 205, 247, 289], "saudimassiliensi": [0, 10, 140, 205, 247, 289], "metalysinibacillu": [0, 10, 140, 205, 247, 289], "actibacterium": [0, 10, 140, 205, 247, 289], "atlanticum": [0, 10, 140, 205, 247, 289], "scsio_11900": [0, 10, 140, 205, 247, 289], "papioni": [0, 10, 140, 205, 247, 289], "quasipneumonia": [0, 10, 140, 205, 247, 289], "ucicr": [0, 10, 140, 205, 247, 289], "actinosporangium": [0, 10, 140, 205, 247, 289], "3428": [0, 10, 140, 205, 247, 289], "16210": [0, 10, 140, 205, 247, 289], "16314": [0, 10, 140, 205, 247, 289], "2890": [0, 10, 140, 205, 247, 289], "5053": [0, 10, 140, 205, 247, 289], "5065": [0, 10, 140, 205, 247, 289], "5123": [0, 10, 140, 205, 247, 289], "5126": [0, 10, 140, 205, 247, 289], "5630": [0, 10, 140, 205, 247, 289], "6677": [0, 10, 140, 205, 247, 289], "118": [0, 10, 140, 205, 247, 289], "1777": [0, 10, 140, 205, 247, 289], "337": [0, 10, 140, 205, 247, 289], "340": [0, 10, 140, 205, 247, 289], "646": [0, 10, 140, 205, 247, 289], "920": [0, 10, 140, 205, 247, 289], "wc": [0, 10, 140, 205, 247, 289], "3626": [0, 10, 140, 205, 247, 289], "3742": [0, 10, 140, 205, 247, 289], "3773": [0, 10, 140, 205, 247, 289], "jc14": [0, 10, 140, 205, 247, 289], "grossensi": [0, 10, 140, 205, 247, 289], "ph5": [0, 10, 140, 205, 247, 289], "jc140": [0, 10, 140, 205, 247, 289], "diop": [0, 10, 140, 205, 247, 289], "jc66": [0, 10, 140, 205, 247, 289], "jc122": [0, 10, 140, 205, 247, 289], "jc225": [0, 10, 140, 205, 247, 289], "noviherbaspirillum": [0, 10, 140, 205, 247, 289], "jc206": [0, 10, 140, 205, 247, 289], "timonella": [0, 10, 140, 205, 247, 289], "jc301": [0, 10, 140, 205, 247, 289], "2002721687": [0, 10, 140, 205, 247, 289], "massilioanorexiu": [0, 10, 140, 205, 247, 289], "ap8": [0, 10, 140, 205, 247, 289], "os02": [0, 10, 140, 205, 247, 289], "ap2": [0, 10, 140, 205, 247, 289], "hk1": [0, 10, 140, 205, 247, 289], "gj": [0, 10, 140, 205, 247, 289], "e10": [0, 10, 140, 205, 247, 289], "jangbogonensi": [0, 10, 140, 205, 247, 289], "ni22": [0, 10, 140, 205, 247, 289], "kineothrix": [0, 10, 140, 205, 247, 289], "alysoid": [0, 10, 140, 205, 247, 289], "ap11": [0, 10, 140, 205, 247, 289], "stoquefichu": [0, 10, 140, 205, 247, 289], "ap9": [0, 10, 140, 205, 247, 289], "ap5": [0, 10, 140, 205, 247, 289], "ap3": [0, 10, 140, 205, 247, 289], "6176": [0, 10, 140, 205, 247, 289], "rit328": [0, 10, 140, 205, 247, 289], "rit357": [0, 10, 140, 205, 247, 289], "scb241_528o2": [0, 10, 140, 205, 247, 289], "scb245a_520k10": [0, 10, 140, 205, 247, 289], "basilea": [0, 10, 140, 205, 247, 289], "psittacipulmoni": [0, 10, 140, 205, 247, 289], "24701": [0, 10, 140, 205, 247, 289], "falsirhodobact": [0, 10, 140, 205, 247, 289], "alg1": [0, 10, 140, 205, 247, 289], "k24": [0, 10, 140, 205, 247, 289], "kallipyga": [0, 10, 140, 205, 247, 289], "ph2": [0, 10, 140, 205, 247, 289], "senegalimassilia": [0, 10, 140, 205, 247, 289], "anaerobia": [0, 10, 140, 205, 247, 289], "jc110": [0, 10, 140, 205, 247, 289], "mizugakiibact": [0, 10, 140, 205, 247, 289], "phoenici": [0, 10, 140, 205, 247, 289], "24720": [0, 10, 140, 205, 247, 289], "va2": [0, 10, 140, 205, 247, 289], "psnih2": [0, 10, 140, 205, 247, 289], "psnih1": [0, 10, 140, 205, 247, 289], "ab2": [0, 10, 140, 205, 247, 289], "saidenbachensi": [0, 10, 140, 205, 247, 289], "ed16": [0, 10, 140, 205, 247, 289], "cadophora": [0, 10, 140, 205, 247, 289], "dse1049": [0, 10, 140, 205, 247, 289], "ae3005": [0, 10, 140, 205, 247, 289], "ferriphaselu": [0, 10, 140, 205, 247, 289], "ghiorsea": [0, 10, 140, 205, 247, 289], "bivora": [0, 10, 140, 205, 247, 289], "mitosporidium": [0, 10, 140, 205, 247, 289], "endophytica": [0, 10, 140, 205, 247, 289], "pierantoniu": [0, 10, 140, 205, 247, 289], "sope": [0, 10, 140, 205, 247, 289], "hmp27": [0, 10, 140, 205, 247, 289], "hmp52": [0, 10, 140, 205, 247, 289], "6931": [0, 10, 140, 205, 247, 289], "ant30": [0, 10, 140, 205, 247, 289], "seoulens": [0, 10, 140, 205, 247, 289], "mfb021": [0, 10, 140, 205, 247, 289], "mesoaciditoga": [0, 10, 140, 205, 247, 289], "lauensi": [0, 10, 140, 205, 247, 289], "1655r": [0, 10, 140, 205, 247, 289], "25116": [0, 10, 140, 205, 247, 289], "wcs374": [0, 10, 140, 205, 247, 289], "griseofulvum": [0, 10, 140, 205, 247, 289], "ufmgcb": [0, 10, 140, 205, 247, 289], "6741": [0, 10, 140, 205, 247, 289], "evansia": [0, 10, 140, 205, 247, 289], "caciam": [0, 10, 140, 205, 247, 289], "listeriacea": [0, 10, 140, 205, 247, 289], "a5": [0, 10, 140, 205, 247, 289], "0209": [0, 10, 140, 205, 247, 289], "0601": [0, 10, 140, 205, 247, 289], "0602": [0, 10, 140, 205, 247, 289], "0701": [0, 10, 140, 205, 247, 289], "rubiinfanti": [0, 10, 140, 205, 247, 289], "andreraoultii": [0, 10, 140, 205, 247, 289], "saudiphocaensi": [0, 10, 140, 205, 247, 289], "amazonitimonens": [0, 10, 140, 205, 247, 289], "moduliflexu": [0, 10, 140, 205, 247, 289], "vecturithrix": [0, 10, 140, 205, 247, 289], "tca20": [0, 10, 140, 205, 247, 289], "yr295": [0, 10, 140, 205, 247, 289], "yr519": [0, 10, 140, 205, 247, 289], "cf284": [0, 10, 140, 205, 247, 289], "cf097": [0, 10, 140, 205, 247, 289], "cf394": [0, 10, 140, 205, 247, 289], "ok494": [0, 10, 140, 205, 247, 289], "luteibact": [0, 10, 140, 205, 247, 289], "9143": [0, 10, 140, 205, 247, 289], "9135": [0, 10, 140, 205, 247, 289], "9096": [0, 10, 140, 205, 247, 289], "9120": [0, 10, 140, 205, 247, 289], "rm16704": [0, 10, 140, 205, 247, 289], "tyrfi": [0, 10, 140, 205, 247, 289], "0604": [0, 10, 140, 205, 247, 289], "0801": [0, 10, 140, 205, 247, 289], "acb8": [0, 10, 140, 205, 247, 289], "asaccharolyticum": [0, 10, 140, 205, 247, 289], "acb7": [0, 10, 140, 205, 247, 289], "inop": [0, 10, 140, 205, 247, 289], "devosia": [0, 10, 140, 205, 247, 289], "lc5": [0, 10, 140, 205, 247, 289], "l2l1": [0, 10, 140, 205, 247, 289], "aac": [0, 10, 140, 205, 247, 289], "lc81": [0, 10, 140, 205, 247, 289], "lc85": [0, 10, 140, 205, 247, 289], "lc238": [0, 10, 140, 205, 247, 289], "seminali": [0, 10, 140, 205, 247, 289], "col6b": [0, 10, 140, 205, 247, 289], "cg9_12": [0, 10, 140, 205, 247, 289], "ko116": [0, 10, 140, 205, 247, 289], "chitinivibrio": [0, 10, 140, 205, 247, 289], "acht1": [0, 10, 140, 205, 247, 289], "polyrhachi": [0, 10, 140, 205, 247, 289], "hedomyrma": [0, 10, 140, 205, 247, 289], "turneri": [0, 10, 140, 205, 247, 289], "colobopsi": [0, 10, 140, 205, 247, 289], "obliquu": [0, 10, 140, 205, 247, 289], "schmidhempelia": [0, 10, 140, 205, 247, 289], "bimp": [0, 10, 140, 205, 247, 289], "eurythermali": [0, 10, 140, 205, 247, 289], "ae3004": [0, 10, 140, 205, 247, 289], "rachicladosporium": [0, 10, 140, 205, 247, 289], "jeotgalibacillu": [0, 10, 140, 205, 247, 289], "malaysiensi": [0, 10, 140, 205, 247, 289], "nl": [0, 10, 140, 205, 247, 289], "hr7": [0, 10, 140, 205, 247, 289], "pseudorhizobium": [0, 10, 140, 205, 247, 289], "pelagicum": [0, 10, 140, 205, 247, 289], "ar1": [0, 10, 140, 205, 247, 289], "unc402clcol": [0, 10, 140, 205, 247, 289], "hun007": [0, 10, 140, 205, 247, 289], "fribergensi": [0, 10, 140, 205, 247, 289], "cot": [0, 10, 140, 205, 247, 289], "oh1446": [0, 10, 140, 205, 247, 289], "290": [0, 10, 140, 205, 247, 289, 324, 325], "oh860": [0, 10, 140, 205, 247, 289], "er1a": [0, 10, 140, 205, 247, 289], "porphyromonadacea": [0, 10, 140, 205, 247, 289], "184": [0, 10, 140, 205, 247, 289], "oh4590": [0, 10, 140, 205, 247, 289], "coluzzii": [0, 10, 140, 205, 247, 289], "er4": [0, 10, 140, 205, 247, 289], "thermochlorobacteriacea": [0, 10, 140, 205, 247, 289], "gbchlb": [0, 10, 140, 205, 247, 289], "ba1": [0, 10, 140, 205, 247, 289], "ceraceosoru": [0, 10, 140, 205, 247, 289], "ml96": [0, 10, 140, 205, 247, 289], "ag1": [0, 10, 140, 205, 247, 289], "21323": [0, 10, 140, 205, 247, 289], "rickettsial": [0, 10, 140, 205, 247, 289], "ac37b": [0, 10, 140, 205, 247, 289], "seifertii": [0, 10, 140, 205, 247, 289], "palleronia": [0, 10, 140, 205, 247, 289], "rufa": [0, 10, 140, 205, 247, 289], "torrubiella": [0, 10, 140, 205, 247, 289], "hemipterigena": [0, 10, 140, 205, 247, 289], "rta": [0, 10, 140, 205, 247, 289], "1r": [0, 10, 140, 205, 247, 289], "thalassotalea": [0, 10, 140, 205, 247, 289], "nd16a": [0, 10, 140, 205, 247, 289], "p4": [0, 10, 140, 205, 247, 289], "0081": [0, 10, 140, 205, 247, 289], "0345": [0, 10, 140, 205, 247, 289], "0912": [0, 10, 140, 205, 247, 289], "0273": [0, 10, 140, 205, 247, 289], "0331": [0, 10, 140, 205, 247, 289], "0357": [0, 10, 140, 205, 247, 289], "0737": [0, 10, 140, 205, 247, 289], "mwb1": [0, 10, 140, 205, 247, 289], "scadc": [0, 10, 140, 205, 247, 289], "mlsb": [0, 10, 140, 205, 247, 289], "lor": [0, 10, 140, 205, 247, 289], "hk10": [0, 10, 140, 205, 247, 289], "aquabacterium": [0, 10, 140, 205, 247, 289], "nj1": [0, 10, 140, 205, 247, 289], "ml3w": [0, 10, 140, 205, 247, 289], "omz": [0, 10, 140, 205, 247, 289], "838": [0, 10, 140, 205, 247, 289], "77859": [0, 10, 140, 205, 247, 289], "knhs214": [0, 10, 140, 205, 247, 289], "myxosarcina": [0, 10, 140, 205, 247, 289], "gi1": [0, 10, 140, 205, 247, 289], "izimaplasma": [0, 10, 140, 205, 247, 289], "hr1": [0, 10, 140, 205, 247, 289], "hr2": [0, 10, 140, 205, 247, 289], "oleiagrimona": [0, 10, 140, 205, 247, 289], "wkb10": [0, 10, 140, 205, 247, 289], "wkb8": [0, 10, 140, 205, 247, 289], "24zxx": [0, 10, 140, 205, 247, 289], "bal378": [0, 10, 140, 205, 247, 289], "fsc1006": [0, 10, 140, 205, 247, 289], "5569": [0, 10, 140, 205, 247, 289], "taxi": [0, 10, 140, 205, 247, 289], "37zxx": [0, 10, 140, 205, 247, 289], "sphingobacteriacea": [0, 10, 140, 205, 247, 289], "dw12": [0, 10, 140, 205, 247, 289], "uzonens": [0, 10, 140, 205, 247, 289], "booria": [0, 10, 140, 205, 247, 289], "fermentimona": [0, 10, 140, 205, 247, 289], "caenicola": [0, 10, 140, 205, 247, 289], "b7740": [0, 10, 140, 205, 247, 289], "ecsmb14101": [0, 10, 140, 205, 247, 289], "rugosibact": [0, 10, 140, 205, 247, 289], "x1": [0, 10, 140, 205, 247, 289], "2014": [0, 9, 10, 140, 205, 247, 289, 323], "ihbb": [0, 10, 140, 205, 247, 289], "10380": [0, 10, 140, 205, 247, 289], "22219": [0, 10, 140, 205, 247, 289], "s60": [0, 10, 140, 205, 247, 289], "jaminaea": [0, 10, 140, 205, 247, 289], "bh072": [0, 10, 140, 205, 247, 289], "yp1": [0, 10, 140, 205, 247, 289], "methanoplasma": [0, 10, 140, 205, 247, 289], "termitum": [0, 10, 140, 205, 247, 289], "adriaticu": [0, 10, 140, 205, 247, 289], "hmsc05h02": [0, 10, 140, 205, 247, 289], "hmsc06f02": [0, 10, 140, 205, 247, 289], "methylopumilu": [0, 10, 140, 205, 247, 289], "planktonicu": [0, 10, 140, 205, 247, 289], "piranensi": [0, 10, 140, 205, 247, 289], "hwasookii": [0, 10, 140, 205, 247, 289], "chdc": [0, 10, 140, 205, 247, 289], "f128": [0, 10, 140, 205, 247, 289], "a21": [0, 10, 140, 205, 247, 289], "arsenijevicii": [0, 10, 140, 205, 247, 289], "10b238": [0, 10, 140, 205, 247, 289], "cba1115": [0, 10, 140, 205, 247, 289], "29904": [0, 10, 140, 205, 247, 289], "nitrosotenui": [0, 10, 140, 205, 247, 289], "halanaeroarchaeum": [0, 10, 140, 205, 247, 289], "sulfurireducen": [0, 10, 140, 205, 247, 289], "filomicrobium": [0, 10, 140, 205, 247, 289], "hengshuiensi": [0, 10, 140, 205, 247, 289], "mrsn12121": [0, 10, 140, 205, 247, 289], "s234": [0, 10, 140, 205, 247, 289], "psychromicrobium": [0, 10, 140, 205, 247, 289], "lacusluna": [0, 10, 140, 205, 247, 289], "lm": [0, 10, 140, 205, 247, 289], "t08": [0, 10, 140, 205, 247, 289], "imcc26134": [0, 10, 140, 205, 247, 289], "chania": [0, 10, 140, 205, 247, 289], "multitudinisenten": [0, 10, 140, 205, 247, 289], "paralicheniformi": [0, 10, 140, 205, 247, 289], "9945a": [0, 10, 140, 205, 247, 289], "rileyi": [0, 10, 140, 205, 247, 289], "4871": [0, 10, 140, 205, 247, 289], "maju": [0, 10, 140, 205, 247, 289], "297": [0, 10, 140, 205, 247, 289], "cuenoti": [0, 10, 140, 205, 247, 289], "bpaa": [0, 10, 140, 205, 247, 289], "quebecensi": [0, 10, 140, 205, 247, 289], "cac": [0, 10, 140, 205, 247, 289], "2015a": [0, 10, 140, 205, 247, 289], "percursu": [0, 10, 140, 205, 247, 289], "attinorum": [0, 10, 140, 205, 247, 289], "violaceomyc": [0, 10, 140, 205, 247, 289], "gilchristii": [0, 10, 140, 205, 247, 289], "slh14081": [0, 10, 140, 205, 247, 289], "pseudomicrostroma": [0, 10, 140, 205, 247, 289], "glucosiphilum": [0, 10, 140, 205, 247, 289], "mellicola": [0, 10, 140, 205, 247, 289], "633": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "66": [0, 10, 140, 205, 247, 289], "panamericana": [0, 10, 140, 205, 247, 289], "10762": [0, 10, 140, 205, 247, 289], "leucoagaricu": [0, 10, 140, 205, 247, 289], "symc": [0, 10, 140, 205, 247, 289], "pezoloma": [0, 10, 140, 205, 247, 289], "erica": [0, 10, 140, 205, 247, 289], "neocallimastix": [0, 10, 140, 205, 247, 289], "california": [0, 10, 140, 205, 247, 289], "finni": [0, 10, 140, 205, 247, 289], "anaeromyc": [0, 10, 140, 205, 247, 289], "robustu": [0, 10, 140, 205, 247, 289], "erdmanii": [0, 10, 140, 205, 247, 289], "3471": [0, 10, 140, 205, 247, 289], "disploder": [0, 10, 140, 205, 247, 289], "roggenkampii": [0, 10, 140, 205, 247, 289], "ec_38vim1": [0, 10, 140, 205, 247, 289], "et080813": [0, 10, 140, 205, 247, 289], "dacryopinax": [0, 10, 140, 205, 247, 289], "primogenitu": [0, 10, 140, 205, 247, 289], "vgii": [0, 10, 140, 205, 247, 289], "la55": [0, 10, 140, 205, 247, 289], "vgiv": [0, 10, 140, 205, 247, 289], "ind107": [0, 10, 140, 205, 247, 289], "amphiambli": [0, 10, 140, 205, 247, 289], "wsbs2006": [0, 10, 140, 205, 247, 289], "fijiensi": [0, 10, 140, 205, 247, 289], "cirad86": [0, 10, 140, 205, 247, 289], "testicularia": [0, 10, 140, 205, 247, 289], "cyperi": [0, 10, 140, 205, 247, 289], "phaseoli": [0, 10, 140, 205, 247, 289], "planoprotostelium": [0, 10, 140, 205, 247, 289], "fungivorum": [0, 10, 140, 205, 247, 289], "fortiea": [0, 10, 140, 205, 247, 289], "contorta": [0, 10, 140, 205, 247, 289], "7126": [0, 10, 140, 205, 247, 289], "parmentieri": [0, 10, 140, 205, 247, 289], "wpp163": [0, 10, 140, 205, 247, 289], "bifiguratu": [0, 10, 140, 205, 247, 289], "adelaida": [0, 10, 140, 205, 247, 289], "emergomyc": [0, 10, 140, 205, 247, 289], "ep9510": [0, 10, 140, 205, 247, 289], "dinothrombium": [0, 10, 140, 205, 247, 289], "tinctorium": [0, 10, 140, 205, 247, 289], "ccfee": [0, 10, 140, 205, 247, 289], "5018": [0, 10, 140, 205, 247, 289], "rao": [0, 10, 140, 205, 247, 289], "2017": [0, 9, 10, 140, 205, 247, 289], "camponoti": [0, 10, 140, 205, 247, 289], "rufipedi": [0, 10, 140, 205, 247, 289], "ooceraea": [0, 10, 140, 205, 247, 289], "biroi": [0, 10, 140, 205, 247, 289], "vespertilioni": [0, 10, 140, 205, 247, 289], "coniella": [0, 10, 140, 205, 247, 289], "lustricola": [0, 10, 140, 205, 247, 289], "ultimum": [0, 10, 140, 205, 247, 289], "br144": [0, 10, 140, 205, 247, 289], "silvera": [0, 10, 140, 205, 247, 289], "303099": [0, 10, 140, 205, 247, 289], "rutstroemia": [0, 10, 140, 205, 247, 289], "njr": [0, 10, 140, 205, 247, 289], "2017a": [0, 10, 140, 205, 247, 289], "wrk4": [0, 10, 140, 205, 247, 289], "bvv2": [0, 10, 140, 205, 247, 289], "bbw": [0, 10, 140, 205, 247, 289], "paragasseri": [0, 10, 140, 205, 247, 289], "jv": [0, 10, 140, 205, 247, 289], "v03": [0, 10, 140, 205, 247, 289], "laumondii": [0, 10, 140, 205, 247, 289], "tto1": [0, 10, 140, 205, 247, 289], "pyrrhoderma": [0, 10, 140, 205, 247, 289], "noxium": [0, 10, 140, 205, 247, 289], "hondaea": [0, 10, 140, 205, 247, 289], "fermentalgiana": [0, 10, 140, 205, 247, 289], "yamadazyma": [0, 10, 140, 205, 247, 289], "tenui": [0, 10, 140, 205, 247, 289], "10573": [0, 10, 140, 205, 247, 289], "hyaloscypha": [0, 10, 140, 205, 247, 289], "nothophytophthora": [0, 10, 140, 205, 247, 289], "chile5": [0, 10, 140, 205, 247, 289], "odoratissimum": [0, 10, 140, 205, 247, 289], "54006": [0, 10, 140, 205, 247, 289], "gloeothec": [0, 10, 140, 205, 247, 289], "citriformi": [0, 10, 140, 205, 247, 289], "7424": [0, 10, 140, 205, 247, 289], "verrucosa": [0, 10, 140, 205, 247, 289], "7822": [0, 10, 140, 205, 247, 289], "subtropica": [0, 10, 140, 205, 247, 289], "51142": [0, 10, 140, 205, 247, 289], "chwakensi": [0, 10, 140, 205, 247, 289], "ccy0110": [0, 10, 140, 205, 247, 289], "rippkaea": [0, 10, 140, 205, 247, 289], "8802": [0, 10, 140, 205, 247, 289], "thermothielavioid": [0, 10, 140, 205, 247, 289], "8126": [0, 10, 140, 205, 247, 289], "podospora": [0, 10, 140, 205, 247, 289], "mat": [0, 10, 140, 205, 247, 289], "djm": [0, 10, 140, 205, 247, 289], "731": [0, 10, 140, 205, 247, 289], "ssp": [0, 10, 140, 205, 247, 289], "akanthomyc": [0, 10, 140, 205, 247, 289], "lecanii": [0, 10, 140, 205, 247, 289], "1005": [0, 10, 140, 205, 247, 289], "vanettenii": [0, 10, 140, 205, 247, 289], "consistency_score_threshold": [0, 10, 140, 205, 247, 289], "filter_consistency_scor": [0, 10, 140, 205, 247, 289], "phylomedb": [0, 5, 9, 10, 140, 205, 247, 289], "consist": [0, 5, 10, 24, 53, 140, 205, 247, 289, 315, 316, 323, 324, 325], "repres": [0, 4, 10, 140, 205, 247, 262, 289, 323, 324, 325], "orthologi": [0, 10, 140, 205, 247, 289], "normalize_median_of_ratio": [0, 10], "reference_group": [0, 10, 141], "return_scaling_factor": [0, 5, 10, 141, 142, 143, 144, 145, 146, 147, 148], "ratio": [0, 5, 10, 141, 142, 323, 324, 325], "mrn": [0, 5, 10, 141, 324, 325], "maza": [0, 10, 141], "2013": [0, 9, 10, 141], "pick": [0, 5, 10, 24, 53, 141, 142, 166, 167, 168, 169, 323, 324, 325], "multipli": [0, 10, 141, 143], "total": [0, 10, 77, 141, 144, 145, 146, 147, 148, 163, 324], "final": [0, 6, 10, 141, 143, 168, 169, 324, 325], "adjust": [0, 5, 10, 141, 143, 177, 194, 323, 324, 325], "symmetri": [0, 10, 141, 143], "integ": [0, 5, 10, 24, 53, 141, 163, 324], "normalize_rl": [0, 10, 324, 325], "rle": [0, 5, 10, 142, 324, 325], "ander": [0, 9, 10, 142], "huber": [0, 9, 10, 142], "2010": [0, 10, 142, 143, 144, 168], "geometr": [0, 10, 142], "across": [0, 5, 10, 142, 145, 148, 323, 324, 325], "wise": [0, 1, 10, 142, 152, 323], "normalize_tmm": [0, 10, 324, 325], "log_ratio_trim": [0, 10, 143], "sum_trim": [0, 10, 143], "a_cutoff": [0, 10, 143], "10000000000": [0, 10, 143], "tmm": [0, 5, 10, 143, 324, 325], "robinson": [0, 10, 143], "oshlack": [0, 10, 143], "log2": [0, 5, 10, 143, 151, 173, 177, 183, 191, 214, 218, 221, 259, 262, 268, 276, 299, 303, 323, 324, 325], "minu": [0, 10, 143], "extrem": [0, 10, 143, 323, 324, 325], "bottom": [0, 2, 5, 7, 10, 143, 163, 323, 324, 325], "smaller": [0, 10, 65, 66, 143, 323, 324, 325], "cutuff": [0, 10, 143], "avoid": [0, 10, 143, 324, 325], "inf": [0, 10, 143, 262, 324], "next": [0, 2, 7, 10, 143, 152, 323, 324, 325], "invers": [0, 10, 143, 323], "approxim": [0, 10, 143], "direct": [0, 10, 143, 191, 214, 276, 299, 323, 324, 325], "1e10": [0, 10, 143], "lower": [0, 5, 10, 143, 183, 268, 323, 324], "normalize_to_quantil": [0, 10], "quantil": [0, 5, 10, 144, 324, 325], "bullard": [0, 10, 144], "divid": [0, 10, 144, 145, 146, 147, 148, 149, 165, 323, 324, 325], "yield": [0, 10, 144], "normalize_to_rpkm": [0, 5, 10], "merged_exon": [0, 10, 145, 148], "kilobas": [0, 5, 10, 145, 148, 323], "aggreg": [0, 10, 145, 148], "goemetr": [0, 10, 145, 148], "while": [0, 2, 5, 10, 77, 145, 148, 158, 221, 323, 324], "deafult": [0, 10, 24, 30, 40, 53, 59, 65, 66, 72, 145, 148], "normalize_to_rpm": [0, 5, 10, 324, 325], "normalize_to_rpm_htseqcount": [0, 5, 10, 324, 325], "special_counter_fnam": [0, 10, 147], "ambigu": [0, 10, 147, 324, 325], "normalize_to_tpm": [0, 5, 10], "rpk": [0, 10, 148], "kbp": [0, 10, 148], "Then": [0, 1, 10, 148, 323, 325], "similar": [0, 2, 5, 10, 148, 165, 166, 167, 169, 324, 325], "normalize_with_scaling_factor": [0, 5, 10, 324], "scaling_factor_fnam": [0, 10, 149], "scaling_factor": [0, 10, 149, 324], "number_filt": [0, 10, 307, 324], "greater": [0, 7, 10, 150, 206, 248, 290, 307, 324], "equal": [0, 10, 150, 162, 172, 206, 213, 217, 248, 255, 258, 290, 298, 302], "lesser": [0, 10, 150, 206, 248, 290, 323], "applai": [0, 10, 150, 172, 206, 217, 248, 258, 290, 302], "particular": [0, 5, 9, 10, 24, 53, 150, 172, 206, 217, 248, 258, 290, 302, 323, 324, 325], "eq": [0, 10, 150, 172, 206, 217, 248, 258, 290, 302], "lt": [0, 10, 150, 206, 248, 290], "5900": [0, 10, 150, 206, 248, 290], "pairplot": [0, 5, 10, 324, 325], "show_corr": [0, 10, 151], "pairwis": [0, 10, 151, 152, 323, 324, 325], "relationship": [0, 5, 9, 10, 151, 323, 324, 325], "seaborn": [0, 5, 9, 10, 151], "pseudocount": [0, 5, 10, 151], "spearman": [0, 10, 151, 165, 166, 167, 169, 323, 324, 325], "coeffici": [0, 10, 151, 324, 325], "n_compon": [0, 10, 152, 323], "power_transform": [0, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323], "princip": [0, 5, 10, 152, 160, 163, 324, 325], "compon": [0, 5, 10, 152, 160, 163, 324, 325], "prior": [0, 5, 10, 152, 160, 163, 165, 166, 167, 168, 169], "request": [0, 5, 6, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 152, 292, 324, 325], "project": [0, 1, 5, 9, 10, 152, 323, 324], "displai": [0, 4, 5, 8, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 75, 152, 153, 323, 325], "power": [0, 5, 9, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "transform": [0, 5, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "cox": [0, 10, 152, 160, 163, 165, 166, 167, 168, 169, 173, 218, 259, 303, 323], "standart": [0, 10, 152, 160, 163], "proport": [0, 5, 10, 152, 323, 324, 325], "percentag": [0, 5, 10, 76, 152, 323], "grid": [0, 5, 10, 152], "enabl": [0, 5, 10, 152, 323], "sklearn": [0, 10, 152], "decomposit": [0, 10, 152], "plot_express": [0, 5, 10, 324], "count_unit": [0, 10, 153], "Will": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 153, 292], "print_featur": [0, 10], "alt_filenam": [0, 10, 155, 156, 157, 208, 209, 210, 250, 251, 252, 293, 294, 295], "myfilenam": [0, 10, 155, 156, 157, 208, 209, 210, 250, 251, 252, 293, 294, 295], "save_parquet": [0, 10], "parquet": [0, 5, 10, 156, 157, 209, 210, 251, 252, 294, 295], "save_t": [0, 10], "tsv": [0, 2, 5, 10, 157, 165, 166, 167, 168, 169, 210, 252, 295, 323, 325], "scatter_sample_vs_sampl": [0, 5, 10], "xlabel": [0, 10, 158], "annotation_fonts": [0, 10, 158, 221], "highlight": [0, 5, 10, 75, 158, 323, 325], "point_color": [0, 10, 158], "6d7178": [0, 10, 158], "highlight_color": [0, 10, 158], "00aaff": [0, 10, 158], "opac": [0, 10, 77, 158, 221], "point_siz": [0, 10, 158, 221], "interact": [0, 1, 2, 5, 6, 7, 10, 158, 221, 323, 324], "show_cursor": [0, 10, 158, 221], "click": [0, 1, 2, 5, 7, 8, 10, 158, 221, 323, 325], "avarg": [0, 10, 158], "red": [0, 7, 10, 158, 221], "transpar": [0, 1, 10, 31, 60, 77, 158, 221], "opaqu": [0, 10, 77, 158, 221], "turn": [0, 2, 10, 158, 221, 325], "unlabel": [0, 10, 158, 221], "cursor": [0, 10, 158, 221, 323, 325], "451": [0, 10, 159, 211, 253, 296, 324, 325], "388": [0, 10, 159, 211, 253, 296, 324, 325], "sort_by_principal_compon": [0, 5, 10], "contribut": [0, 5, 6, 10, 160, 163, 324, 325], "load": [0, 4, 5, 6, 9, 10, 103, 160, 163, 177, 222, 262, 308, 323], "understand": [0, 5, 8, 10, 160, 163, 324, 325], "particularli": [0, 2, 10, 160, 324, 325], "trle": [0, 10, 160], "neg": [0, 10, 24, 53, 160, 191, 214, 221, 276, 299, 323, 324, 325], "versu": [0, 10, 160], "split_by_attribut": [0, 5, 10], "attribute2": [0, 10, 161, 212, 254, 297, 324, 325], "split_by_percentil": [0, 10], "specfieid": [0, 10, 162, 213, 255], "split_by_principal_compon": [0, 5, 10], "gene_fract": [0, 10, 163], "influenti": [0, 10, 163], "split_by_read": [0, 5, 10], "low_express": [0, 10, 164], "high_express": [0, 10, 164], "split_clicom": [0, 5, 10], "parameter_dict": [0, 10, 165], "replicate_group": [0, 10, 165], "ungroup": [0, 10, 165], "evidence_threshold": [0, 10, 165, 323, 324, 325], "6666666666666666": [0, 10, 165], "cluster_unclustered_featur": [0, 10, 165, 323, 324, 325], "min_cluster_s": [0, 10, 165, 166, 323, 324, 325], "plot_styl": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 165, 166, 167, 168, 169, 324, 325], "std_area": [0, 10, 165, 166, 167, 168, 169, 324, 325], "std_bar": [0, 10, 165, 166, 167, 168, 169, 324, 325], "parallel_backend": [0, 2, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "multiprocess": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "loki": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "sequenti": [0, 2, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 306, 308, 323], "gui_mod": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 165, 166, 167, 168, 169], "clicom": [0, 2, 5, 10, 165], "mimaroglu": [0, 5, 10, 165], "yagci": [0, 5, 10, 165], "incorpor": [0, 10, 165, 323, 324, 325], "solut": [0, 2, 10, 165, 323, 324, 325], "due": [0, 5, 10, 165, 324, 325], "natur": [0, 10, 165, 307, 323], "classifi": [0, 10, 165, 166, 323, 324, 325], "nois": [0, 10, 165, 166, 323, 324, 325], "influenc": [0, 10, 165, 323, 324, 325], "batch": [0, 5, 10, 165, 323, 324, 325], "advantag": [0, 10, 165, 323, 324, 325], "measur": [0, 10, 165, 323, 324, 325], "improv": [0, 1, 5, 7, 10, 165], "theori": [0, 10, 165], "behind": [0, 10, 165], "public": [0, 7, 10, 165, 323, 324, 325], "doi": [0, 9, 10, 165, 324, 325], "1093": [0, 9, 10, 165], "bib": [0, 10, 165], "bbs057": [0, 10, 165], "twice": [0, 5, 10, 165], "reliabl": [0, 5, 10, 165], "forc": [0, 10, 165, 323, 324, 325], "part": [0, 1, 5, 10, 165, 323, 324], "even": [0, 1, 5, 10, 165], "larger": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 165, 166, 292, 323, 324, 325], "fewer": [0, 10, 165, 166, 323, 324, 325], "seek": [0, 10, 165, 166, 167, 168, 169], "dictionari": [0, 10, 76, 77, 165, 308, 324], "medoid": [0, 5, 10, 165, 168, 169], "hdbscan": [0, 5, 7, 9, 10, 165, 166], "prefer": [0, 5, 10, 165, 323, 324], "yoi": [0, 10, 165], "n_cluster": [0, 10, 165, 167, 168, 169, 323, 324], "cosin": [0, 5, 10, 165, 166, 167, 169, 324, 325], "four": [0, 5, 10, 165, 325], "style": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 77, 165, 166, 167, 168, 169, 323, 324, 325], "babckend": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "case": [0, 1, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 323, 324, 325], "dev_stag": [0, 10, 165, 166, 167, 168, 169], "elegans_developmental_stag": [0, 10, 165, 166, 167, 168, 169], "44072": [0, 10, 165, 166, 167, 168, 169], "2326": [0, 10, 165, 166, 167, 168, 169], "46398": [0, 10, 165, 166, 167, 168, 169], "140": [0, 10, 165, 168], "ys1": [0, 10, 165, 166, 167, 169, 324, 325], "yr1": [0, 10, 165, 166, 167, 169, 323, 324, 325], "jackknif": [0, 10, 165, 166, 167, 169, 323, 324, 325], "kmedoid": [0, 10, 165], "651": [0, 10, 165], "06it": [0, 10, 165], "cliqu": [0, 10, 165], "42436": [0, 10, 165], "61385": [0, 10, 165], "87it": [0, 10, 165], "153": [0, 10, 165, 166], "unclust": [0, 10, 165, 166, 323, 324, 325], "1864": [0, 10, 165], "462": [0, 10, 165], "2115": [0, 10, 165], "204": [0, 10, 165, 166], "2123": [0, 10, 165], "203": [0, 10, 165], "2128": [0, 10, 165], "2167": [0, 10, 165], "159": [0, 10, 165], "2179": [0, 10, 165], "2204": [0, 10, 165], "2229": [0, 10, 165, 169], "2234": [0, 10, 165, 166], "2238": [0, 10, 165, 166, 167], "2263": [0, 10, 165], "47": [0, 9, 10, 165], "split_hdbscan": [0, 5, 10], "min_sampl": [0, 5, 10, 166], "pearson": [0, 10, 166, 167, 169, 324, 325], "manhattan": [0, 10, 166, 167, 169, 324, 325], "sharpened_cosin": [0, 10, 166, 167, 169], "cluster_selection_epsilon": [0, 10, 166], "cluster_selection_method": [0, 10, 166], "eom": [0, 10, 166], "leaf": [0, 10, 166], "return_prob": [0, 10, 166], "ndarrai": [0, 10, 41, 166], "neighbourhood": [0, 10, 166], "conserv": [0, 10, 166], "condens": [0, 10, 166], "excess": [0, 10, 166], "mass": [0, 10, 166], "persist": [0, 10, 166], "fine": [0, 10, 166], "grain": [0, 10, 166, 323], "homogen": [0, 10, 166], "arrai": [0, 2, 10, 166, 323, 324], "probabl": [0, 2, 10, 166, 323, 324, 325], "categor": [0, 5, 10, 31, 60, 166, 323], "otherswis": [0, 10, 166], "79": [0, 10, 166], "2019": [0, 6, 9, 10, 166], "2146": [0, 10, 166], "2173": [0, 10, 166], "2176": [0, 10, 166], "2183": [0, 10, 166], "143": [0, 10, 166], "2192": [0, 10, 166, 169], "2244": [0, 10, 166], "2246": [0, 10, 166, 167], "split_hierarch": [0, 5, 10], "gap": [0, 9, 10, 167, 168, 169, 323, 324, 325], "silhouett": [0, 10, 167, 168, 169, 323, 324, 325], "calinski_harabasz": [0, 10, 167, 168, 169], "davies_bouldin": [0, 10, 167, 168, 169], "bic": [0, 10, 167, 168, 169], "distance_threshold": [0, 10, 167], "max_n_clusters_estim": [0, 10, 167, 168, 169], "observ": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 167, 292, 323, 324, 325], "try": [0, 5, 10, 167, 168, 169, 323, 324], "optim": [0, 9, 10, 167, 168, 169, 323, 324], "appropri": [0, 5, 10, 167, 168, 169, 323, 324, 325], "1718": [0, 10, 167], "608": [0, 10, 167], "1979": [0, 10, 167], "347": [0, 10, 167], "2094": [0, 10, 167], "2110": [0, 10, 167], "2156": [0, 10, 167], "2191": [0, 10, 167], "2195": [0, 10, 167], "2223": [0, 10, 167], "2224": [0, 10, 167], "2252": [0, 10, 167, 169], "2286": [0, 10, 167], "center": [0, 10, 73, 167, 323, 324, 325], "split_kmean": [0, 5, 10, 324], "n_init": [0, 10, 168, 169], "max_it": [0, 10, 168, 169], "300": [0, 10, 74, 75, 168, 169], "determinist": [0, 10, 168, 169, 323], "consecut": [0, 5, 10, 168, 169], "inertia": [0, 10, 168, 169], "1801": [0, 10, 168], "316": [0, 10, 168], "267": [0, 10, 168], "2185": [0, 10, 168], "2186": [0, 10, 168], "2219": [0, 10, 168], "2225": [0, 10, 168], "2250": [0, 10, 168], "67": [0, 10, 168], "2276": [0, 10, 168], "split_kmedoid": [0, 5, 10], "1967": [0, 10, 169], "359": [0, 9, 10, 169], "2071": [0, 10, 169], "2131": [0, 10, 169], "2145": [0, 10, 169], "169": [0, 10, 169], "2159": [0, 10, 169], "2182": [0, 10, 169], "144": [0, 10, 169], "136": [0, 10, 169], "2268": [0, 10, 169], "2275": [0, 10, 169], "wbgene00000017": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000024": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000010": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000020": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000029": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324], "wbgene00000019": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000023": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000025": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000014": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000027": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000021": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000012": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000026": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000007": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000008": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000013": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000011": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000015": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000018": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000016": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000028": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000022": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000009": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "tail": [0, 10, 324, 325], "2236": [0, 10, 171, 216, 257, 301, 324, 325], "185837": [0, 10, 171, 216, 257, 301, 324], "477374": [0, 10, 171, 216, 257, 301, 324, 325], "910000e": [0, 10, 171, 216, 257, 301, 324], "81": [0, 10, 171, 216, 257, 301, 324, 325], "460000e": [0, 10, 171, 216, 257, 301, 324], "343": [0, 10, 171, 216, 257, 301, 324, 325], "648987": [0, 10, 171, 216, 257, 301, 324], "037191": [0, 10, 171, 216, 257, 301, 324], "320000e": [0, 10, 171, 216, 257, 301, 324], "142856": [0, 10, 171, 216, 257, 301, 324], "352044": [0, 10, 171, 216, 257, 301, 324, 325], "580000e": [0, 10, 171, 216, 257, 301, 324], "120000e": [0, 10, 171, 216, 257, 301, 324], "71": [0, 10, 171, 216, 257, 301, 324, 325], "219": [0, 10, 171, 216, 257, 301, 324, 325], "163200": [0, 10, 171, 216, 257, 301, 324], "913657": [0, 10, 171, 216, 257, 301, 324, 325], "420000e": [0, 10, 171, 216, 257, 301, 324], "1066": [0, 10, 171, 216, 257, 301, 324], "242402": [0, 10, 171, 216, 257, 301, 324], "811281": [0, 10, 171, 216, 257, 301, 324], "813048": [0, 10, 171, 216, 257, 301, 324], "101303": [0, 10, 171, 216, 257, 301, 324, 325], "740000e": [0, 10, 171, 216, 257, 301, 324], "3168": [0, 10, 171, 216, 257, 301, 324, 325], "566714": [0, 10, 171, 216, 257, 301, 324], "906719": [0, 10, 171, 216, 257, 301, 324, 325], "600000e": [0, 10, 171, 216, 257, 301, 324], "340000e": [0, 10, 171, 216, 257, 301, 324], "925724": [0, 10, 171, 216, 257, 301, 324], "801676": [0, 10, 171, 216, 257, 301, 324, 325], "230000e": [0, 10, 171, 216, 257, 301, 324], "820000e": [0, 10, 171, 216, 257, 301, 324], "text_filt": [0, 10], "text": [0, 2, 5, 10, 77, 172, 217, 258, 302, 324, 325], "ew": [0, 10, 172, 217, 258, 302], "ac3": [0, 10, 172, 217, 258, 302], "ln": [0, 10, 173, 218, 259, 303, 323], "callabl": [0, 10, 173, 218, 259, 303], "function_kwarg": [0, 10, 173, 218, 259, 303], "logx": [0, 10, 173, 218, 259, 303], "taken": [0, 10, 173, 218, 259, 303, 324, 325], "filt_log10": [0, 10, 173, 218, 259], "lambda": [0, 10, 173, 218, 259], "translate_gene_id": [0, 5, 10], "translate_to": [0, 10, 37, 69, 174, 219, 260, 304], "translate_from": [0, 10, 37, 69, 174, 219, 260, 304], "anoth": [0, 5, 8, 10, 19, 26, 28, 29, 36, 37, 48, 55, 57, 58, 68, 69, 174, 177, 219, 260, 304, 323, 324, 325], "servic": [0, 9, 10, 37, 69, 174, 219, 260, 304, 325], "choos": [0, 5, 8, 10, 37, 69, 174, 219, 260, 304, 323], "fail": [0, 2, 5, 10, 37, 69, 174, 219, 260, 304], "violin_plot": [0, 5, 10], "log_10": [0, 10, 176], "insid": [0, 5, 7, 10, 176], "log2fc_col": [0, 10, 177, 198, 324], "padj_col": [0, 10, 177, 198, 324], "suppress_warn": [0, 10, 130, 177, 198, 262, 282], "deseq": [0, 10, 177, 222], "filter_abs_log2_fold_chang": [0, 10, 324], "abslog2fc": [0, 10, 183, 268], "log2fc": [0, 10, 183, 268], "went": [0, 5, 10, 183, 268], "sample_deseq": [0, 10, 183, 191, 194], "filter_fold_change_direct": [0, 10, 324], "filter_signific": [0, 10, 324], "did": [0, 5, 10, 194, 323, 324], "significantli": [0, 5, 10, 194, 221, 292, 323, 324, 325], "split_fold_change_direct": [0, 10, 324], "filteirng": [0, 10, 214], "volcano_plot": [0, 5, 10, 324], "log2fc_threshold": [0, 10, 221], "volcano": [0, 5, 10, 221, 323, 325], "adj": [0, 10, 221], "upregul": [0, 10, 221, 323, 324], "downregul": [0, 10, 221, 323], "paint": [0, 10, 221], "regul": [0, 10, 221, 323, 324, 325], "numerator_nam": [0, 10, 262, 282], "denominator_nam": [0, 10, 262, 282], "incorrect": [0, 5, 10, 262], "fc_1": [0, 10, 268, 276, 292, 299, 324], "randomization_test": [0, 10, 324], "rep": [0, 10, 292], "10000": [0, 10, 24, 30, 40, 53, 59, 72, 292], "examin": [0, 5, 6, 10, 292, 324], "background": [0, 4, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292], "repetit": [0, 10, 292, 324, 325], "000": [0, 10, 292, 324, 325], "dir": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292], "prompt": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292, 323, 324, 325], "f_background": [0, 10, 292, 324], "f_test": [0, 10, 292, 324], "rand_test_r": [0, 10, 292, 324], "806873": [0, 10, 292, 324], "360264": [0, 10, 292, 324], "pos_log2fc": [0, 10, 299], "neg_log2fc": [0, 10, 299], "filter_typ": [0, 10, 306, 308, 324], "collect": [0, 10, 306], "_apply_filter_norm_sort": 0, "filter_object": [0, 10, 308], "other_output": 0, "other_cnt": 0, "_apply_oth": 0, "recursive_cal": 0, "counter": [0, 324, 325], "call": [0, 2, 5, 7, 323, 324, 325], "_apply_split": 0, "correspod": [0, 10, 307], "virtual": [0, 10, 307], "apply_to": [0, 5, 10, 307, 324], "unkeyword": [0, 10, 307], "col1": [0, 10, 307], "ident": [0, 10, 308, 323, 324], "noth": [0, 10, 308], "d_filter": [0, 10, 308, 324], "ontologi": [0, 5, 9, 10, 11, 24, 53, 65, 74, 75, 323, 324, 325], "tissu": [0, 10, 11, 323], "phenotyp": [0, 10, 11], "gene_set": [0, 10, 12, 41, 324], "set_nam": [0, 5, 10, 12, 15, 41, 44, 324], "preform": [0, 10, 12, 41], "func_kwarg": 0, "update_kwarg": 0, "self": 0, "en": [0, 10, 14, 18, 25, 35, 38, 43, 47, 54, 67, 70, 324, 325], "change_set_nam": [0, 5, 10], "new_nam": [0, 10, 15, 44], "clear": [0, 5, 325], "shallow": [0, 17, 46], "rankedset": [0, 4, 5, 10, 18, 25, 35], "against": [0, 10, 18, 24, 25, 30, 31, 35, 38, 40, 47, 53, 54, 59, 60, 67, 70, 72, 324, 325], "compar": [0, 1, 9, 10, 18, 25, 35, 38, 47, 54, 65, 66, 67, 70, 324, 325], "en2": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70], "difference_upd": 0, "unlik": [0, 20, 49, 323, 324, 325], "rais": [0, 5, 10, 20, 31, 32, 33, 40, 49, 60, 61, 62, 64, 72], "except": [0, 5, 20, 49, 324], "go_enrich": [0, 5, 10, 324], "statistical_test": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "fisher": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "hypergeometr": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "background_gen": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 324], "biotype_ref_path": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72], "aspect": [0, 5, 10, 24, 53, 65, 74, 323], "biological_process": [0, 10, 24, 53, 65, 74], "cellular_compon": [0, 10, 24, 53, 65, 74], "molecular_funct": [0, 10, 24, 53, 65, 74], "exclude_unannotated_gen": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "return_nonsignific": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "return_fig": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 324, 325], "plot_horizont": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "show_expect": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "bar": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 323, 324, 325], "lollipop": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "plot_ontology_graph": [0, 10, 24, 53, 65, 324, 325], "ontology_graph_format": [0, 10, 24, 53, 65, 324, 325], "pdf": [0, 5, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "png": [0, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "svg": [0, 5, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "randomization_rep": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "deplet": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 324, 325], "via": [0, 2, 7, 9, 10, 24, 53, 65, 324, 325], "solr": [0, 10, 24, 53, 65], "engin": [0, 10, 24, 53, 65], "golr": [0, 10, 24, 53, 65], "variabl": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 323, 324, 325], "benjamini": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "hochberg": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "step": [0, 1, 2, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 323, 325], "fdr": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "clariti": [0, 1, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "linear": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 324, 325], "smallest": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 323, 324, 325], "some": [0, 2, 5, 7, 8, 10, 24, 30, 40, 53, 59, 72, 323, 324, 325], "cannot": [0, 2, 10, 24, 30, 31, 40, 53, 59, 60, 72, 323, 324, 325], "associ": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "practic": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "sinc": [0, 2, 5, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "unannot": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "chanc": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "spuriou": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "depict": [0, 10, 24, 30, 53, 59, 65, 66, 323, 324, 325], "additon": [0, 10, 24, 30, 53, 59, 65, 66, 74, 75], "horizont": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "vertic": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "shown": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "pseudorandom": [0, 10, 24, 53], "get": [0, 5, 6, 7, 9, 10, 24, 53, 323, 324, 325], "repitit": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "return_figur": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "common": [0, 5, 10, 25, 54, 312, 323, 324, 325], "intersection_upd": 0, "isdisjoint": 0, "null": [0, 27, 56], "issubset": 0, "report": [0, 5, 6, 7, 9, 28, 29, 57, 58], "issuperset": 0, "kegg_enrich": [0, 10, 324], "plot_pathway_graph": [0, 10, 30, 59, 66], "pathway_graphs_format": [0, 10, 30, 59, 66], "encyclopedia": [0, 10, 30, 59, 66, 325], "non_categorical_enrich": [0, 10, 324], "parametric_test": [0, 10, 31, 60, 324, 325], "attr_ref_path": [0, 10, 31, 40, 60, 64, 72, 324], "plot_log_scal": [0, 10, 31, 60, 324, 325], "interleav": [0, 10, 31, 60, 324, 325], "n_bin": [0, 10, 31, 60], "sign": [0, 10, 31, 60, 324, 325], "parametr": [0, 10, 31, 60, 324, 325], "logarithm": [0, 5, 10, 31, 60, 323, 324, 325], "histogram": [0, 10, 31, 60, 323, 324, 325], "semi": [0, 10, 31, 60, 323], "obsrev": [0, 10, 31, 60], "pop": [0, 5, 323, 325], "arbitrari": [0, 32, 61], "keyerror": [0, 32, 33, 61, 62], "empti": [0, 5, 32, 61, 323, 324, 325], "save_txt": [0, 10, 324], "doesn": [0, 10, 34, 63, 323, 324, 325], "ONE": [0, 10, 35, 67], "symmetric_difference_upd": 0, "user_defined_enrich": [0, 5, 10, 324], "ranked_gen": [0, 10, 41, 324], "rank": [0, 1, 4, 5, 9, 10, 41, 324, 325], "meaning": [0, 10, 41, 323, 324, 325], "vector": [0, 10], "single_set_enrich": [0, 5, 10, 324], "min_positive_gen": [0, 10, 64, 65, 66], "lowest_cutoff": [0, 10, 64, 65, 66], "xl": [0, 5, 7, 9, 10, 64, 65, 66, 324], "mhg": [0, 5, 7, 9, 10, 64, 65, 66, 324], "develop": [0, 1, 6, 10, 64, 65, 66, 323, 324, 325], "prof": [0, 7, 10, 64, 65, 66, 323, 325], "zohar": [0, 10, 64, 65, 66], "yakhini": [0, 9, 10, 64, 65, 66], "colleagu": [0, 10, 64, 65, 66], "florian": [0, 10, 64, 65, 66], "wagner": [0, 5, 9, 10, 64, 65, 66], "single_set_go_enrich": [0, 5, 10, 324], "nonparametr": [0, 10, 65, 66], "real": [0, 10, 65, 66, 323, 324, 325], "rest": [0, 10, 65, 66, 323, 324, 325], "single_set_kegg_enrich": [0, 10, 324], "_fetch_set": 0, "obj": [0, 5, 10, 76, 77], "upset_plot": [0, 5, 10, 324], "venn_diagram": [0, 5, 10, 324], "kei": [0, 10, 76, 77, 324, 325], "enrichment_bar_plot": [0, 5, 10], "results_table_path": [0, 10, 73, 74], "enrichment_score_column": [0, 10, 73, 74], "log2_fold_enrich": [0, 10, 73, 74, 324, 325], "log2_enrichment_scor": [0, 10, 73, 74], "n_bar": [0, 5, 10, 73], "center_bar": [0, 10, 73], "log_2": [0, 10, 73, 74, 75], "ylim": [0, 5, 10, 73], "asterisk": [0, 5, 10, 73, 324, 325], "around": [0, 10, 73, 323, 324, 325], "limit": [0, 5, 10, 73, 324], "gene_ontology_graph": [0, 5, 10], "graph_format": [0, 10, 74, 75], "dpi": [0, 10, 74, 75], "resolut": [0, 10, 74, 75], "inch": [0, 10, 74, 75], "kegg_pathway_graph": [0, 5, 10], "pathway_id": [0, 10, 75], "marked_gen": [0, 10, 75], "set_color": [0, 10, 76, 77], "colorlist": [0, 10, 76, 77], "upset": [0, 5, 8, 10, 76, 323, 325], "show_percentag": [0, 10, 76], "attr_ref_table_path": [0, 10, 76, 77], "fig": [0, 10, 76, 77], "gene1": [0, 2, 10, 12, 41, 76, 77, 324], "gene2": [0, 2, 10, 12, 41, 76, 77, 324], "gene3": [0, 2, 10, 76, 77, 324], "name_of_attribute_from_reference_t": [0, 10, 76, 77], "iif": [0, 10, 76], "subset": [0, 1, 8, 10, 76, 77, 324, 325], "mix": [0, 5, 10, 76], "entir": [0, 5, 10, 76, 323, 325], "onto": [0, 10, 76, 77], "plt": [0, 10, 76], "add_outlin": [0, 10, 77], "linecolor": [0, 10, 77], "linestyl": [0, 10, 77], "solid": [0, 10, 77], "dash": [0, 10, 77], "linewidth": [0, 10, 77], "set_fonts": [0, 10, 77], "subset_fonts": [0, 10, 77], "normalize_to": [0, 10, 77], "venn": [0, 5, 8, 9, 10, 77, 325], "diagram": [0, 5, 8, 10, 77, 325], "circl": [0, 5, 10, 77, 323, 325], "area": [0, 10, 77, 323], "outlin": [0, 5, 10, 77], "widdth": [0, 10, 77], "ax": [0, 5, 10, 77, 323], "sometim": [0, 5, 10, 77], "tune": [0, 5, 10, 77, 324, 325], "overal": [0, 5, 10, 77], "fitur": [0, 10, 77], "fit": [0, 5, 8, 10, 77, 323, 324, 325], "better": [0, 5, 10, 77, 324, 325], "venndiagram": [0, 10, 77], "patch": [0, 1, 5, 10, 77], "pars": [0, 5, 10, 312, 315, 316, 317, 325], "parse_gene_name_str": [0, 10], "daf": [0, 10, 315, 316, 324], "lin15b": [0, 10, 315], "saeg": [0, 10, 315], "lin": [0, 10, 315, 324], "15b": [0, 10, 315, 324], "cyp": [0, 10, 315], "23a1lin": [0, 10, 315], "15a": [0, 10, 315], "wbgene12345678": [0, 10, 315, 317], "ghf5h": [0, 10, 315], "23a1": [0, 10, 315], "parse_sequence_name_str": [0, 10], "y55d5a": [0, 10, 316, 324], "digit": [0, 10, 316, 317], "cele_y55d5a": [0, 10, 316], "5t23g5": [0, 10, 316], "6wbgene00000000": [0, 10, 316], "zk662": [0, 10, 316], "t23g5": [0, 10, 316, 324], "parse_wbgene_str": [0, 10, 324], "wbgene98765432wbgene00000000": [0, 10, 317], "genewbgene44444444daf": [0, 10, 317], "16a5ghb": [0, 10, 317], "wbgene55555555": [0, 10, 317], "wbgene44444444": [0, 10, 317], "wbgene98765432": [0, 10, 317], "wbgene00000000": [0, 10, 317], "print_settings_fil": [0, 10], "configur": [0, 8, 10, 318], "my_attribute_reference_table_path": [0, 10, 318, 321], "my_biotype_reference_table_path": [0, 10, 318, 322], "reset_settings_fil": [0, 10], "reset": [0, 10, 319, 325], "warn": [0, 5, 10, 103, 177, 262, 319, 323, 325], "action": [0, 5, 10, 319, 323, 324, 325], "irrevers": [0, 10, 319], "save_to_csv": [0, 10], "control": [0, 1, 10, 320, 325], "set_attr_ref_table_path": [0, 4, 10, 324], "wish": [0, 10, 321, 322, 323, 324], "set_biotype_ref_table_path": [0, 4, 10, 324], "mainli": 0, "welcom": 1, "greatli": 1, "appreci": 1, "littl": 1, "credit": [1, 6], "github": [1, 2, 5, 6, 7], "com": [1, 7, 9, 324, 325], "guyteichman": [1, 7, 9], "issu": [1, 2, 5, 103, 177, 262, 323, 324, 325], "pleas": [1, 2, 5, 7, 9, 323, 325], "system": [1, 2, 5, 7, 323, 325], "might": [1, 2, 7, 323], "troubleshoot": 1, "reproduc": [1, 2, 6, 323, 324, 325], "through": [1, 5, 7, 8, 9, 323, 324], "open": [1, 5, 6, 7, 9, 323], "whoever": 1, "offici": [1, 2, 323], "docstr": [1, 5], "web": 1, "blog": 1, "articl": [1, 324], "send": 1, "propos": 1, "scope": 1, "narrow": 1, "easier": [1, 5, 8, 323, 324, 325], "rememb": [1, 2, 323], "volunt": 1, "driven": 1, "think": 1, "rather": [1, 323], "unsort": [1, 4], "nice": 1, "thing": [1, 2, 324], "hide": 1, "gsea": 1, "enrich": [1, 4, 5, 6, 7, 9, 118, 160, 187, 231, 272], "distplot": 1, "matric": [1, 2, 4, 5, 8, 9, 323], "cell": [1, 5, 323, 324, 325], "atac": 1, "seq": [1, 7, 9, 323, 324, 325], "gener": [1, 4, 5, 6, 7, 8, 9, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 97, 98, 99, 104, 107, 108, 109, 111, 112, 114, 135, 137, 138, 139, 140, 142, 144, 151, 152, 155, 156, 157, 158, 165, 168, 169, 176, 180, 202, 203, 204, 205, 208, 209, 210, 221, 225, 244, 245, 246, 247, 250, 251, 252, 265, 286, 287, 288, 289, 293, 294, 295, 323], "sashimi": 1, "browser": [1, 2, 325], "custom": [1, 9, 324, 325], "As": [1, 2, 323, 325], "prinipl": 1, "futur": [1, 5, 323, 324, 325], "principl": [1, 5, 323, 324, 325], "univers": [1, 9], "usabl": [1, 5], "commonli": [1, 323, 324, 325], "linux": [1, 2, 5, 7], "maco": [1, 2, 5, 7, 9], "scenario": 1, "who": 1, "never": [1, 2, 9], "ask": [1, 5, 6, 323], "themselv": [1, 323, 324, 325], "modul": [1, 2, 4, 5, 11, 78, 102, 307, 312], "my": [1, 5, 12, 41, 323, 324], "graphic": [1, 2, 5, 6, 8, 323], "degre": [1, 323], "serv": 1, "firstli": [1, 325], "advanc": 1, "suit": [1, 9], "perhap": [1, 323], "importantli": [1, 324, 325], "know": [1, 323, 324, 325], "much": [1, 323, 324, 325], "filter": [1, 4, 5, 6, 9, 12, 14, 21, 22, 23, 24, 30, 31, 40, 41, 43, 50, 51, 52, 53, 59, 60, 72, 84, 90, 94, 95, 100, 312, 320], "readi": 1, "here": [1, 5, 323, 324, 325], "fork": 1, "repo": 1, "clone": [1, 7], "git": [1, 7], "your_name_her": 1, "virtualenv": 1, "assum": [1, 323, 324, 325], "virtualenvwrapp": 1, "mkvirtualenv": 1, "py": [1, 5, 7], "branch": 1, "checkout": 1, "bugfix": 1, "now": [1, 2, 5, 7, 8, 323, 324, 325], "flake8": 1, "tox": 1, "just": [1, 8, 324, 325], "pip": [1, 2, 6], "commit": 1, "push": 1, "meet": [1, 324, 325], "readm": 1, "rst": 1, "pypi": [1, 5, 8, 9], "coveral": 1, "io": [1, 324, 325], "sure": [1, 2, 323, 324, 325], "test_rnalysi": 1, "remind": 1, "maintain": [1, 5], "histori": [1, 8, 323, 325], "bumpvers": 1, "travi": 1, "internet": [2, 9, 325], "connect": [2, 324, 325], "command": [2, 5, 7, 8, 9, 323, 325], "troubl": [2, 7], "extend": [2, 5], "caus": [2, 5, 323], "fastq": [2, 5, 6, 7], "faq": 2, "environ": 2, "still": [2, 5, 323, 324], "submit": 2, "bug": [2, 5, 6, 9], "contact": 2, "heavi": 2, "compil": [2, 325], "unfortun": [2, 323, 324, 325], "microsoft": [2, 7, 323, 325], "restart": 2, "again": [2, 323, 325], "anaconda": 2, "miniconda": 2, "conda": 2, "numba": [2, 9], "usual": [2, 323, 324, 325], "video": [2, 5, 6, 7], "repositori": [2, 7, 9], "slow": 2, "link": [2, 5, 6, 9, 323, 324, 325], "appdata": 2, "On": [2, 7, 323, 325], "someth": 2, "roam": 2, "applic": [2, 323, 324, 325], "rnalyisi": 2, "properli": [2, 5, 323, 324, 325], "uninstal": 2, "approach": [2, 324, 325], "brows": 2, "offer": [2, 4, 6, 323, 324, 325], "larg": [2, 323, 324, 325], "imposs": 2, "fortun": [2, 323], "mark": [2, 323, 324, 325], "button": [2, 5, 7, 8, 323, 325], "hover": [2, 323, 325], "screenshot": 2, "couldn": 2, "arriv": 2, "gene4": [2, 324], "convert": [2, 5, 323, 324, 325], "convers": 2, "fairli": [2, 323], "easili": [2, 8, 324, 325], "googl": [2, 323, 325], "sheet": [2, 323, 325], "excel": [2, 5, 323, 325], "libreoffic": 2, "calc": 2, "especi": [2, 323, 324, 325], "spreadsheet": 2, "xlsx": 2, "kind": [2, 323, 324, 325], "howev": [2, 4, 323, 324, 325], "special": [2, 5], "preferr": 2, "intens": [2, 5], "task": [2, 5], "wait": [2, 9, 323], "few": [2, 5, 323, 324, 325], "minut": [2, 7, 9], "our": [2, 324, 325], "session": [2, 5, 323, 324], "compress": [2, 325], "zip": [2, 7, 325], "unzip": [2, 7, 325], "enter": [2, 7, 323, 324, 325], "rnalysis_report": [2, 325], "doubl": [2, 325], "html": [2, 323, 324, 325], "There": [2, 323, 324, 325], "pane": [2, 8, 325], "rnal": [2, 325], "close": [2, 5, 6, 323, 325], "achiev": 2, "refer": [4, 5, 6, 10, 14, 21, 24, 30, 31, 40, 43, 50, 53, 59, 60, 64, 72, 76, 77, 91, 92, 93, 99, 106, 116, 117, 135, 141, 143, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 292, 297, 318, 321, 322, 323], "intestin": [4, 324, 325], "epigenet": [4, 323, 324, 325], "abut": 4, "lncrna": [4, 325], "rnalysi": [4, 5], "enrichmemt": 4, "store": [4, 324], "structur": [4, 177, 262, 324, 325], "util": [4, 5, 324, 325], "subtyp": [4, 324], "introduc": [5, 324, 325], "sever": [5, 324, 325], "read1": 5, "read2": 5, "implement": [5, 323, 324, 325], "thrill": 5, "life": [5, 323], "brief": 5, "panther": [5, 9], "extract": [5, 8, 324, 325], "vein": 5, "facilit": [5, 324, 325], "ve": 5, "person": 5, "apologi": 5, "delai": 5, "bring": 5, "reason": [5, 323], "releas": [5, 7], "schedul": 5, "august": 5, "took": 5, "patienc": 5, "been": [5, 323, 324, 325], "invalu": 5, "eager": 5, "share": [5, 6, 9, 323, 324], "excit": 5, "thank": 5, "stai": 5, "kallisto_quant_single_end": 5, "kallisto_quant_paired_end": 5, "deprac": 5, "old": 5, "freez": 5, "messag": [5, 325], "progress": [5, 323], "disappear": 5, "reach": 5, "layout": 5, "dependeci": 5, "newer": 5, "stand": [5, 6, 9, 323, 324, 325], "alon": [5, 6, 9], "invalid": 5, "discern": 5, "app": [5, 6, 9, 324], "show_exp": 5, "further": [5, 323, 324, 325], "compat": 5, "adress": 5, "relat": 5, "clearli": 5, "wrong": 5, "disabl": [5, 323], "abil": 5, "suggest": [5, 323, 324, 325], "ensur": [5, 323], "theme": 5, "address": 5, "discuss": [5, 323], "tooltip": 5, "global": [5, 9], "toggl": 5, "switch": [5, 325], "draggabl": 5, "illeg": 5, "widget": 5, "clearer": 5, "crop": 5, "outsid": 5, "visibl": 5, "neurorooki": [5, 9], "cancel": [5, 323], "chapter": [5, 324, 325], "softwar": [5, 9, 324], "unsupport": 5, "lastli": 5, "june": 5, "access": [5, 8, 9, 324], "boot": 5, "clockgen": [5, 9], "immedi": 5, "refactor": 5, "hint": 5, "parammet": 5, "sens": [5, 324, 325], "report_read_assignment_path": 5, "quickli": [5, 6, 324, 325], "reflect": [5, 323], "elaps": 5, "higli": 5, "incorrectli": 5, "belowxread": 5, "vice": 5, "versa": 5, "detect": [5, 323, 324, 325], "split_percentil": 5, "foldcangefilt": 5, "proper": 5, "recent": 5, "mac": 5, "unless": [5, 323, 325], "afterward": 5, "complexport": 5, "callinski": 5, "harabasz": 5, "davi": 5, "bouldin": 5, "bayesian": 5, "criterieon": 5, "integr": [5, 9, 325], "dialog": [5, 323, 325], "proccess": 5, "queu": 5, "job": 5, "march": 5, "1st": 5, "importerror": 5, "grei": 5, "whenev": [5, 323, 324, 325], "unabl": 5, "depend": [5, 6, 7, 323, 324, 325], "matthia": [5, 7, 9, 323, 325], "wilm": [5, 7, 9, 323, 325], "sandyl27": [5, 9], "space": 5, "characters": 5, "occasion": 5, "backend": 5, "standalon": 5, "expand": [5, 9, 323], "frequent": [5, 6], "question": [5, 6, 9, 323], "page": [5, 6, 7, 9, 323], "perl": [5, 7], "colour": 5, "obscur": 5, "newli": [5, 323], "typo": 5, "correctli": [5, 324, 325], "customiz": 5, "quick": [5, 6, 323, 324, 325], "procrss": 5, "progammat": 5, "api": [5, 6, 10, 140, 205, 247, 289, 323, 324], "made": [5, 6, 323], "speed": 5, "inherit": 5, "tightli": 5, "scratch": 5, "scree": 5, "sharpen": 5, "cach": 5, "gui": [5, 7, 8, 9, 325], "biologi": [5, 9], "section": [5, 323, 324, 325], "precis": [5, 9], "colorbar": 5, "slight": 5, "stabil": 5, "plot_enrich": 5, "differential_express": 5, "mintxoklet": [5, 9], "bipin": [5, 9], "kumar": [5, 9], "create_kallisto_index": 5, "deprec": 5, "enrich_random": [5, 324], "enrich_hypergeometr": 5, "materi": 5, "edit": [5, 8, 325], "guidelin": [5, 6], "screen": [5, 323, 325], "shorten": 5, "ellipsi": 5, "nessecari": 5, "left": [5, 323, 325], "metadata": [5, 324, 325], "date": 5, "older": 5, "overwrit": 5, "keyboard": 5, "shortcut": [5, 325], "citat": 5, "replicates_group": [5, 323, 324, 325], "filter_biotyp": 5, "queue": 5, "computation": 5, "crash": 5, "auxillari": 5, "restor": [5, 6], "renam": [5, 323, 325], "supplement": 5, "among": 5, "unweight": 5, "moreov": [5, 323, 324, 325], "slightli": 5, "runtim": 5, "randomli": [5, 324, 325], "priorit": 5, "exact": [5, 323, 324, 325], "occurs": 5, "quicker": 5, "conveni": [5, 325], "elabor": [5, 324, 325], "pattern": [5, 323, 324, 325], "perfofm": 5, "eden": [5, 9], "plo": [5, 9, 324], "biol": [5, 9], "2007": [5, 9, 323, 324, 325], "One": [5, 323, 324], "let": [5, 323, 325], "enrich_randomization_parallel": 5, "parallel_process": 5, "activ": [5, 324, 325], "six": [5, 323, 324, 325], "y_titl": 5, "data_scal": 5, "ob": [5, 324, 325], "exp": [5, 324, 325], "respect": [5, 323, 325], "boolean": [5, 324, 325], "_missing_from_biotype_refer": 5, "not_in_biotype_refer": 5, "printout": 5, "board": 5, "feature_str": 5, "abl": [5, 8, 323, 325], "depracationwarn": 5, "utf": 5, "won": [5, 8, 323], "upsetplot": [5, 9], "divis": 5, "previou": [5, 323], "stabl": 5, "upgrad": 5, "write": [5, 7, 9, 323, 324], "deseq_highlight": 5, "load_csv": 5, "predict": 5, "filter_by_ref_table_attr": 5, "split_by_ref_table_attr": 5, "norm_reads_with_size_factor": 5, "norm_reads_to_rpm": 5, "hidden": 5, "feature_name_to_wbgen": 5, "cite": [6, 324, 325], "contributor": 6, "tip": 6, "deploi": 6, "beginn": 6, "friendli": [6, 323], "undo": [6, 323, 325], "icon": [6, 325], "streamlin": 6, "bioinformat": [6, 323], "intro": 6, "word": 6, "glossari": 6, "2023": [6, 9], "02": 6, "2022": [6, 9], "2021": 6, "latest": 7, "amount": [7, 323], "z_window": 7, "z_maco": 7, "launch": [7, 9], "messagebox": 7, "past": 7, "info": 7, "anywai": 7, "corner": [7, 325], "patient": [7, 9], "dmg": [7, 9], "kindli": [7, 323, 325], "machin": 7, "graphviz": 7, "qt": 7, "imag": 7, "debian": 7, "ubuntu": 7, "sudo": 7, "apt": 7, "qt5": 7, "plugin": 7, "hat": 7, "distro": 7, "fedora": 7, "dnf": 7, "qtimageformat": 7, "squar": [7, 324, 325], "bracket": 7, "along": [7, 323, 324, 325], "consol": [7, 8, 9], "run_gui": [7, 8, 9], "Or": [7, 9, 324], "overview": [8, 9, 323, 324, 325], "entireti": [8, 325], "until": [8, 323], "moment": 8, "redo": [8, 323], "resiz": 8, "workspac": 8, "accident": 8, "worri": 8, "soon": 8, "review": [8, 324, 325], "preview": [8, 323, 325], "workflow": [8, 324, 325], "prone": [8, 324, 325], "stage": 8, "research": 9, "visualis": [9, 325], "explor": [9, 323], "profil": 9, "dimension": [9, 323], "reduct": [9, 323], "visit": 9, "simpli": [9, 323, 324, 325], "scikit": [9, 324, 325], "extra": 9, "statsmodel": 9, "joblib": 9, "tqdm": 9, "appdir": 9, "grid_strategi": 9, "pyyaml": 9, "xlmhglite": 9, "pairwisedist": 9, "typing_extens": 9, "pyqt5": 9, "qdarkstyl": 9, "defusedxml": 9, "aiohttp": 9, "aiodn": 9, "aiolimit": 9, "brotli": 9, "networkx": 9, "pyvi": 9, "tenac": 9, "teichman": 9, "cohen": 9, "ganon": 9, "o": 9, "dunski": 9, "shani": 9, "gingold": 9, "rechavi": 9, "bmc": 9, "1186": 9, "s12915": 9, "023": 9, "01574": 9, "martin": 9, "throughput": [9, 324], "embnet": 9, "journal": [9, 324], "pp": 9, "14806": 9, "ej": 9, "200": [9, 323, 324], "brai": 9, "pimentel": 9, "melst": 9, "Near": 9, "probabilist": 9, "nat": 9, "biotechnol": 9, "527": 9, "1038": 9, "nbt": 9, "langmead": 9, "salzberg": 9, "nmeth": 9, "1923": 9, "axtel": 9, "mj": 9, "740": 9, "751": 9, "035279": 9, "112": 9, "love": 9, "moder": 9, "550": 9, "s13059": 9, "0550": 9, "ritchi": 9, "phipson": 9, "wu": 9, "hu": 9, "law": 9, "shi": 9, "smyth": 9, "microarrai": 9, "studi": 9, "nucleic": 9, "acid": 9, "e47": 9, "nar": 9, "gkv007": 9, "chen": 9, "unlock": 9, "r29": 9, "mcinn": 9, "heali": 9, "astel": 9, "densiti": [9, 324, 325], "volum": 9, "1371": [9, 324], "pcbi": [9, 324], "0030039": [9, 324], "lipson": 9, "yogev": 9, "motif": 9, "e39": 9, "arxiv": [9, 324], "48550": 9, "1507": [9, 324], "07905": [9, 324], "fj": 9, "amod": 9, "aneja": 9, "austin": 9, "orimoloy": 9, "azov": 9, "barn": 9, "jan": 9, "d933": 9, "41": 9, "gkac958": 9, "thoma": 9, "ebert": 9, "muruganujan": 9, "mushayahama": 9, "albou": 9, "sci": 9, "1002": 9, "pro": 9, "4218": 9, "kress": 9, "defosset": 9, "ripp": 9, "linard": 9, "thompson": 9, "jd": 9, "portal": 9, "d411": 9, "gky1068": 9, "fuent": 9, "molina": 9, "chorostecki": 9, "u": [9, 323, 325], "capella": 9, "guti\u00e9rrez": 9, "marcet": 9, "houben": 9, "gabald\u00f3n": 9, "v5": 9, "catalogu": 9, "phylogeni": 9, "d1062": 9, "gkab966": 9, "knowledgebas": 9, "d523": 9, "gkac1052": 9, "gmail": 9, "dror": 9, "netta": 9, "shachar": 9, "cookiecutt": 9, "audreyr": 9, "pypackag": 9, "templat": 9, "from_datafram": 10, "readable_nam": 10, "filter_types_rev": 10, "clear_all_cach": 10, "clear_gui_cach": 10, "__init__": [12, 41, 79, 85, 103, 177, 222, 262, 306], "my_set": [12, 41, 324], "filter_obj": [12, 41], "my_other_set": [12, 41, 324], "deseq_pip": [306, 324], "cover": 323, "focu": 323, "nematod": [323, 324, 325], "resourc": [323, 324, 325], "exercis": [323, 325], "demonstr": [323, 324, 325], "publicli": 323, "literatur": 323, "gave": 323, "mandatori": [323, 324, 325], "later": [323, 324, 325], "dedic": [323, 325], "fpkm": 323, "actual": [323, 325], "regard": 323, "magnitud": [323, 324, 325], "everyth": 323, "unfilt": [323, 325], "conveniet": 323, "expelicitli": 323, "undon": [323, 325], "happi": [323, 325], "chose": [323, 325], "scroll": 323, "panel": 323, "reduc": [323, 324, 325], "thousand": 323, "difficult": 323, "vari": 323, "remedi": 323, "rearrang": [323, 325], "captur": [323, 324, 325], "That": 323, "standardaz": 323, "undesir": 323, "skew": 323, "neutral": 323, "largest": 323, "preceed": 323, "worth": 323, "ey": 323, "interestingli": 323, "circular": 323, "worm": 323, "hypothesi": 323, "arrang": 323, "germlin": 323, "embryo": 323, "mostli": 323, "gonad": 323, "adult": 323, "quantiti": 323, "germ": 323, "l4": 323, "prolifer": 323, "l3": 323, "pc2": 323, "spot": 323, "trend": 323, "seem": 323, "dissimilar": [323, 324, 325], "earlier": [323, 325], "unexpress": 323, "wbgene00003864": 323, "almost": 323, "embryon": 323, "skn": 323, "wbgene00004804": 323, "decid": [323, 324, 325], "unlaid": 323, "convei": 323, "had": 323, "subgroup": 323, "cycl": 323, "illustr": 323, "simplest": 323, "challeng": 323, "aren": 323, "tempor": 323, "good": [323, 325], "son": [323, 324, 325], "baek": [323, 324, 325], "anslysi": 323, "orang": 323, "neighbor": [323, 324, 325], "granular": 323, "regular": 323, "biggest": 323, "character": 323, "quit": 323, "outlier": [323, 324, 325], "hope": [323, 324, 325], "ok": [323, 325], "hsbscan": [323, 324, 325], "assumpt": [323, 324, 325], "guess": [323, 324, 325], "reveal": 323, "obviou": 323, "move": [323, 325], "emsembl": 323, "concensu": 323, "weak": [323, 324, 325], "account": [323, 324, 325], "robustli": [323, 324, 325], "robust": [323, 324, 325], "agre": 323, "half": 323, "mind": 323, "plu": 323, "enlarg": 323, "back": [323, 325], "cellular": [323, 324, 325], "molecular": [323, 324, 325], "ancestor": 323, "ran": 323, "throughout": 323, "closer": 323, "geo": 323, "caenorhabidti": 323, "stress": 323, "goal": 323, "answer": 323, "exposur": 323, "expos": 323, "osmot": 323, "gse107704": 323, "srr6348197": 323, "srr6348198": 323, "srr6348199": 323, "srr6348200": 323, "srr6348201": 323, "srr6348202": 323, "starvat": 323, "gse124178": 323, "srr8359132": 323, "srr8359133": 323, "srr8359142": 323, "srr8359134": 323, "srr8359135": 323, "srr8359136": 323, "heat": 323, "shock": 323, "gse132838": 323, "srr9310678": 323, "srr9310679": 323, "srr9310680": 323, "srr9310681": 323, "srr9310682": 323, "srr9310683": 323, "opportun": 323, "uaualli": 323, "portion": 323, "leftov": 323, "happen": 323, "prime": 323, "truseq": 323, "agatcggaagagcacacgtctgaactccagtca": 323, "10bp": 323, "didn": 323, "throw": [323, 324], "awai": 323, "agatcggaagagcgtcgtgtagggaaagagtg": 323, "reorder": 323, "proce": [323, 324, 325], "rapid": [323, 324], "physic": [323, 325], "proceed": [323, 325], "deviaton": 323, "accordingli": 323, "underneath": 323, "subfold": 323, "orient": [323, 324, 325], "languag": [323, 325], "genotyp": [323, 325], "ctrl1": [323, 325], "ctrl": [323, 325], "ctrl2": [323, 325], "ctrl3": [323, 325], "osm1": [323, 325], "osm": [323, 325], "osm2": [323, 325], "osm3": [323, 325], "prepar": [323, 325], "straight": 323, "decent": 323, "mistak": 323, "similarli": [323, 324, 325], "textbox": [323, 325], "notic": 323, "resum": 323, "hard": 323, "big": [323, 325], "seen": 323, "downregl": 323, "simplifi": [323, 325], "luckili": 323, "evolv": 323, "codon": 323, "norm": 323, "certain": [323, 324, 325], "attirbut": 323, "mock": 323, "feature_indic": [323, 324, 325], "gut": [323, 325], "wbgene0000001": [323, 324, 325], "wbgene0000002": [323, 324, 325], "wbgene0000003": [323, 324, 325], "wbgene0000004": [323, 324, 325], "wbgene0000005": [323, 324, 325], "houri": 323, "dalzel": 323, "yigit": 323, "2006": 323, "presenc": 323, "inflat": 323, "concern": 323, "18924": 323, "conclud": 323, "encompass": 323, "familiar": 323, "deeper": 323, "dive": 323, "feel": 323, "free": [323, 325], "luck": 323, "endeavor": 323, "primer": 324, "poli": 324, "unwant": 324, "sequencea": 324, "incid": 324, "atggcgttga": 324, "read1_fil": 324, "sample1read1": 324, "sample2read1": 324, "sample3read1": 324, "read2_fil": 324, "sample1read2": 324, "sample2read2": 324, "sample3read2": 324, "adapter1": 324, "atggcgt": 324, "adapter2": 324, "cgttatc": 324, "bulk": 324, "pinpoint": 324, "incredibli": 324, "transcriptome_fast": 324, "paremet": 324, "construct": 324, "ng": 324, "100bp": 324, "avg_frag_len": 324, "stdev_frag_len": 324, "preper": 324, "protocol": 324, "ultrafast": 324, "memori": [324, 325], "effici": 324, "prefix": 324, "paramat": 324, "promot": 324, "bodi": 324, "subread": 324, "furthermor": [324, 325], "paramt": 324, "glimps": [324, 325], "represent": [324, 325], "5954": 324, "17781": 324, "unaffect": 324, "unchang": [324, 325], "becam": 324, "suppos": [324, 325], "kept": [324, 325], "yet": 324, "myfold": 324, "test_deseq_below0": 324, "75basemeangt500": 324, "alternative_filenam": 324, "eahc": 324, "return_format": 324, "18129": [324, 325], "b9": [324, 325], "bioc": [324, 325], "lfcse": [324, 325], "stat": [324, 325], "044": [324, 325], "329404": [324, 325], "158938": [324, 325], "94783": [324, 325], "96e": [324, 325], "80e": [324, 325], "813": [324, 325], "291484": [324, 325], "93189": [324, 325], "74e": [324, 325], "40e": [324, 325], "567": [324, 325], "190439": [324, 325], "51433": [324, 325], "60e": [324, 325], "34e": [324, 325], "9257": [324, 325], "246313": [324, 325], "49419": [324, 325], "23e": [324, 325], "82e": [324, 325], "129606": [324, 325], "11463": [324, 325], "91e": [324, 325], "46e": [324, 325], "649": [324, 325], "03719": [324, 325], "219781": [324, 325], "3691": [324, 325], "32e": [324, 325], "70e": [324, 325], "1429": [324, 325], "347777": [324, 325], "26471": [324, 325], "58e": [324, 325], "12e": [324, 325], "1632": [324, 325], "217802": [324, 325], "96885": [324, 325], "42e": [324, 325], "insignific": [324, 325], "With": [324, 325], "capabl": [324, 325], "readthedoc": [324, 325], "master": [324, 325], "unintend": [324, 325], "nativ": [324, 325], "weren": [324, 325], "376": [324, 325], "177": [324, 325], "__no_featur": [324, 325], "__ambigu": [324, 325], "__too_low_aqu": [324, 325], "__not_align": [324, 325], "121": [324, 325], "__alignment_not_uniqu": [324, 325], "deault": 324, "uq": [324, 325], "normalize_quantil": [324, 325], "normalize_mrn": [324, 325], "sample4": [324, 325], "145": [324, 325], "9468": [324, 325], "11354": [324, 325], "14009": [324, 325], "30287": [324, 325], "557": [324, 325], "893": [324, 325], "109853": [324, 325], "277653": [324, 325], "88653": [324, 325], "96012": [324, 325], "Such": 324, "__alignment_no_uniqu": [324, 325], "varieti": [324, 325], "five_clust": 324, "len": 324, "two_clust": 324, "silhouette_clust": 324, "gap_stat_clust": 324, "evalu": [324, 325], "outcom": [324, 325], "partit": [324, 325], "eucliean": [324, 325], "simplic": [324, 325], "eucliidean": [324, 325], "cityblock": [324, 325], "heyer": [324, 325], "kruglyak": [324, 325], "yooseph": [324, 325], "1999": [324, 325], "hamm": [324, 325], "agglom": [324, 325], "aim": [324, 325], "eventu": [324, 325], "cut": [324, 325], "height": [324, 325], "specifii": [324, 325], "springer": [324, 325], "1007": [324, 325], "978": [324, 325], "642": [324, 325], "37456": [324, 325], "2_14": [324, 325], "interest": [324, 325], "1016": [324, 325], "eswa": [324, 325], "059": [324, 325], "positon": [324, 325], "agreement": [324, 325], "slope": [324, 325], "strong": [324, 325], "numerator_read": 324, "denominator_read": 324, "underli": 324, "lack": 324, "famili": 324, "mean_numerator_read": 324, "mean_denominator_read": 324, "cond3_rep1": 324, "cond3_rep2": 324, "condition1": 324, "condition2": 324, "51828": 324, "36026": 324, "column1": 324, "repr": 324, "output_dict": 324, "biotypes_1": 324, "biotypes_2": 324, "output_dict_inplac": 324, "append": 324, "someon": [324, 325], "els": [324, 325], "hyperosmot": 324, "anslys": 324, "my_filter_obj": 324, "my_python_set": 324, "wbgene0245200": 324, "wbgene00402029": 324, "third": 324, "paresd": 324, "path_to_my_fil": 324, "product": [324, 325], "6239": [324, 325], "mischaracter": [324, 325], "deem": [324, 325], "my_background_set": 324, "feature1": 324, "feature2": 324, "feature3": 324, "success": [324, 325], "oppos": [324, 325], "sucess": [324, 325], "zero": [324, 325], "topic": [324, 325], "21044043": [324, 325], "discret": [324, 325], "locomot": [324, 325], "wnt": [324, 325], "carri": [324, 325], "antioxid": [324, 325], "atp": [324, 325], "chaperon": [324, 325], "granul": [324, 325], "mitochondrion": [324, 325], "silico": [324, 325], "statement": [324, 325], "judgement": [324, 325], "homologi": [324, 325], "definit": [324, 325], "iea": [324, 325], "ikr": [324, 325], "explicit": [324, 325], "complex": [324, 325], "organel": [324, 325], "somewhat": [324, 325], "cyclic": [324, 325], "hexos": [324, 325], "biosynthet": [324, 325], "metabol": [324, 325], "said": [324, 325], "upstream": [324, 325], "rate": [324, 325], "deal": [324, 325], "problem": [324, 325], "compromis": [324, 325], "propagation_method": [324, 325], "barplot": [324, 325], "0001556": [324, 325], "oocyt": [324, 325], "1327": [324, 325], "319": [324, 325], "49722119558": [324, 325], "0000999": [324, 325], "0043186": [324, 325], "244": [324, 325], "46013879322": [324, 325], "cel00010": [324, 325], "glycolysi": [324, 325], "gluconeogenesi": [324, 325], "cel00030": [324, 325], "pentos": [324, 325], "phosphat": [324, 325], "retreiv": [324, 325], "peform": [324, 325], "neuron": [324, 325], "attirubt": [324, 325], "student": [324, 325], "wbgene00003002": 324, "wbgene00004201": 324, "wbgene00300139": 324, "union_result": 324, "inher": 324, "behav": 324, "ploscompbiol": 324, "my_ranked_set": 324, "my_list": 324, "comapr": [324, 325], "ranked_set": 324, "wbgene00000106": 324, "wbgene00000041": 324, "wbgene00000105": 324, "go_en_result": 324, "en_result": 324, "plot_enrichment_result": 324, "emploi": 324, "sets_to_visu": 324, "parser": 324, "insensit": [324, 325], "the_new_attribute_reference_table_path": 324, "the_new_biotype_reference_table_path": 324, "read_attr_ref_table_path": 324, "read_biotype_ref_table_path": 324, "attr_table_path": 324, "the_attribute_reference_table_path_that_was_saved_in_the_settings_fil": 324, "biotype_table_path": 324, "the_biotype_reference_table_path_that_was_saved_in_the_settings_fil": 324, "wbgene00023495": 324, "my_str": 324, "wbgene00000002wbgene00000003": 324, "wbgene00000004g": 324, "wbgene000000002": 324, "freeli": 325, "log2folcchang": 325, "effort": 325, "independ": 325, "fc": 325, "creation": 325, "saw": 325, "sophist": 325, "mention": 325, "essenti": 325, "mine": 325, "notabl": 325, "intermedi": 325, "arrow": 325, "flow": 325, "drag": 325, "wheel": 325, "readjust": 325, "simul": 325, "wil": 325}, "objects": {"rnalysis": [[11, 0, 0, "-", "enrichment"], [78, 0, 0, "-", "fastq"], [102, 0, 0, "-", "filtering"], [312, 0, 0, "-", "general"]], "rnalysis.enrichment": [[12, 1, 1, "", "FeatureSet"], [41, 1, 1, "", "RankedSet"], [73, 3, 1, "", "enrichment_bar_plot"], [74, 3, 1, "", "gene_ontology_graph"], [75, 3, 1, "", "kegg_pathway_graph"], [76, 3, 1, "", "upset_plot"], [77, 3, 1, "", "venn_diagram"]], "rnalysis.enrichment.FeatureSet": [[12, 2, 1, "", "__init__"], [13, 2, 1, "", "add"], [14, 2, 1, "", "biotypes_from_ref_table"], [15, 2, 1, "", "change_set_name"], [16, 2, 1, "", "clear"], [17, 2, 1, "", "copy"], [18, 2, 1, "", "difference"], [19, 2, 1, "", "difference_update"], [20, 2, 1, "", "discard"], [21, 2, 1, "", "filter_by_attribute"], [22, 2, 1, "", "filter_by_go_annotations"], [23, 2, 1, "", "filter_by_kegg_annotations"], [24, 2, 1, "", "go_enrichment"], [25, 2, 1, "", "intersection"], [26, 2, 1, "", "intersection_update"], [27, 2, 1, "", "isdisjoint"], [28, 2, 1, "", "issubset"], [29, 2, 1, "", "issuperset"], [30, 2, 1, "", "kegg_enrichment"], [31, 2, 1, "", "non_categorical_enrichment"], [32, 2, 1, "", "pop"], [33, 2, 1, "", "remove"], [34, 2, 1, "", "save_txt"], [35, 2, 1, "", "symmetric_difference"], [36, 2, 1, "", "symmetric_difference_update"], [37, 2, 1, "", "translate_gene_ids"], [38, 2, 1, "", "union"], [39, 2, 1, "", "update"], [40, 2, 1, "", "user_defined_enrichment"]], "rnalysis.enrichment.RankedSet": [[41, 2, 1, "", "__init__"], [42, 2, 1, "", "add"], [43, 2, 1, "", "biotypes_from_ref_table"], [44, 2, 1, "", "change_set_name"], [45, 2, 1, "", "clear"], [46, 2, 1, "", "copy"], [47, 2, 1, "", "difference"], [48, 2, 1, "", "difference_update"], [49, 2, 1, "", "discard"], [50, 2, 1, "", "filter_by_attribute"], [51, 2, 1, "", "filter_by_go_annotations"], [52, 2, 1, "", "filter_by_kegg_annotations"], [53, 2, 1, "", "go_enrichment"], [54, 2, 1, "", "intersection"], [55, 2, 1, "", "intersection_update"], [56, 2, 1, "", "isdisjoint"], [57, 2, 1, "", "issubset"], [58, 2, 1, "", "issuperset"], [59, 2, 1, "", "kegg_enrichment"], [60, 2, 1, "", "non_categorical_enrichment"], [61, 2, 1, "", "pop"], [62, 2, 1, "", "remove"], [63, 2, 1, "", "save_txt"], [64, 2, 1, "", "single_set_enrichment"], [65, 2, 1, "", "single_set_go_enrichment"], [66, 2, 1, "", "single_set_kegg_enrichment"], [67, 2, 1, "", "symmetric_difference"], [68, 2, 1, "", "symmetric_difference_update"], [69, 2, 1, "", "translate_gene_ids"], [70, 2, 1, "", "union"], [71, 2, 1, "", "update"], [72, 2, 1, "", "user_defined_enrichment"]], "rnalysis.fastq": [[79, 1, 1, "", "PairedEndPipeline"], [85, 1, 1, "", "SingleEndPipeline"], [91, 3, 1, "", "bowtie2_align_paired_end"], [92, 3, 1, "", "bowtie2_align_single_end"], [93, 3, 1, "", "bowtie2_create_index"], [94, 3, 1, "", "featurecounts_paired_end"], [95, 3, 1, "", "featurecounts_single_end"], [96, 3, 1, "", "kallisto_create_index"], [97, 3, 1, "", "kallisto_quantify_paired_end"], [98, 3, 1, "", "kallisto_quantify_single_end"], [99, 3, 1, "", "shortstack_align_smallrna"], [100, 3, 1, "", "trim_adapters_paired_end"], [101, 3, 1, "", "trim_adapters_single_end"]], "rnalysis.fastq.PairedEndPipeline": [[79, 2, 1, "", "__init__"], [80, 2, 1, "", "add_function"], [81, 2, 1, "", "apply_to"], [82, 2, 1, "", "export_pipeline"], [83, 2, 1, "", "import_pipeline"], [84, 2, 1, "", "remove_last_function"]], "rnalysis.fastq.SingleEndPipeline": [[85, 2, 1, "", "__init__"], [86, 2, 1, "", "add_function"], [87, 2, 1, "", "apply_to"], [88, 2, 1, "", "export_pipeline"], [89, 2, 1, "", "import_pipeline"], [90, 2, 1, "", "remove_last_function"]], "rnalysis.filtering": [[103, 1, 1, "", "CountFilter"], [177, 1, 1, "", "DESeqFilter"], [222, 1, 1, "", "Filter"], [262, 1, 1, "", "FoldChangeFilter"], [306, 1, 1, "", "Pipeline"]], "rnalysis.filtering.CountFilter": [[103, 2, 1, "", "__init__"], [104, 2, 1, "", "average_replicate_samples"], [105, 2, 1, "", "biotypes_from_gtf"], [106, 2, 1, "", "biotypes_from_ref_table"], [107, 2, 1, "", "box_plot"], [108, 2, 1, "", "clustergram"], [109, 2, 1, "", "describe"], [110, 2, 1, "", "difference"], [111, 2, 1, "", "differential_expression_deseq2"], [112, 2, 1, "", "differential_expression_limma_voom"], [113, 2, 1, "", "drop_columns"], [114, 2, 1, "", "enhanced_box_plot"], [115, 2, 1, "", "filter_biotype_from_gtf"], [116, 2, 1, "", "filter_biotype_from_ref_table"], [117, 2, 1, "", "filter_by_attribute"], [118, 2, 1, "", "filter_by_go_annotations"], [119, 2, 1, "", "filter_by_kegg_annotations"], [120, 2, 1, "", "filter_by_row_name"], [121, 2, 1, "", "filter_by_row_sum"], [122, 2, 1, "", "filter_duplicate_ids"], [123, 2, 1, "", "filter_low_reads"], [124, 2, 1, "", "filter_missing_values"], [125, 2, 1, "", "filter_percentile"], [126, 2, 1, "", "filter_top_n"], [127, 2, 1, "", "find_paralogs_ensembl"], [128, 2, 1, "", "find_paralogs_panther"], [129, 2, 1, "", "fold_change"], [130, 2, 1, "", "from_dataframe"], [131, 2, 1, "", "from_folder"], [132, 2, 1, "", "from_folder_htseqcount"], [133, 2, 1, "", "head"], [134, 2, 1, "", "intersection"], [135, 2, 1, "", "ma_plot"], [136, 2, 1, "", "majority_vote_intersection"], [137, 2, 1, "", "map_orthologs_ensembl"], [138, 2, 1, "", "map_orthologs_orthoinspector"], [139, 2, 1, "", "map_orthologs_panther"], [140, 2, 1, "", "map_orthologs_phylomedb"], [141, 2, 1, "", "normalize_median_of_ratios"], [142, 2, 1, "", "normalize_rle"], [143, 2, 1, "", "normalize_tmm"], [144, 2, 1, "", "normalize_to_quantile"], [145, 2, 1, "", "normalize_to_rpkm"], [146, 2, 1, "", "normalize_to_rpm"], [147, 2, 1, "", "normalize_to_rpm_htseqcount"], [148, 2, 1, "", "normalize_to_tpm"], [149, 2, 1, "", "normalize_with_scaling_factors"], [150, 2, 1, "", "number_filters"], [151, 2, 1, "", "pairplot"], [152, 2, 1, "", "pca"], [153, 2, 1, "", "plot_expression"], [154, 2, 1, "", "print_features"], [155, 2, 1, "", "save_csv"], [156, 2, 1, "", "save_parquet"], [157, 2, 1, "", "save_table"], [158, 2, 1, "", "scatter_sample_vs_sample"], [159, 2, 1, "", "sort"], [160, 2, 1, "", "sort_by_principal_component"], [161, 2, 1, "", "split_by_attribute"], [162, 2, 1, "", "split_by_percentile"], [163, 2, 1, "", "split_by_principal_components"], [164, 2, 1, "", "split_by_reads"], [165, 2, 1, "", "split_clicom"], [166, 2, 1, "", "split_hdbscan"], [167, 2, 1, "", "split_hierarchical"], [168, 2, 1, "", "split_kmeans"], [169, 2, 1, "", "split_kmedoids"], [170, 2, 1, "", "symmetric_difference"], [171, 2, 1, "", "tail"], [172, 2, 1, "", "text_filters"], [173, 2, 1, "", "transform"], [174, 2, 1, "", "translate_gene_ids"], [175, 2, 1, "", "union"], [176, 2, 1, "", "violin_plot"]], "rnalysis.filtering.DESeqFilter": [[177, 2, 1, "", "__init__"], [178, 2, 1, "", "biotypes_from_gtf"], [179, 2, 1, "", "biotypes_from_ref_table"], [180, 2, 1, "", "describe"], [181, 2, 1, "", "difference"], [182, 2, 1, "", "drop_columns"], [183, 2, 1, "", "filter_abs_log2_fold_change"], [184, 2, 1, "", "filter_biotype_from_gtf"], [185, 2, 1, "", "filter_biotype_from_ref_table"], [186, 2, 1, "", "filter_by_attribute"], [187, 2, 1, "", "filter_by_go_annotations"], [188, 2, 1, "", "filter_by_kegg_annotations"], [189, 2, 1, "", "filter_by_row_name"], [190, 2, 1, "", "filter_duplicate_ids"], [191, 2, 1, "", "filter_fold_change_direction"], [192, 2, 1, "", "filter_missing_values"], [193, 2, 1, "", "filter_percentile"], [194, 2, 1, "", "filter_significant"], [195, 2, 1, "", "filter_top_n"], [196, 2, 1, "", "find_paralogs_ensembl"], [197, 2, 1, "", "find_paralogs_panther"], [198, 2, 1, "", "from_dataframe"], [199, 2, 1, "", "head"], [200, 2, 1, "", "intersection"], [201, 2, 1, "", "majority_vote_intersection"], [202, 2, 1, "", "map_orthologs_ensembl"], [203, 2, 1, "", "map_orthologs_orthoinspector"], [204, 2, 1, "", "map_orthologs_panther"], [205, 2, 1, "", "map_orthologs_phylomedb"], [206, 2, 1, "", "number_filters"], [207, 2, 1, "", "print_features"], [208, 2, 1, "", "save_csv"], [209, 2, 1, "", "save_parquet"], [210, 2, 1, "", "save_table"], [211, 2, 1, "", "sort"], [212, 2, 1, "", "split_by_attribute"], [213, 2, 1, "", "split_by_percentile"], [214, 2, 1, "", "split_fold_change_direction"], [215, 2, 1, "", "symmetric_difference"], [216, 2, 1, "", "tail"], [217, 2, 1, "", "text_filters"], [218, 2, 1, "", "transform"], [219, 2, 1, "", "translate_gene_ids"], [220, 2, 1, "", "union"], [221, 2, 1, "", "volcano_plot"]], "rnalysis.filtering.Filter": [[222, 2, 1, "", "__init__"], [223, 2, 1, "", "biotypes_from_gtf"], [224, 2, 1, "", "biotypes_from_ref_table"], [225, 2, 1, "", "describe"], [226, 2, 1, "", "difference"], [227, 2, 1, "", "drop_columns"], [228, 2, 1, "", "filter_biotype_from_gtf"], [229, 2, 1, "", "filter_biotype_from_ref_table"], [230, 2, 1, "", "filter_by_attribute"], [231, 2, 1, "", "filter_by_go_annotations"], [232, 2, 1, "", "filter_by_kegg_annotations"], [233, 2, 1, "", "filter_by_row_name"], [234, 2, 1, "", "filter_duplicate_ids"], [235, 2, 1, "", "filter_missing_values"], [236, 2, 1, "", "filter_percentile"], [237, 2, 1, "", "filter_top_n"], [238, 2, 1, "", "find_paralogs_ensembl"], [239, 2, 1, "", "find_paralogs_panther"], [240, 2, 1, "", "from_dataframe"], [241, 2, 1, "", "head"], [242, 2, 1, "", "intersection"], [243, 2, 1, "", "majority_vote_intersection"], [244, 2, 1, "", "map_orthologs_ensembl"], [245, 2, 1, "", "map_orthologs_orthoinspector"], [246, 2, 1, "", "map_orthologs_panther"], [247, 2, 1, "", "map_orthologs_phylomedb"], [248, 2, 1, "", "number_filters"], [249, 2, 1, "", "print_features"], [250, 2, 1, "", "save_csv"], [251, 2, 1, "", "save_parquet"], [252, 2, 1, "", "save_table"], [253, 2, 1, "", "sort"], [254, 2, 1, "", "split_by_attribute"], [255, 2, 1, "", "split_by_percentile"], [256, 2, 1, "", "symmetric_difference"], [257, 2, 1, "", "tail"], [258, 2, 1, "", "text_filters"], [259, 2, 1, "", "transform"], [260, 2, 1, "", "translate_gene_ids"], [261, 2, 1, "", "union"]], "rnalysis.filtering.FoldChangeFilter": [[262, 2, 1, "", "__init__"], [263, 2, 1, "", "biotypes_from_gtf"], [264, 2, 1, "", "biotypes_from_ref_table"], [265, 2, 1, "", "describe"], [266, 2, 1, "", "difference"], [267, 2, 1, "", "drop_columns"], [268, 2, 1, "", "filter_abs_log2_fold_change"], [269, 2, 1, "", "filter_biotype_from_gtf"], [270, 2, 1, "", "filter_biotype_from_ref_table"], [271, 2, 1, "", "filter_by_attribute"], [272, 2, 1, "", "filter_by_go_annotations"], [273, 2, 1, "", "filter_by_kegg_annotations"], [274, 2, 1, "", "filter_by_row_name"], [275, 2, 1, "", "filter_duplicate_ids"], [276, 2, 1, "", "filter_fold_change_direction"], [277, 2, 1, "", "filter_missing_values"], [278, 2, 1, "", "filter_percentile"], [279, 2, 1, "", "filter_top_n"], [280, 2, 1, "", "find_paralogs_ensembl"], [281, 2, 1, "", "find_paralogs_panther"], [282, 2, 1, "", "from_dataframe"], [283, 2, 1, "", "head"], [284, 2, 1, "", "intersection"], [285, 2, 1, "", "majority_vote_intersection"], [286, 2, 1, "", "map_orthologs_ensembl"], [287, 2, 1, "", "map_orthologs_orthoinspector"], [288, 2, 1, "", "map_orthologs_panther"], [289, 2, 1, "", "map_orthologs_phylomedb"], [290, 2, 1, "", "number_filters"], [291, 2, 1, "", "print_features"], [292, 2, 1, "", "randomization_test"], [293, 2, 1, "", "save_csv"], [294, 2, 1, "", "save_parquet"], [295, 2, 1, "", "save_table"], [296, 2, 1, "", "sort"], [297, 2, 1, "", "split_by_attribute"], [298, 2, 1, "", "split_by_percentile"], [299, 2, 1, "", "split_fold_change_direction"], [300, 2, 1, "", "symmetric_difference"], [301, 2, 1, "", "tail"], [302, 2, 1, "", "text_filters"], [303, 2, 1, "", "transform"], [304, 2, 1, "", "translate_gene_ids"], [305, 2, 1, "", "union"]], "rnalysis.filtering.Pipeline": [[306, 2, 1, "", "__init__"], [307, 2, 1, "", "add_function"], [308, 2, 1, "", "apply_to"], [309, 2, 1, "", "export_pipeline"], [310, 2, 1, "", "import_pipeline"], [311, 2, 1, "", "remove_last_function"]], "rnalysis.general": [[313, 3, 1, "", "clear_all_cache"], [314, 3, 1, "", "clear_gui_cache"], [315, 3, 1, "", "parse_gene_name_string"], [316, 3, 1, "", "parse_sequence_name_string"], [317, 3, 1, "", "parse_wbgene_string"], [318, 3, 1, "", "print_settings_file"], [319, 3, 1, "", "reset_settings_file"], [320, 3, 1, "", "save_to_csv"], [321, 3, 1, "", "set_attr_ref_table_path"], [322, 3, 1, "", "set_biotype_ref_table_path"]]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:function"}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "function", "Python function"]}, "titleterms": {"api": 0, "refer": [0, 324, 325], "rnalysi": [0, 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325], "fastq": [0, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 323, 324], "modul": [0, 6, 10, 324, 325], "filter": [0, 8, 10, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 323, 324, 325], "enrich": [0, 2, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 323, 324, 325], "gener": [0, 2, 10, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 324, 325], "util": 0, "how": [1, 2, 7, 9], "can": [1, 2, 9], "i": [1, 2, 9, 324, 325], "contribut": 1, "type": [1, 2, 8, 324, 325], "report": [1, 2, 8, 323, 325], "bug": 1, "fix": [1, 5], "write": 1, "document": [1, 6], "submit": 1, "feedback": 1, "implement": 1, "featur": [1, 2, 324], "idea": 1, "To": 1, "do": [1, 2, 9], "design": 1, "philosophi": 1, "get": [1, 2], "start": [1, 2, 6, 8, 323], "pull": 1, "request": 1, "guidelin": 1, "tip": 1, "deploi": 1, "frequent": 2, "ask": 2, "question": 2, "instal": [2, 7, 9], "an": [2, 8, 324, 325], "error": 2, "messag": 2, "when": 2, "try": 2, "what": [2, 9, 324, 325], "hdbscan": [2, 323, 324, 325], "random": [2, 324], "am": 2, "open": [2, 8, 325], "first": 2, "time": [2, 8, 323], "take": 2, "long": 2, "load": [2, 8, 324, 325], "doesn": 2, "t": 2, "all": 2, "should": 2, "previou": 2, "version": 2, "usag": 2, "view": [2, 324, 325], "quick": [2, 8], "guid": [2, 8, 324, 325], "see": 2, "onli": 2, "blank": 2, "page": 2, "appli": [2, 8, 323, 324, 325], "function": [2, 325], "my": 2, "data": [2, 8, 323, 324, 325], "tabl": [2, 6, 8, 324, 325], "know": 2, "differ": [2, 8, 18, 47, 110, 181, 226, 266], "parmet": 2, "want": 2, "us": [2, 9, 324, 325], "particular": 2, "statist": [2, 324, 325], "method": [2, 324, 325], "algorithm": 2, "avail": 2, "exactli": 2, "doe": 2, "work": [2, 8, 324, 325], "file": [2, 323, 324, 325], "format": [2, 325], "ar": [2, 323], "support": 2, "analyz": [2, 8, 325], "run": [2, 7, 323], "cluster": [2, 323, 324, 325], "other": [2, 8], "progress": 2, "bar": 2, "appear": 2, "noth": 2, "happen": 2, "ran": 2, "problem": 2, "specifi": 2, "here": 2, "automat": 2, "analysi": [2, 8, 323, 324, 325], "share": [2, 8, 325], "access": [2, 325], "figur": 2, "need": 2, "manual": 2, "edit": 2, "crash": 2, "dure": 2, "restor": [2, 8], "creat": [2, 8, 323, 324, 325], "through": [2, 325], "programmat": [2, 4, 324], "interfac": [2, 4, 8, 324, 325], "index": [3, 324], "glossari": 4, "histori": [5, 6], "3": [5, 6], "10": [5, 6], "1": [5, 6, 323], "2023": 5, "11": 5, "22": 5, "ad": 5, "0": 5, "31": 5, "chang": [5, 6, 8, 324], "9": 5, "2": [5, 323], "06": 5, "23": 5, "19": 5, "09": 5, "new": [5, 8, 324, 325], "contributor": [5, 9], "8": 5, "05": 5, "07": 5, "7": 5, "04": 5, "6": 5, "03": 5, "25": 5, "5": 5, "02": 5, "08": 5, "4": 5, "01": 5, "remov": [5, 33, 62, 323], "2022": 5, "12": 5, "16": 5, "2021": 5, "2020": 5, "27": 5, "28": 5, "2019": 5, "about": 6, "indic": [6, 324], "stand": 7, "alon": 7, "app": 7, "most": 7, "beginn": 7, "friendli": 7, "further": 7, "guidanc": 7, "python": 7, "packag": [7, 10], "pip": 7, "best": 7, "perform": [7, 8, 324, 325], "from": [7, 324, 325], "sourc": 7, "video": 8, "program": 8, "examin": [8, 323, 325], "your": [8, 324, 325], "undo": 8, "oper": [8, 324, 325], "you": 8, "place": 8, "save": [8, 324], "made": [8, 324, 325], "multipl": [8, 324, 325], "same": 8, "offer": 8, "wai": 8, "graph": 8, "quickli": 8, "look": 8, "up": 8, "gene": [8, 323, 324, 325], "databas": [8, 324, 325], "choic": 8, "sort": [8, 159, 211, 253, 296], "tab": 8, "icon": 8, "close": 8, "import": [8, 324, 325], "list": 8, "set": [8, 323, 324, 325], "visual": [8, 323, 324, 325], "intersect": [8, 25, 54, 134, 200, 242, 284, 324, 325], "between": [8, 323], "pipelin": [8, 306, 307, 308, 309, 310, 311, 323, 324, 325], "streamlin": 8, "one": 8, "more": 8, "export": [8, 325], "make": 8, "reproduc": 8, "bioinformat": 8, "tool": 8, "interact": [8, 325], "depend": 9, "credit": 9, "cite": 9, "develop": 9, "lead": 9, "featureset": [12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 324], "add": [13, 42], "biotypes_from_ref_t": [14, 43, 106, 179, 224, 264], "change_set_nam": [15, 44], "clear": [16, 45], "copi": [17, 46, 325], "difference_upd": [19, 48], "discard": [20, 49], "filter_by_attribut": [21, 50, 117, 186, 230, 271], "filter_by_go_annot": [22, 51, 118, 187, 231, 272], "filter_by_kegg_annot": [23, 52, 119, 188, 232, 273], "go_enrich": [24, 53], "intersection_upd": [26, 55], "isdisjoint": [27, 56], "issubset": [28, 57], "issuperset": [29, 58], "kegg_enrich": [30, 59], "non_categorical_enrich": [31, 60], "pop": [32, 61], "save_txt": [34, 63], "symmetric_differ": [35, 67, 170, 215, 256, 300], "symmetric_difference_upd": [36, 68], "translate_gene_id": [37, 69, 174, 219, 260, 304], "union": [38, 70, 175, 220, 261, 305], "updat": [39, 71], "user_defined_enrich": [40, 72], "rankedset": [41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 324], "single_set_enrich": 64, "single_set_go_enrich": 65, "single_set_kegg_enrich": 66, "enrichment_bar_plot": 73, "gene_ontology_graph": 74, "kegg_pathway_graph": 75, "upset_plot": 76, "venn_diagram": 77, "pairedendpipelin": [79, 80, 81, 82, 83, 84], "add_funct": [80, 86, 307], "apply_to": [81, 87, 308], "export_pipelin": [82, 88, 309], "import_pipelin": [83, 89, 310], "remove_last_funct": [84, 90, 311], "singleendpipelin": [85, 86, 87, 88, 89, 90], "bowtie2_align_paired_end": 91, "bowtie2_align_single_end": 92, "bowtie2_create_index": 93, "featurecounts_paired_end": 94, "featurecounts_single_end": 95, "kallisto_create_index": 96, "kallisto_quantify_paired_end": 97, "kallisto_quantify_single_end": 98, "shortstack_align_smallrna": 99, "trim_adapters_paired_end": 100, "trim_adapters_single_end": 101, "countfilt": [103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 324], "average_replicate_sampl": 104, "biotypes_from_gtf": [105, 178, 223, 263], "box_plot": 107, "clustergram": 108, "describ": [109, 180, 225, 265], "differential_expression_deseq2": 111, "differential_expression_limma_voom": 112, "drop_column": [113, 182, 227, 267], "enhanced_box_plot": 114, "filter_biotype_from_gtf": [115, 184, 228, 269], "filter_biotype_from_ref_t": [116, 185, 229, 270], "filter_by_row_nam": [120, 189, 233, 274], "filter_by_row_sum": 121, "filter_duplicate_id": [122, 190, 234, 275], "filter_low_read": 123, "filter_missing_valu": [124, 192, 235, 277], "filter_percentil": [125, 193, 236, 278], "filter_top_n": [126, 195, 237, 279], "find_paralogs_ensembl": [127, 196, 238, 280], "find_paralogs_panth": [128, 197, 239, 281], "fold_chang": 129, "from_datafram": [130, 198, 240, 282], "from_fold": 131, "from_folder_htseqcount": 132, "head": [133, 199, 241, 283], "ma_plot": 135, "majority_vote_intersect": [136, 201, 243, 285], "map_orthologs_ensembl": [137, 202, 244, 286], "map_orthologs_orthoinspector": [138, 203, 245, 287], "map_orthologs_panth": [139, 204, 246, 288], "map_orthologs_phylomedb": [140, 205, 247, 289], "normalize_median_of_ratio": 141, "normalize_rl": 142, "normalize_tmm": 143, "normalize_to_quantil": 144, "normalize_to_rpkm": 145, "normalize_to_rpm": 146, "normalize_to_rpm_htseqcount": 147, "normalize_to_tpm": 148, "normalize_with_scaling_factor": 149, "number_filt": [150, 206, 248, 290], "pairplot": 151, "pca": 152, "plot_express": 153, "print_featur": [154, 207, 249, 291], "save_csv": [155, 208, 250, 293], "save_parquet": [156, 209, 251, 294], "save_t": [157, 210, 252, 295], "scatter_sample_vs_sampl": 158, "sort_by_principal_compon": 160, "split_by_attribut": [161, 212, 254, 297], "split_by_percentil": [162, 213, 255, 298], "split_by_principal_compon": 163, "split_by_read": 164, "split_clicom": 165, "split_hdbscan": 166, "split_hierarch": 167, "split_kmean": 168, "split_kmedoid": 169, "tail": [171, 216, 257, 301], "text_filt": [172, 217, 258, 302], "transform": [173, 218, 259, 303], "violin_plot": 176, "deseqfilt": [177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 324], "filter_abs_log2_fold_chang": [183, 268], "filter_fold_change_direct": [191, 276], "filter_signific": 194, "split_fold_change_direct": [214, 299], "volcano_plot": 221, "foldchangefilt": [262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 324], "randomization_test": 292, "clear_all_cach": 313, "clear_gui_cach": 314, "parse_gene_name_str": 315, "parse_sequence_name_str": 316, "parse_wbgene_str": 317, "print_settings_fil": 318, "reset_settings_fil": 319, "save_to_csv": 320, "set_attr_ref_table_path": 321, "set_biotype_ref_table_path": 322, "A": 323, "z": 323, "tutori": 323, "exampl": 323, "intro": 323, "recommend": 323, "seri": 323, "rna": [323, 324], "sequenc": [323, 324], "The": 323, "dataset": [323, 324, 325], "preprocess": 323, "exploratori": [323, 324, 325], "out": 323, "lowli": 323, "express": [323, 324, 325], "varianc": 323, "our": 323, "princip": 323, "compon": 323, "similar": 323, "development": 323, "stage": 323, "compar": 323, "specif": 323, "over": 323, "simpl": 323, "approach": 323, "distanc": [323, 324, 325], "base": 323, "k": [323, 324, 325], "medoid": [323, 324, 325], "fine": 323, "tune": 323, "densiti": 323, "complex": 323, "ensembl": 323, "clicom": [323, 324, 325], "differenti": [323, 325], "quantifi": 323, "qualiti": 323, "control": 323, "fastqc": 323, "trim": [323, 324], "adapt": [323, 324], "low": 323, "read": [323, 324], "cutadapt": [323, 324], "kallisto": [323, 324], "deseq2": [323, 324, 325], "custom": 323, "extract": 323, "interesct": 323, "venn": [323, 324], "diagram": [323, 324], "subset": 323, "we": 323, "interest": 323, "defin": [323, 324, 325], "background": [323, 324, 325], "attribut": [323, 324, 325], "final": 323, "word": 323, "user": [324, 325], "singl": [324, 325], "end": 324, "pair": 324, "quantif": 324, "build": 324, "acquir": 324, "align": 324, "bowtie2": 324, "count": [324, 325], "featurecount": 324, "object": 324, "initi": 324, "result": 324, "biotyp": [324, 325], "output": [324, 325], "csv": [324, 325], "uniqu": [324, 325], "matric": [324, 325], "folder": [324, 325], "htseq": [324, 325], "txt": [324, 325], "pre": [324, 325], "normal": [324, 325], "mean": [324, 325], "hierarch": [324, 325], "special": [324, 325], "metric": [324, 325], "fold": 324, "exist": 324, "test": [324, 325], "sequenti": [324, 325], "go": [324, 325], "correct": [324, 325], "organ": [324, 325], "id": [324, 325], "choos": [324, 325], "option": [324, 325], "term": [324, 325], "aspect": [324, 325], "annot": [324, 325], "evid": [324, 325], "code": [324, 325], "qualifi": [324, 325], "propag": [324, 325], "plot": [324, 325], "paramet": [324, 325], "kegg": [324, 325], "pathwai": [324, 325], "which": [324, 325], "calcul": [324, 325], "non": [324, 325], "categor": [324, 325], "visualis": 324, "without": [324, 325], "upset": 324, "default": [324, 325], "path": 324, "pars": 324, "c": 324, "elegan": 324, "name": 324, "wbgene": 324, "regular": 324, "graphic": 325, "workspac": 325, "gtf": 325, "summar": 325, "matrix": 325, "enabl": 325, "session": 325}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx": 57}, "alltitles": {"API Reference": [[0, "api-reference"]], "rnalysis.fastq module": [[0, "rnalysis-fastq-module"]], "rnalysis.filtering module": [[0, "rnalysis-filtering-module"], [10, "rnalysis-filtering-module"]], "rnalysis.enrichment module": [[0, "rnalysis-enrichment-module"], [10, "rnalysis-enrichment-module"]], "rnalysis.general module": [[0, "rnalysis-general-module"], [10, "rnalysis-general-module"]], "rnalysis.utils module": [[0, "rnalysis-utils-module"]], "How can I contribute to RNAlysis?": [[1, "how-can-i-contribute-to-rnalysis"]], "Types of Contributions": [[1, "types-of-contributions"]], "Report Bugs": [[1, "report-bugs"]], "Fix Bugs": [[1, "fix-bugs"]], "Write Documentation": [[1, "write-documentation"]], "Submit Feedback": [[1, "submit-feedback"]], "Implement Features": [[1, "implement-features"]], "Ideas/To-Do": [[1, "ideas-to-do"]], "RNAlysis Design Philosophy": [[1, "rnalysis-design-philosophy"]], "Get Started!": [[1, "get-started"]], "Pull Request Guidelines": [[1, "pull-request-guidelines"]], "Tips": [[1, "tips"]], "Deploying": [[1, "deploying"]], "Frequently asked questions": [[2, "frequently-asked-questions"]], "Installation": [[2, "installation"], [7, "installation"]], "I get an error message when I try to install RNAlysis. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-rnalysis-what-can-i-do"]], "I get an error message when I try to install the RNAlysis hdbscan feature. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-the-rnalysis-hdbscan-feature-what-can-i-do"]], "I get an error message when I try to install the RNAlysis randomization feature. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-the-rnalysis-randomization-feature-what-can-i-do"]], "I am trying to open RNAlysis for the first time and it takes a long time to load/doesn\u2019t load at all. What should I do?": [[2, "i-am-trying-to-open-rnalysis-for-the-first-time-and-it-takes-a-long-time-to-load-doesn-t-load-at-all-what-should-i-do"]], "Can I install a previous version of RNAlysis?": [[2, "can-i-install-a-previous-version-of-rnalysis"]], "Usage": [[2, "usage"]], "I am trying to view the RNAlysis quick-start guide, but see only blank pages. What should I do?": [[2, "i-am-trying-to-view-the-rnalysis-quick-start-guide-but-see-only-blank-pages-what-should-i-do"]], "I am trying to apply a function to my data table. How do I know what all the different functions and parmeters do?": [[2, "i-am-trying-to-apply-a-function-to-my-data-table-how-do-i-know-what-all-the-different-functions-and-parmeters-do"]], "I want to use a particular statistical method or algorithm available in RNAlysis. How do I know exactly what it does and how it works?": [[2, "i-want-to-use-a-particular-statistical-method-or-algorithm-available-in-rnalysis-how-do-i-know-exactly-what-it-does-and-how-it-works"]], "What file formats are supported by RNAlysis?": [[2, "what-file-formats-are-supported-by-rnalysis"]], "What types of tables can I analyze with RNAlysis?": [[2, "what-types-of-tables-can-i-analyze-with-rnalysis"]], "When trying to run clustering/enrichment/other functions in RNAlysis, a progress bar appears but nothing happens. What can I do?": [[2, "when-trying-to-run-clustering-enrichment-other-functions-in-rnalysis-a-progress-bar-appears-but-nothing-happens-what-can-i-do"]], "I ran into a problem that is not specified here. What can I do?": [[2, "i-ran-into-a-problem-that-is-not-specified-here-what-can-i-do"]], "Automatic analysis reports": [[2, "automatic-analysis-reports"]], "How can I generate an analysis report?": [[2, "how-can-i-generate-an-analysis-report"]], "How can I view an analysis report?": [[2, "how-can-i-view-an-analysis-report"]], "How can I share an analysis report?": [[2, "how-can-i-share-an-analysis-report"]], "How can I access the data and figures that appear in an analysis report?": [[2, "how-can-i-access-the-data-and-figures-that-appear-in-an-analysis-report"]], "Do I need to generate analysis reports manually?": [[2, "do-i-need-to-generate-analysis-reports-manually"]], "Can I edit my analysis report?": [[2, "can-i-edit-my-analysis-report"]], "RNAlysis crashed during an analysis! Can I restore my automatic analysis report?": [[2, "rnalysis-crashed-during-an-analysis-can-i-restore-my-automatic-analysis-report"]], "Can I create an analysis report through the programmatic interface?": [[2, "can-i-create-an-analysis-report-through-the-programmatic-interface"]], "Index": [[3, "index"]], "Glossary - programmatic interface": [[4, "glossary-programmatic-interface"]], "History": [[5, "history"]], "3.10.1 (2023-11-22)": [[5, "id1"]], "Added": [[5, "added"], [5, "id3"], [5, "id9"], [5, "id13"], [5, "id18"], [5, "id24"], [5, "id28"], [5, "id34"], [5, "id45"], [5, "id51"], [5, "id58"], [5, "id67"], [5, "id71"], [5, "id76"], [5, "id82"], [5, "id86"], [5, "id90"], [5, "id94"], [5, "id101"]], "Fixed": [[5, "fixed"], [5, "id4"], [5, "id7"], [5, "id11"], [5, "id15"], [5, "id20"], [5, "id26"], [5, "id29"], [5, "id32"], [5, "id36"], [5, "id41"], [5, "id43"], [5, "id47"], [5, "id49"], [5, "id53"], [5, "id60"], [5, "id62"], [5, "id65"], [5, "id69"], [5, "id73"], [5, "id78"], [5, "id84"], [5, "id88"], [5, "id92"], [5, "id96"], [5, "id99"], [5, "id103"]], "3.10.0 (2023-10-31)": [[5, "id2"]], "Changed": [[5, "changed"], [5, "id6"], [5, "id10"], [5, "id14"], [5, "id19"], [5, "id25"], [5, "id31"], [5, "id35"], [5, "id40"], [5, "id46"], [5, "id52"], [5, "id59"], [5, "id64"], [5, "id68"], [5, "id72"], [5, "id77"], [5, "id80"], [5, "id83"], [5, "id87"], [5, "id91"], [5, "id95"], [5, "id98"], [5, "id102"]], "3.9.2 (2023-06-23)": [[5, "id5"]], "3.9.1 (2023-06-19)": [[5, "id8"]], "3.9.0 (2023-06-09)": [[5, "id12"]], "New Contributors": [[5, "new-contributors"], [5, "id22"], [5, "id38"], [5, "id56"]], "3.8.0 (2023-05-07)": [[5, "id17"]], "3.7.0 (2023-04-07)": [[5, "id23"]], "3.6.2 (2023-03-25)": [[5, "id27"]], "3.6.1 (2023-03-22)": [[5, "id30"]], "3.6.0 (2023-03-07)": [[5, "id33"]], "3.5.2 (2023-02-23)": [[5, "id39"]], "3.5.1 (2023-02-22)": [[5, "id42"]], "3.5.0 (2023-02-08)": [[5, "id44"]], "3.4.2 (2023-02-01)": [[5, "id48"]], "3.4.0 (2023-02-01)": [[5, "id50"]], "Removed": [[5, "removed"], [5, "id104"]], "3.3.0 (2022-12-02)": [[5, "id57"]], "3.2.2 (2022-11-25)": [[5, "id61"]], "3.2.1 (2022-11-25)": [[5, "id63"]], "3.2.0 (2022-11-23)": [[5, "id66"]], "3.1.0 (2022-10-16)": [[5, "id70"]], "3.0.1 (2022-10-12)": [[5, "id74"]], "3.0.0 (2022-10-10)": [[5, "id75"]], "2.1.1 (2022-07-05)": [[5, "id79"]], "2.1.0 (2022-04-16)": [[5, "id81"]], "2.0.1 (2022-04-02)": [[5, "id85"]], "2.0.0 (2021-12-05)": [[5, "id89"]], "1.3.5 (2020-05-27)": [[5, "id93"]], "1.3.4 (2020-04-07)": [[5, "id97"]], "1.3.3 (2020-03-28)": [[5, "id100"]], "1.3.2 (2019-12-11)": [[5, "id105"]], "RNAlysis 3.10.1 documentation": [[6, "rnalysis-release-documentation"]], "About RNAlysis:": [[6, null]], "Starting with RNAlysis:": [[6, null]], "Change history:": [[6, null]], "Modules:": [[6, "modules"]], "Indices and tables:": [[6, null]], "RNAlysis stand-alone app (most beginner-friendly)": [[7, "rnalysis-stand-alone-app-most-beginner-friendly"]], "How to install it": [[7, "how-to-install-it"], [7, "id1"], [7, "id3"]], "How to run it": [[7, "how-to-run-it"], [7, "id2"], [7, "id4"]], "Further guidance": [[7, "further-guidance"]], "Install as a Python package with pip (best performance)": [[7, "install-as-a-python-package-with-pip-best-performance"]], "From sources": [[7, "from-sources"]], "RNAlysis quick-start video guide": [[8, "rnalysis-quick-start-video-guide"]], "Open the program": [[8, "open-the-program"]], "Load a table": [[8, "load-a-table"]], "Examine your table": [[8, "examine-your-table"]], "Filter your table": [[8, "filter-your-table"]], "Undo the operations you applied to your table": [[8, "undo-the-operations-you-applied-to-your-table"]], "Apply your operations \u2018in-place\u2019 or apply on a new table": [[8, "apply-your-operations-in-place-or-apply-on-a-new-table"]], "Save the changes you made to your table": [[8, "save-the-changes-you-made-to-your-table"]], "Work on multiple tables at the same time": [[8, "work-on-multiple-tables-at-the-same-time"]], "Different types of tables offer different ways to filter and analyze your data": [[8, "different-types-of-tables-offer-different-ways-to-filter-and-analyze-your-data"]], "Create and save graphs": [[8, "create-and-save-graphs"]], "Quickly look-up genes in your database of choice": [[8, "quickly-look-up-genes-in-your-database-of-choice"]], "Sort your tabs and change their icons": [[8, "sort-your-tabs-and-change-their-icons"]], "Restore tabs you closed": [[8, "restore-tabs-you-closed"]], "Import lists of genes as Gene Sets": [[8, "import-lists-of-genes-as-gene-sets"]], "Visualize the intersections between your tables and gene sets": [[8, "visualize-the-intersections-between-your-tables-and-gene-sets"]], "Apply set operations to your tables and gene sets": [[8, "apply-set-operations-to-your-tables-and-gene-sets"]], "Perform enrichment analysis on your tables and gene sets": [[8, "perform-enrichment-analysis-on-your-tables-and-gene-sets"]], "Create Pipelines to streamline your data analysis": [[8, "create-pipelines-to-streamline-your-data-analysis"]], "Apply Pipelines to one or more of your tables": [[8, "apply-pipelines-to-one-or-more-of-your-tables"]], "Export and share Pipelines to make your analysis more reproducible": [[8, "export-and-share-pipelines-to-make-your-analysis-more-reproducible"]], "Interface with other bioinformatic tools": [[8, "interface-with-other-bioinformatic-tools"]], "Create an interactive analysis report": [[8, "create-an-interactive-analysis-report"]], "What is RNAlysis?": [[9, "what-is-rnalysis"]], "What can I do with RNAlysis?": [[9, "what-can-i-do-with-rnalysis"]], "How do I install it?": [[9, "how-do-i-install-it"]], "How do I use it?": [[9, "how-do-i-use-it"]], "Dependencies": [[9, "dependencies"]], "Credits": [[9, "credits"]], "How do I cite RNAlysis?": [[9, "how-do-i-cite-rnalysis"]], "Development Lead": [[9, "development-lead"]], "Contributors": [[9, "contributors"]], "rnalysis package": [[10, "rnalysis-package"]], "rnalysis.enrichment": [[11, "rnalysis-enrichment"]], "rnalysis.enrichment.FeatureSet": [[12, "rnalysis-enrichment-featureset"]], "rnalysis.enrichment.FeatureSet.add": [[13, "rnalysis-enrichment-featureset-add"]], "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table": [[14, "rnalysis-enrichment-featureset-biotypes-from-ref-table"]], "rnalysis.enrichment.FeatureSet.change_set_name": [[15, "rnalysis-enrichment-featureset-change-set-name"]], "rnalysis.enrichment.FeatureSet.clear": [[16, "rnalysis-enrichment-featureset-clear"]], "rnalysis.enrichment.FeatureSet.copy": [[17, "rnalysis-enrichment-featureset-copy"]], "rnalysis.enrichment.FeatureSet.difference": [[18, "rnalysis-enrichment-featureset-difference"]], "rnalysis.enrichment.FeatureSet.difference_update": [[19, "rnalysis-enrichment-featureset-difference-update"]], "rnalysis.enrichment.FeatureSet.discard": [[20, "rnalysis-enrichment-featureset-discard"]], "rnalysis.enrichment.FeatureSet.filter_by_attribute": [[21, "rnalysis-enrichment-featureset-filter-by-attribute"]], "rnalysis.enrichment.FeatureSet.filter_by_go_annotations": [[22, "rnalysis-enrichment-featureset-filter-by-go-annotations"]], "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations": [[23, "rnalysis-enrichment-featureset-filter-by-kegg-annotations"]], "rnalysis.enrichment.FeatureSet.go_enrichment": [[24, "rnalysis-enrichment-featureset-go-enrichment"]], "rnalysis.enrichment.FeatureSet.intersection": [[25, "rnalysis-enrichment-featureset-intersection"]], "rnalysis.enrichment.FeatureSet.intersection_update": [[26, "rnalysis-enrichment-featureset-intersection-update"]], "rnalysis.enrichment.FeatureSet.isdisjoint": [[27, "rnalysis-enrichment-featureset-isdisjoint"]], "rnalysis.enrichment.FeatureSet.issubset": [[28, "rnalysis-enrichment-featureset-issubset"]], "rnalysis.enrichment.FeatureSet.issuperset": [[29, "rnalysis-enrichment-featureset-issuperset"]], "rnalysis.enrichment.FeatureSet.kegg_enrichment": [[30, "rnalysis-enrichment-featureset-kegg-enrichment"]], "rnalysis.enrichment.FeatureSet.non_categorical_enrichment": [[31, "rnalysis-enrichment-featureset-non-categorical-enrichment"]], "rnalysis.enrichment.FeatureSet.pop": [[32, "rnalysis-enrichment-featureset-pop"]], "rnalysis.enrichment.FeatureSet.remove": [[33, "rnalysis-enrichment-featureset-remove"]], "rnalysis.enrichment.FeatureSet.save_txt": [[34, "rnalysis-enrichment-featureset-save-txt"]], "rnalysis.enrichment.FeatureSet.symmetric_difference": [[35, "rnalysis-enrichment-featureset-symmetric-difference"]], "rnalysis.enrichment.FeatureSet.symmetric_difference_update": [[36, "rnalysis-enrichment-featureset-symmetric-difference-update"]], "rnalysis.enrichment.FeatureSet.translate_gene_ids": [[37, "rnalysis-enrichment-featureset-translate-gene-ids"]], "rnalysis.enrichment.FeatureSet.union": [[38, "rnalysis-enrichment-featureset-union"]], "rnalysis.enrichment.FeatureSet.update": [[39, "rnalysis-enrichment-featureset-update"]], "rnalysis.enrichment.FeatureSet.user_defined_enrichment": [[40, "rnalysis-enrichment-featureset-user-defined-enrichment"]], "rnalysis.enrichment.RankedSet": [[41, "rnalysis-enrichment-rankedset"]], "rnalysis.enrichment.RankedSet.add": [[42, "rnalysis-enrichment-rankedset-add"]], "rnalysis.enrichment.RankedSet.biotypes_from_ref_table": [[43, "rnalysis-enrichment-rankedset-biotypes-from-ref-table"]], "rnalysis.enrichment.RankedSet.change_set_name": [[44, "rnalysis-enrichment-rankedset-change-set-name"]], "rnalysis.enrichment.RankedSet.clear": [[45, "rnalysis-enrichment-rankedset-clear"]], "rnalysis.enrichment.RankedSet.copy": [[46, "rnalysis-enrichment-rankedset-copy"]], "rnalysis.enrichment.RankedSet.difference": [[47, "rnalysis-enrichment-rankedset-difference"]], "rnalysis.enrichment.RankedSet.difference_update": [[48, "rnalysis-enrichment-rankedset-difference-update"]], "rnalysis.enrichment.RankedSet.discard": [[49, "rnalysis-enrichment-rankedset-discard"]], "rnalysis.enrichment.RankedSet.filter_by_attribute": [[50, "rnalysis-enrichment-rankedset-filter-by-attribute"]], "rnalysis.enrichment.RankedSet.filter_by_go_annotations": [[51, "rnalysis-enrichment-rankedset-filter-by-go-annotations"]], "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations": [[52, "rnalysis-enrichment-rankedset-filter-by-kegg-annotations"]], "rnalysis.enrichment.RankedSet.go_enrichment": [[53, "rnalysis-enrichment-rankedset-go-enrichment"]], "rnalysis.enrichment.RankedSet.intersection": [[54, "rnalysis-enrichment-rankedset-intersection"]], "rnalysis.enrichment.RankedSet.intersection_update": [[55, "rnalysis-enrichment-rankedset-intersection-update"]], "rnalysis.enrichment.RankedSet.isdisjoint": [[56, "rnalysis-enrichment-rankedset-isdisjoint"]], "rnalysis.enrichment.RankedSet.issubset": [[57, "rnalysis-enrichment-rankedset-issubset"]], "rnalysis.enrichment.RankedSet.issuperset": [[58, "rnalysis-enrichment-rankedset-issuperset"]], "rnalysis.enrichment.RankedSet.kegg_enrichment": [[59, "rnalysis-enrichment-rankedset-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.non_categorical_enrichment": [[60, "rnalysis-enrichment-rankedset-non-categorical-enrichment"]], "rnalysis.enrichment.RankedSet.pop": [[61, "rnalysis-enrichment-rankedset-pop"]], "rnalysis.enrichment.RankedSet.remove": [[62, "rnalysis-enrichment-rankedset-remove"]], "rnalysis.enrichment.RankedSet.save_txt": [[63, "rnalysis-enrichment-rankedset-save-txt"]], "rnalysis.enrichment.RankedSet.single_set_enrichment": [[64, "rnalysis-enrichment-rankedset-single-set-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_go_enrichment": [[65, "rnalysis-enrichment-rankedset-single-set-go-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment": [[66, "rnalysis-enrichment-rankedset-single-set-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.symmetric_difference": [[67, "rnalysis-enrichment-rankedset-symmetric-difference"]], "rnalysis.enrichment.RankedSet.symmetric_difference_update": [[68, "rnalysis-enrichment-rankedset-symmetric-difference-update"]], "rnalysis.enrichment.RankedSet.translate_gene_ids": [[69, "rnalysis-enrichment-rankedset-translate-gene-ids"]], "rnalysis.enrichment.RankedSet.union": [[70, "rnalysis-enrichment-rankedset-union"]], "rnalysis.enrichment.RankedSet.update": [[71, "rnalysis-enrichment-rankedset-update"]], "rnalysis.enrichment.RankedSet.user_defined_enrichment": [[72, "rnalysis-enrichment-rankedset-user-defined-enrichment"]], "rnalysis.enrichment.enrichment_bar_plot": [[73, "rnalysis-enrichment-enrichment-bar-plot"]], "rnalysis.enrichment.gene_ontology_graph": [[74, "rnalysis-enrichment-gene-ontology-graph"]], "rnalysis.enrichment.kegg_pathway_graph": [[75, "rnalysis-enrichment-kegg-pathway-graph"]], "rnalysis.enrichment.upset_plot": [[76, "rnalysis-enrichment-upset-plot"]], "rnalysis.enrichment.venn_diagram": [[77, "rnalysis-enrichment-venn-diagram"]], "rnalysis.fastq": [[78, "rnalysis-fastq"]], "rnalysis.fastq.PairedEndPipeline": [[79, "rnalysis-fastq-pairedendpipeline"]], "rnalysis.fastq.PairedEndPipeline.add_function": [[80, "rnalysis-fastq-pairedendpipeline-add-function"]], "rnalysis.fastq.PairedEndPipeline.apply_to": [[81, "rnalysis-fastq-pairedendpipeline-apply-to"]], "rnalysis.fastq.PairedEndPipeline.export_pipeline": [[82, "rnalysis-fastq-pairedendpipeline-export-pipeline"]], "rnalysis.fastq.PairedEndPipeline.import_pipeline": [[83, "rnalysis-fastq-pairedendpipeline-import-pipeline"]], "rnalysis.fastq.PairedEndPipeline.remove_last_function": [[84, "rnalysis-fastq-pairedendpipeline-remove-last-function"]], "rnalysis.fastq.SingleEndPipeline": [[85, "rnalysis-fastq-singleendpipeline"]], "rnalysis.fastq.SingleEndPipeline.add_function": [[86, "rnalysis-fastq-singleendpipeline-add-function"]], "rnalysis.fastq.SingleEndPipeline.apply_to": [[87, "rnalysis-fastq-singleendpipeline-apply-to"]], "rnalysis.fastq.SingleEndPipeline.export_pipeline": [[88, "rnalysis-fastq-singleendpipeline-export-pipeline"]], "rnalysis.fastq.SingleEndPipeline.import_pipeline": [[89, "rnalysis-fastq-singleendpipeline-import-pipeline"]], "rnalysis.fastq.SingleEndPipeline.remove_last_function": [[90, "rnalysis-fastq-singleendpipeline-remove-last-function"]], "rnalysis.fastq.bowtie2_align_paired_end": [[91, "rnalysis-fastq-bowtie2-align-paired-end"]], "rnalysis.fastq.bowtie2_align_single_end": [[92, "rnalysis-fastq-bowtie2-align-single-end"]], "rnalysis.fastq.bowtie2_create_index": [[93, "rnalysis-fastq-bowtie2-create-index"]], "rnalysis.fastq.featurecounts_paired_end": [[94, "rnalysis-fastq-featurecounts-paired-end"]], "rnalysis.fastq.featurecounts_single_end": [[95, "rnalysis-fastq-featurecounts-single-end"]], "rnalysis.fastq.kallisto_create_index": [[96, "rnalysis-fastq-kallisto-create-index"]], "rnalysis.fastq.kallisto_quantify_paired_end": [[97, "rnalysis-fastq-kallisto-quantify-paired-end"]], "rnalysis.fastq.kallisto_quantify_single_end": [[98, "rnalysis-fastq-kallisto-quantify-single-end"]], "rnalysis.fastq.shortstack_align_smallrna": [[99, "rnalysis-fastq-shortstack-align-smallrna"]], "rnalysis.fastq.trim_adapters_paired_end": [[100, "rnalysis-fastq-trim-adapters-paired-end"]], "rnalysis.fastq.trim_adapters_single_end": [[101, "rnalysis-fastq-trim-adapters-single-end"]], "rnalysis.filtering": [[102, "rnalysis-filtering"]], "rnalysis.filtering.CountFilter": [[103, "rnalysis-filtering-countfilter"]], "rnalysis.filtering.CountFilter.average_replicate_samples": [[104, "rnalysis-filtering-countfilter-average-replicate-samples"]], "rnalysis.filtering.CountFilter.biotypes_from_gtf": [[105, "rnalysis-filtering-countfilter-biotypes-from-gtf"]], "rnalysis.filtering.CountFilter.biotypes_from_ref_table": [[106, "rnalysis-filtering-countfilter-biotypes-from-ref-table"]], "rnalysis.filtering.CountFilter.box_plot": [[107, "rnalysis-filtering-countfilter-box-plot"]], "rnalysis.filtering.CountFilter.clustergram": [[108, "rnalysis-filtering-countfilter-clustergram"]], "rnalysis.filtering.CountFilter.describe": [[109, "rnalysis-filtering-countfilter-describe"]], "rnalysis.filtering.CountFilter.difference": [[110, "rnalysis-filtering-countfilter-difference"]], "rnalysis.filtering.CountFilter.differential_expression_deseq2": [[111, "rnalysis-filtering-countfilter-differential-expression-deseq2"]], "rnalysis.filtering.CountFilter.differential_expression_limma_voom": [[112, "rnalysis-filtering-countfilter-differential-expression-limma-voom"]], "rnalysis.filtering.CountFilter.drop_columns": [[113, "rnalysis-filtering-countfilter-drop-columns"]], "rnalysis.filtering.CountFilter.enhanced_box_plot": [[114, "rnalysis-filtering-countfilter-enhanced-box-plot"]], "rnalysis.filtering.CountFilter.filter_biotype_from_gtf": [[115, "rnalysis-filtering-countfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table": [[116, "rnalysis-filtering-countfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.CountFilter.filter_by_attribute": [[117, "rnalysis-filtering-countfilter-filter-by-attribute"]], "rnalysis.filtering.CountFilter.filter_by_go_annotations": [[118, "rnalysis-filtering-countfilter-filter-by-go-annotations"]], "rnalysis.filtering.CountFilter.filter_by_kegg_annotations": [[119, "rnalysis-filtering-countfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.CountFilter.filter_by_row_name": [[120, "rnalysis-filtering-countfilter-filter-by-row-name"]], "rnalysis.filtering.CountFilter.filter_by_row_sum": [[121, "rnalysis-filtering-countfilter-filter-by-row-sum"]], "rnalysis.filtering.CountFilter.filter_duplicate_ids": [[122, "rnalysis-filtering-countfilter-filter-duplicate-ids"]], "rnalysis.filtering.CountFilter.filter_low_reads": [[123, "rnalysis-filtering-countfilter-filter-low-reads"]], "rnalysis.filtering.CountFilter.filter_missing_values": [[124, "rnalysis-filtering-countfilter-filter-missing-values"]], "rnalysis.filtering.CountFilter.filter_percentile": [[125, "rnalysis-filtering-countfilter-filter-percentile"]], "rnalysis.filtering.CountFilter.filter_top_n": [[126, "rnalysis-filtering-countfilter-filter-top-n"]], "rnalysis.filtering.CountFilter.find_paralogs_ensembl": [[127, "rnalysis-filtering-countfilter-find-paralogs-ensembl"]], "rnalysis.filtering.CountFilter.find_paralogs_panther": [[128, "rnalysis-filtering-countfilter-find-paralogs-panther"]], "rnalysis.filtering.CountFilter.fold_change": [[129, "rnalysis-filtering-countfilter-fold-change"]], "rnalysis.filtering.CountFilter.from_dataframe": [[130, "rnalysis-filtering-countfilter-from-dataframe"]], "rnalysis.filtering.CountFilter.from_folder": [[131, "rnalysis-filtering-countfilter-from-folder"]], "rnalysis.filtering.CountFilter.from_folder_htseqcount": [[132, "rnalysis-filtering-countfilter-from-folder-htseqcount"]], "rnalysis.filtering.CountFilter.head": [[133, "rnalysis-filtering-countfilter-head"]], "rnalysis.filtering.CountFilter.intersection": [[134, "rnalysis-filtering-countfilter-intersection"]], "rnalysis.filtering.CountFilter.ma_plot": [[135, "rnalysis-filtering-countfilter-ma-plot"]], "rnalysis.filtering.CountFilter.majority_vote_intersection": [[136, "rnalysis-filtering-countfilter-majority-vote-intersection"]], "rnalysis.filtering.CountFilter.map_orthologs_ensembl": [[137, "rnalysis-filtering-countfilter-map-orthologs-ensembl"]], "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector": [[138, "rnalysis-filtering-countfilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.CountFilter.map_orthologs_panther": [[139, "rnalysis-filtering-countfilter-map-orthologs-panther"]], "rnalysis.filtering.CountFilter.map_orthologs_phylomedb": [[140, "rnalysis-filtering-countfilter-map-orthologs-phylomedb"]], "rnalysis.filtering.CountFilter.normalize_median_of_ratios": [[141, "rnalysis-filtering-countfilter-normalize-median-of-ratios"]], "rnalysis.filtering.CountFilter.normalize_rle": [[142, "rnalysis-filtering-countfilter-normalize-rle"]], "rnalysis.filtering.CountFilter.normalize_tmm": [[143, "rnalysis-filtering-countfilter-normalize-tmm"]], "rnalysis.filtering.CountFilter.normalize_to_quantile": [[144, "rnalysis-filtering-countfilter-normalize-to-quantile"]], "rnalysis.filtering.CountFilter.normalize_to_rpkm": [[145, "rnalysis-filtering-countfilter-normalize-to-rpkm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm": [[146, "rnalysis-filtering-countfilter-normalize-to-rpm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount": [[147, "rnalysis-filtering-countfilter-normalize-to-rpm-htseqcount"]], "rnalysis.filtering.CountFilter.normalize_to_tpm": [[148, "rnalysis-filtering-countfilter-normalize-to-tpm"]], "rnalysis.filtering.CountFilter.normalize_with_scaling_factors": [[149, "rnalysis-filtering-countfilter-normalize-with-scaling-factors"]], "rnalysis.filtering.CountFilter.number_filters": [[150, "rnalysis-filtering-countfilter-number-filters"]], "rnalysis.filtering.CountFilter.pairplot": [[151, "rnalysis-filtering-countfilter-pairplot"]], "rnalysis.filtering.CountFilter.pca": [[152, "rnalysis-filtering-countfilter-pca"]], "rnalysis.filtering.CountFilter.plot_expression": [[153, "rnalysis-filtering-countfilter-plot-expression"]], "rnalysis.filtering.CountFilter.print_features": [[154, "rnalysis-filtering-countfilter-print-features"]], "rnalysis.filtering.CountFilter.save_csv": [[155, "rnalysis-filtering-countfilter-save-csv"]], "rnalysis.filtering.CountFilter.save_parquet": [[156, "rnalysis-filtering-countfilter-save-parquet"]], "rnalysis.filtering.CountFilter.save_table": [[157, "rnalysis-filtering-countfilter-save-table"]], "rnalysis.filtering.CountFilter.scatter_sample_vs_sample": [[158, "rnalysis-filtering-countfilter-scatter-sample-vs-sample"]], "rnalysis.filtering.CountFilter.sort": [[159, "rnalysis-filtering-countfilter-sort"]], "rnalysis.filtering.CountFilter.sort_by_principal_component": [[160, "rnalysis-filtering-countfilter-sort-by-principal-component"]], "rnalysis.filtering.CountFilter.split_by_attribute": [[161, "rnalysis-filtering-countfilter-split-by-attribute"]], "rnalysis.filtering.CountFilter.split_by_percentile": [[162, "rnalysis-filtering-countfilter-split-by-percentile"]], "rnalysis.filtering.CountFilter.split_by_principal_components": [[163, "rnalysis-filtering-countfilter-split-by-principal-components"]], "rnalysis.filtering.CountFilter.split_by_reads": [[164, "rnalysis-filtering-countfilter-split-by-reads"]], "rnalysis.filtering.CountFilter.split_clicom": [[165, "rnalysis-filtering-countfilter-split-clicom"]], "rnalysis.filtering.CountFilter.split_hdbscan": [[166, "rnalysis-filtering-countfilter-split-hdbscan"]], "rnalysis.filtering.CountFilter.split_hierarchical": [[167, "rnalysis-filtering-countfilter-split-hierarchical"]], "rnalysis.filtering.CountFilter.split_kmeans": [[168, "rnalysis-filtering-countfilter-split-kmeans"]], "rnalysis.filtering.CountFilter.split_kmedoids": [[169, "rnalysis-filtering-countfilter-split-kmedoids"]], "rnalysis.filtering.CountFilter.symmetric_difference": [[170, "rnalysis-filtering-countfilter-symmetric-difference"]], "rnalysis.filtering.CountFilter.tail": [[171, "rnalysis-filtering-countfilter-tail"]], "rnalysis.filtering.CountFilter.text_filters": [[172, "rnalysis-filtering-countfilter-text-filters"]], "rnalysis.filtering.CountFilter.transform": [[173, "rnalysis-filtering-countfilter-transform"]], "rnalysis.filtering.CountFilter.translate_gene_ids": [[174, "rnalysis-filtering-countfilter-translate-gene-ids"]], "rnalysis.filtering.CountFilter.union": [[175, "rnalysis-filtering-countfilter-union"]], "rnalysis.filtering.CountFilter.violin_plot": [[176, "rnalysis-filtering-countfilter-violin-plot"]], "rnalysis.filtering.DESeqFilter": [[177, "rnalysis-filtering-deseqfilter"]], "rnalysis.filtering.DESeqFilter.biotypes_from_gtf": [[178, "rnalysis-filtering-deseqfilter-biotypes-from-gtf"]], "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table": [[179, "rnalysis-filtering-deseqfilter-biotypes-from-ref-table"]], "rnalysis.filtering.DESeqFilter.describe": [[180, "rnalysis-filtering-deseqfilter-describe"]], "rnalysis.filtering.DESeqFilter.difference": [[181, "rnalysis-filtering-deseqfilter-difference"]], "rnalysis.filtering.DESeqFilter.drop_columns": [[182, "rnalysis-filtering-deseqfilter-drop-columns"]], "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change": [[183, "rnalysis-filtering-deseqfilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf": [[184, "rnalysis-filtering-deseqfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table": [[185, "rnalysis-filtering-deseqfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.DESeqFilter.filter_by_attribute": [[186, "rnalysis-filtering-deseqfilter-filter-by-attribute"]], "rnalysis.filtering.DESeqFilter.filter_by_go_annotations": [[187, "rnalysis-filtering-deseqfilter-filter-by-go-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations": [[188, "rnalysis-filtering-deseqfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_row_name": [[189, "rnalysis-filtering-deseqfilter-filter-by-row-name"]], "rnalysis.filtering.DESeqFilter.filter_duplicate_ids": [[190, "rnalysis-filtering-deseqfilter-filter-duplicate-ids"]], "rnalysis.filtering.DESeqFilter.filter_fold_change_direction": [[191, "rnalysis-filtering-deseqfilter-filter-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.filter_missing_values": [[192, "rnalysis-filtering-deseqfilter-filter-missing-values"]], "rnalysis.filtering.DESeqFilter.filter_percentile": [[193, "rnalysis-filtering-deseqfilter-filter-percentile"]], "rnalysis.filtering.DESeqFilter.filter_significant": [[194, "rnalysis-filtering-deseqfilter-filter-significant"]], "rnalysis.filtering.DESeqFilter.filter_top_n": [[195, "rnalysis-filtering-deseqfilter-filter-top-n"]], "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl": [[196, "rnalysis-filtering-deseqfilter-find-paralogs-ensembl"]], "rnalysis.filtering.DESeqFilter.find_paralogs_panther": [[197, "rnalysis-filtering-deseqfilter-find-paralogs-panther"]], "rnalysis.filtering.DESeqFilter.from_dataframe": [[198, "rnalysis-filtering-deseqfilter-from-dataframe"]], "rnalysis.filtering.DESeqFilter.head": [[199, "rnalysis-filtering-deseqfilter-head"]], "rnalysis.filtering.DESeqFilter.intersection": [[200, "rnalysis-filtering-deseqfilter-intersection"]], "rnalysis.filtering.DESeqFilter.majority_vote_intersection": [[201, "rnalysis-filtering-deseqfilter-majority-vote-intersection"]], "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl": [[202, "rnalysis-filtering-deseqfilter-map-orthologs-ensembl"]], "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector": [[203, "rnalysis-filtering-deseqfilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.DESeqFilter.map_orthologs_panther": [[204, "rnalysis-filtering-deseqfilter-map-orthologs-panther"]], "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb": [[205, "rnalysis-filtering-deseqfilter-map-orthologs-phylomedb"]], "rnalysis.filtering.DESeqFilter.number_filters": [[206, "rnalysis-filtering-deseqfilter-number-filters"]], "rnalysis.filtering.DESeqFilter.print_features": [[207, "rnalysis-filtering-deseqfilter-print-features"]], "rnalysis.filtering.DESeqFilter.save_csv": [[208, "rnalysis-filtering-deseqfilter-save-csv"]], "rnalysis.filtering.DESeqFilter.save_parquet": [[209, "rnalysis-filtering-deseqfilter-save-parquet"]], "rnalysis.filtering.DESeqFilter.save_table": [[210, "rnalysis-filtering-deseqfilter-save-table"]], "rnalysis.filtering.DESeqFilter.sort": [[211, "rnalysis-filtering-deseqfilter-sort"]], "rnalysis.filtering.DESeqFilter.split_by_attribute": [[212, "rnalysis-filtering-deseqfilter-split-by-attribute"]], "rnalysis.filtering.DESeqFilter.split_by_percentile": [[213, "rnalysis-filtering-deseqfilter-split-by-percentile"]], "rnalysis.filtering.DESeqFilter.split_fold_change_direction": [[214, "rnalysis-filtering-deseqfilter-split-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.symmetric_difference": [[215, "rnalysis-filtering-deseqfilter-symmetric-difference"]], "rnalysis.filtering.DESeqFilter.tail": [[216, "rnalysis-filtering-deseqfilter-tail"]], "rnalysis.filtering.DESeqFilter.text_filters": [[217, "rnalysis-filtering-deseqfilter-text-filters"]], "rnalysis.filtering.DESeqFilter.transform": [[218, "rnalysis-filtering-deseqfilter-transform"]], "rnalysis.filtering.DESeqFilter.translate_gene_ids": [[219, "rnalysis-filtering-deseqfilter-translate-gene-ids"]], "rnalysis.filtering.DESeqFilter.union": [[220, "rnalysis-filtering-deseqfilter-union"]], "rnalysis.filtering.DESeqFilter.volcano_plot": [[221, "rnalysis-filtering-deseqfilter-volcano-plot"]], "rnalysis.filtering.Filter": [[222, "rnalysis-filtering-filter"]], "rnalysis.filtering.Filter.biotypes_from_gtf": [[223, "rnalysis-filtering-filter-biotypes-from-gtf"]], "rnalysis.filtering.Filter.biotypes_from_ref_table": [[224, "rnalysis-filtering-filter-biotypes-from-ref-table"]], "rnalysis.filtering.Filter.describe": [[225, "rnalysis-filtering-filter-describe"]], "rnalysis.filtering.Filter.difference": [[226, "rnalysis-filtering-filter-difference"]], "rnalysis.filtering.Filter.drop_columns": [[227, "rnalysis-filtering-filter-drop-columns"]], "rnalysis.filtering.Filter.filter_biotype_from_gtf": [[228, "rnalysis-filtering-filter-filter-biotype-from-gtf"]], "rnalysis.filtering.Filter.filter_biotype_from_ref_table": [[229, "rnalysis-filtering-filter-filter-biotype-from-ref-table"]], "rnalysis.filtering.Filter.filter_by_attribute": [[230, "rnalysis-filtering-filter-filter-by-attribute"]], "rnalysis.filtering.Filter.filter_by_go_annotations": [[231, "rnalysis-filtering-filter-filter-by-go-annotations"]], "rnalysis.filtering.Filter.filter_by_kegg_annotations": [[232, "rnalysis-filtering-filter-filter-by-kegg-annotations"]], "rnalysis.filtering.Filter.filter_by_row_name": [[233, "rnalysis-filtering-filter-filter-by-row-name"]], "rnalysis.filtering.Filter.filter_duplicate_ids": [[234, "rnalysis-filtering-filter-filter-duplicate-ids"]], "rnalysis.filtering.Filter.filter_missing_values": [[235, "rnalysis-filtering-filter-filter-missing-values"]], "rnalysis.filtering.Filter.filter_percentile": [[236, "rnalysis-filtering-filter-filter-percentile"]], "rnalysis.filtering.Filter.filter_top_n": [[237, "rnalysis-filtering-filter-filter-top-n"]], "rnalysis.filtering.Filter.find_paralogs_ensembl": [[238, "rnalysis-filtering-filter-find-paralogs-ensembl"]], "rnalysis.filtering.Filter.find_paralogs_panther": [[239, "rnalysis-filtering-filter-find-paralogs-panther"]], "rnalysis.filtering.Filter.from_dataframe": [[240, "rnalysis-filtering-filter-from-dataframe"]], "rnalysis.filtering.Filter.head": [[241, "rnalysis-filtering-filter-head"]], "rnalysis.filtering.Filter.intersection": [[242, "rnalysis-filtering-filter-intersection"]], "rnalysis.filtering.Filter.majority_vote_intersection": [[243, "rnalysis-filtering-filter-majority-vote-intersection"]], "rnalysis.filtering.Filter.map_orthologs_ensembl": [[244, "rnalysis-filtering-filter-map-orthologs-ensembl"]], "rnalysis.filtering.Filter.map_orthologs_orthoinspector": [[245, "rnalysis-filtering-filter-map-orthologs-orthoinspector"]], "rnalysis.filtering.Filter.map_orthologs_panther": [[246, "rnalysis-filtering-filter-map-orthologs-panther"]], "rnalysis.filtering.Filter.map_orthologs_phylomedb": [[247, "rnalysis-filtering-filter-map-orthologs-phylomedb"]], "rnalysis.filtering.Filter.number_filters": [[248, "rnalysis-filtering-filter-number-filters"]], "rnalysis.filtering.Filter.print_features": [[249, "rnalysis-filtering-filter-print-features"]], "rnalysis.filtering.Filter.save_csv": [[250, "rnalysis-filtering-filter-save-csv"]], "rnalysis.filtering.Filter.save_parquet": [[251, "rnalysis-filtering-filter-save-parquet"]], "rnalysis.filtering.Filter.save_table": [[252, "rnalysis-filtering-filter-save-table"]], "rnalysis.filtering.Filter.sort": [[253, "rnalysis-filtering-filter-sort"]], "rnalysis.filtering.Filter.split_by_attribute": [[254, "rnalysis-filtering-filter-split-by-attribute"]], "rnalysis.filtering.Filter.split_by_percentile": [[255, "rnalysis-filtering-filter-split-by-percentile"]], "rnalysis.filtering.Filter.symmetric_difference": [[256, "rnalysis-filtering-filter-symmetric-difference"]], "rnalysis.filtering.Filter.tail": [[257, "rnalysis-filtering-filter-tail"]], "rnalysis.filtering.Filter.text_filters": [[258, "rnalysis-filtering-filter-text-filters"]], "rnalysis.filtering.Filter.transform": [[259, "rnalysis-filtering-filter-transform"]], "rnalysis.filtering.Filter.translate_gene_ids": [[260, "rnalysis-filtering-filter-translate-gene-ids"]], "rnalysis.filtering.Filter.union": [[261, "rnalysis-filtering-filter-union"]], "rnalysis.filtering.FoldChangeFilter": [[262, "rnalysis-filtering-foldchangefilter"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf": [[263, "rnalysis-filtering-foldchangefilter-biotypes-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table": [[264, "rnalysis-filtering-foldchangefilter-biotypes-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.describe": [[265, "rnalysis-filtering-foldchangefilter-describe"]], "rnalysis.filtering.FoldChangeFilter.difference": [[266, "rnalysis-filtering-foldchangefilter-difference"]], "rnalysis.filtering.FoldChangeFilter.drop_columns": [[267, "rnalysis-filtering-foldchangefilter-drop-columns"]], "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change": [[268, "rnalysis-filtering-foldchangefilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf": [[269, "rnalysis-filtering-foldchangefilter-filter-biotype-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table": [[270, "rnalysis-filtering-foldchangefilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.filter_by_attribute": [[271, "rnalysis-filtering-foldchangefilter-filter-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations": [[272, "rnalysis-filtering-foldchangefilter-filter-by-go-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations": [[273, "rnalysis-filtering-foldchangefilter-filter-by-kegg-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_row_name": [[274, "rnalysis-filtering-foldchangefilter-filter-by-row-name"]], "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids": [[275, "rnalysis-filtering-foldchangefilter-filter-duplicate-ids"]], "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction": [[276, "rnalysis-filtering-foldchangefilter-filter-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.filter_missing_values": [[277, "rnalysis-filtering-foldchangefilter-filter-missing-values"]], "rnalysis.filtering.FoldChangeFilter.filter_percentile": [[278, "rnalysis-filtering-foldchangefilter-filter-percentile"]], "rnalysis.filtering.FoldChangeFilter.filter_top_n": [[279, "rnalysis-filtering-foldchangefilter-filter-top-n"]], "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl": [[280, "rnalysis-filtering-foldchangefilter-find-paralogs-ensembl"]], "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther": [[281, "rnalysis-filtering-foldchangefilter-find-paralogs-panther"]], "rnalysis.filtering.FoldChangeFilter.from_dataframe": [[282, "rnalysis-filtering-foldchangefilter-from-dataframe"]], "rnalysis.filtering.FoldChangeFilter.head": [[283, "rnalysis-filtering-foldchangefilter-head"]], "rnalysis.filtering.FoldChangeFilter.intersection": [[284, "rnalysis-filtering-foldchangefilter-intersection"]], "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection": [[285, "rnalysis-filtering-foldchangefilter-majority-vote-intersection"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl": [[286, "rnalysis-filtering-foldchangefilter-map-orthologs-ensembl"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector": [[287, "rnalysis-filtering-foldchangefilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther": [[288, "rnalysis-filtering-foldchangefilter-map-orthologs-panther"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb": [[289, "rnalysis-filtering-foldchangefilter-map-orthologs-phylomedb"]], "rnalysis.filtering.FoldChangeFilter.number_filters": [[290, "rnalysis-filtering-foldchangefilter-number-filters"]], "rnalysis.filtering.FoldChangeFilter.print_features": [[291, "rnalysis-filtering-foldchangefilter-print-features"]], "rnalysis.filtering.FoldChangeFilter.randomization_test": [[292, "rnalysis-filtering-foldchangefilter-randomization-test"]], "rnalysis.filtering.FoldChangeFilter.save_csv": [[293, "rnalysis-filtering-foldchangefilter-save-csv"]], "rnalysis.filtering.FoldChangeFilter.save_parquet": [[294, "rnalysis-filtering-foldchangefilter-save-parquet"]], "rnalysis.filtering.FoldChangeFilter.save_table": [[295, "rnalysis-filtering-foldchangefilter-save-table"]], "rnalysis.filtering.FoldChangeFilter.sort": [[296, "rnalysis-filtering-foldchangefilter-sort"]], "rnalysis.filtering.FoldChangeFilter.split_by_attribute": [[297, "rnalysis-filtering-foldchangefilter-split-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.split_by_percentile": [[298, "rnalysis-filtering-foldchangefilter-split-by-percentile"]], "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction": [[299, "rnalysis-filtering-foldchangefilter-split-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.symmetric_difference": [[300, "rnalysis-filtering-foldchangefilter-symmetric-difference"]], "rnalysis.filtering.FoldChangeFilter.tail": [[301, "rnalysis-filtering-foldchangefilter-tail"]], "rnalysis.filtering.FoldChangeFilter.text_filters": [[302, "rnalysis-filtering-foldchangefilter-text-filters"]], "rnalysis.filtering.FoldChangeFilter.transform": [[303, "rnalysis-filtering-foldchangefilter-transform"]], "rnalysis.filtering.FoldChangeFilter.translate_gene_ids": [[304, "rnalysis-filtering-foldchangefilter-translate-gene-ids"]], "rnalysis.filtering.FoldChangeFilter.union": [[305, "rnalysis-filtering-foldchangefilter-union"]], "rnalysis.filtering.Pipeline": [[306, "rnalysis-filtering-pipeline"]], "rnalysis.filtering.Pipeline.add_function": [[307, "rnalysis-filtering-pipeline-add-function"]], "rnalysis.filtering.Pipeline.apply_to": [[308, "rnalysis-filtering-pipeline-apply-to"]], "rnalysis.filtering.Pipeline.export_pipeline": [[309, "rnalysis-filtering-pipeline-export-pipeline"]], "rnalysis.filtering.Pipeline.import_pipeline": [[310, "rnalysis-filtering-pipeline-import-pipeline"]], "rnalysis.filtering.Pipeline.remove_last_function": [[311, "rnalysis-filtering-pipeline-remove-last-function"]], "rnalysis.general": [[312, "rnalysis-general"]], "rnalysis.general.clear_all_cache": [[313, "rnalysis-general-clear-all-cache"]], "rnalysis.general.clear_gui_cache": [[314, "rnalysis-general-clear-gui-cache"]], "rnalysis.general.parse_gene_name_string": [[315, "rnalysis-general-parse-gene-name-string"]], "rnalysis.general.parse_sequence_name_string": [[316, "rnalysis-general-parse-sequence-name-string"]], "rnalysis.general.parse_wbgene_string": [[317, "rnalysis-general-parse-wbgene-string"]], "rnalysis.general.print_settings_file": [[318, "rnalysis-general-print-settings-file"]], "rnalysis.general.reset_settings_file": [[319, "rnalysis-general-reset-settings-file"]], "rnalysis.general.save_to_csv": [[320, "rnalysis-general-save-to-csv"]], "rnalysis.general.set_attr_ref_table_path": [[321, "rnalysis-general-set-attr-ref-table-path"]], "rnalysis.general.set_biotype_ref_table_path": [[322, "rnalysis-general-set-biotype-ref-table-path"]], "A-to-Z tutorial - example analysis": [[323, "a-to-z-tutorial-example-analysis"]], "Intro and recommendations": [[323, "intro-and-recommendations"]], "Analysis #1 - time series RNA sequencing": [[323, "analysis-1-time-series-rna-sequencing"]], "The dataset": [[323, "the-dataset"], [323, "id6"]], "Start RNAlysis": [[323, "start-rnalysis"]], "Data preprocessing and exploratory data analysis": [[323, "data-preprocessing-and-exploratory-data-analysis"]], "Filter out lowly-expressed genes": [[323, "filter-out-lowly-expressed-genes"]], "Examine variance in our data with Principal Component Analysis": [[323, "examine-variance-in-our-data-with-principal-component-analysis"]], "Examine similarity between developmental stages": [[323, "examine-similarity-between-developmental-stages"]], "Compare the expression of specific genes over the developmental stages": [[323, "compare-the-expression-of-specific-genes-over-the-developmental-stages"]], "Clustering analysis": [[323, "clustering-analysis"]], "The simple approach - distance-based clustering with K-Medoids": [[323, "the-simple-approach-distance-based-clustering-with-k-medoids"]], "Fine-tuning our approach - density-based clustering with HDBSCAN": [[323, "fine-tuning-our-approach-density-based-clustering-with-hdbscan"]], "The complex approach - ensemble-based clustering with CLICOM": [[323, "the-complex-approach-ensemble-based-clustering-with-clicom"]], "Enrichment analysis": [[323, "enrichment-analysis"], [323, "id9"], [325, "enrichment-analysis"]], "Running enrichment analysis": [[323, "running-enrichment-analysis"], [323, "id11"]], "Create analysis report": [[323, "create-analysis-report"]], "Analysis #2 - differential expression data": [[323, "analysis-2-differential-expression-data"]], "Quantify FASTQ files and Differential Expression Analysis": [[323, "quantify-fastq-files-and-differential-expression-analysis"]], "Quality control with FastQC": [[323, "quality-control-with-fastqc"]], "Trim adapters and remove low-quality reads with CutAdapt": [[323, "trim-adapters-and-remove-low-quality-reads-with-cutadapt"]], "Quantify gene expression with kallisto": [[323, "quantify-gene-expression-with-kallisto"]], "Run differential expression analysis with DESeq2": [[323, "run-differential-expression-analysis-with-deseq2"]], "Data filtering and visualization with customized Pipelines": [[323, "data-filtering-and-visualization-with-customized-pipelines"]], "Create a customized Pipeline": [[323, "create-a-customized-pipeline"]], "Apply the Pipeline to our datasets": [[323, "apply-the-pipeline-to-our-datasets"]], "Visualizing and extracting gene set interesctions": [[323, "visualizing-and-extracting-gene-set-interesctions"]], "Create a Venn diagram": [[323, "create-a-venn-diagram"]], "Extract the gene subsets we are interested in": [[323, "extract-the-gene-subsets-we-are-interested-in"]], "Define a background set": [[323, "define-a-background-set"]], "Define our custom enrichment attributes": [[323, "define-our-custom-enrichment-attributes"]], "Final words": [[323, "final-words"]], "User guide - programmatic interface": [[324, "user-guide-programmatic-interface"]], "RNAlysis fastq module": [[324, "rnalysis-fastq-module"]], "Working with the fastq module": [[324, "working-with-the-fastq-module"]], "Adapter trimming with CutAdapt": [[324, "adapter-trimming-with-cutadapt"]], "Single-end adapter trimming": [[324, "single-end-adapter-trimming"]], "Paired-end adapter trimming": [[324, "paired-end-adapter-trimming"]], "RNA sequencing quantification with kallisto": [[324, "rna-sequencing-quantification-with-kallisto"]], "Building or acquiring index files": [[324, "building-or-acquiring-index-files"], [324, "id2"]], "Single-end read quantification": [[324, "single-end-read-quantification"]], "Paired-end read quantification": [[324, "paired-end-read-quantification"]], "Read alignment with bowtie2": [[324, "read-alignment-with-bowtie2"]], "Single-end read alignment": [[324, "single-end-read-alignment"]], "Paired-end read alignment": [[324, "paired-end-read-alignment"]], "Feature counting with featureCounts": [[324, "feature-counting-with-featurecounts"]], "Single-end read feature counting": [[324, "single-end-read-feature-counting"]], "Paired-end read feature counting": [[324, "paired-end-read-feature-counting"]], "RNAlysis filtering module": [[324, "rnalysis-filtering-module"]], "Working with Filter objects": [[324, "working-with-filter-objects"]], "Initialize a Filter object": [[324, "initialize-a-filter-object"]], "View a Filter object": [[324, "view-a-filter-object"]], "Filtering operations": [[324, "filtering-operations"], [325, "filtering-operations"]], "Performing set operations on multiple Filter objects": [[324, "performing-set-operations-on-multiple-filter-objects"]], "Saving Filter results": [[324, "saving-filter-results"]], "Using an Attribute Reference Table for filter operations": [[324, "using-an-attribute-reference-table-for-filter-operations"]], "Using a Biotype Reference Table for filter operations": [[324, "using-a-biotype-reference-table-for-filter-operations"]], "Filtering DESeq2 output files with filtering.DESeqFilter": [[324, "filtering-deseq2-output-files-with-filtering-deseqfilter"]], "Loading from a csv file": [[324, "loading-from-a-csv-file"]], "Filtering operations unique to DESeqFilter": [[324, "filtering-operations-unique-to-deseqfilter"]], "Data visualization and exploratory data analysis with DESeqFilter": [[324, "data-visualization-and-exploratory-data-analysis-with-deseqfilter"]], "Filtering count matrices with filtering.CountFilter": [[324, "filtering-count-matrices-with-filtering-countfilter"]], "Generating an CountFilter object from a folder of HTSeq-count output .txt files": [[324, "generating-an-countfilter-object-from-a-folder-of-htseq-count-output-txt-files"]], "Loading from a pre-made csv file": [[324, "loading-from-a-pre-made-csv-file"]], "Filtering operations unique to CountFilter": [[324, "filtering-operations-unique-to-countfilter"]], "Normalizing reads with CountFilter": [[324, "normalizing-reads-with-countfilter"]], "Data clustering with CountFilter": [[324, "data-clustering-with-countfilter"]], "K-Means clustering": [[324, "k-means-clustering"], [325, "k-means-clustering"]], "K-Medoids clustering": [[324, "k-medoids-clustering"], [325, "k-medoids-clustering"]], "Hierarchical clustering": [[324, "hierarchical-clustering"], [325, "hierarchical-clustering"]], "HDBSCAN clustering": [[324, "hdbscan-clustering"], [325, "hdbscan-clustering"]], "CLICOM clustering": [[324, "clicom-clustering"], [325, "clicom-clustering"]], "Specialized clustering distance metrics": [[324, "specialized-clustering-distance-metrics"], [325, "specialized-clustering-distance-metrics"]], "Data visualization and exploratory data analysis with CountFilter": [[324, "data-visualization-and-exploratory-data-analysis-with-countfilter"]], "Filtering fold-change data of features using filtering.FoldChangeFilter": [[324, "filtering-fold-change-data-of-features-using-filtering-foldchangefilter"]], "Loading fold change data from a csv file": [[324, "loading-fold-change-data-from-a-csv-file"]], "Generating fold change data from an existing CountFilter object": [[324, "generating-fold-change-data-from-an-existing-countfilter-object"]], "Performing randomization tests on a FoldChangeFilter object": [[324, "performing-randomization-tests-on-a-foldchangefilter-object"]], "Sequentially applying filtering operations using Pipelines": [[324, "sequentially-applying-filtering-operations-using-pipelines"]], "Creating a new Pipeline": [[324, "creating-a-new-pipeline"], [325, "creating-a-new-pipeline"]], "Applying Pipelines to Filter objects": [[324, "applying-pipelines-to-filter-objects"]], "Importing a Pipeline": [[324, "importing-a-pipeline"], [325, "importing-a-pipeline"]], "RNAlysis enrichment module": [[324, "rnalysis-enrichment-module"]], "Working with FeatureSet objects": [[324, "working-with-featureset-objects"]], "Initialize an FeatureSet object": [[324, "initialize-an-featureset-object"]], "GO Enrichment": [[324, "go-enrichment"], [325, "go-enrichment"]], "Define the correct organism and gene ID type for your dataset": [[324, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [324, "id21"], [325, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [325, "id18"]], "Define the background set": [[324, "define-the-background-set"], [324, "id22"], [324, "id30"], [324, "id38"]], "Choose the statistical test (optional)": [[324, "choose-the-statistical-test-optional"], [324, "id23"], [324, "id31"], [324, "id39"], [325, "choose-the-statistical-test-optional"], [325, "id19"], [325, "id26"], [325, "id33"]], "Filter GO Terms by GO aspects (optional)": [[324, "filter-go-terms-by-go-aspects-optional"], [325, "filter-go-terms-by-go-aspects-optional"]], "Filter GO Annotations by Evidence Codes (optional)": [[324, "filter-go-annotations-by-evidence-codes-optional"], [325, "filter-go-annotations-by-evidence-codes-optional"]], "Filter GO Annotations by database (optional)": [[324, "filter-go-annotations-by-database-optional"], [325, "filter-go-annotations-by-database-optional"]], "Filter GO Annotations by Qualifiers (optional)": [[324, "filter-go-annotations-by-qualifiers-optional"], [325, "filter-go-annotations-by-qualifiers-optional"]], "Choose annotation propagation method (optional)": [[324, "choose-annotation-propagation-method-optional"], [325, "choose-annotation-propagation-method-optional"]], "Choose plotting parameters (optional)": [[324, "choose-plotting-parameters-optional"], [324, "id24"], [324, "id32"], [324, "id40"], [325, "choose-plotting-parameters-optional"], [325, "id20"], [325, "id27"], [325, "id34"]], "Enrichment analysis output": [[324, "enrichment-analysis-output"], [324, "id29"], [324, "id37"], [325, "enrichment-analysis-output"], [325, "id25"], [325, "id32"]], "KEGG Pathways enrichment": [[324, "kegg-pathways-enrichment"], [325, "kegg-pathways-enrichment"]], "Enrichment analysis for user-defined attributes": [[324, "enrichment-analysis-for-user-defined-attributes"], [325, "enrichment-analysis-for-user-defined-attributes"]], "Choose which user-defined attributes to calculate enrichment for": [[324, "choose-which-user-defined-attributes-to-calculate-enrichment-for"], [325, "choose-which-user-defined-attributes-to-calculate-enrichment-for"]], "Performing enrichment analysis for non-categorical user-defined attributes": [[324, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"], [325, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"]], "Choose which user-defined non-categorical attributes to calculate enrichment for": [[324, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"], [325, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"]], "Non-Categorical Enrichment analysis output": [[324, "non-categorical-enrichment-analysis-output"], [325, "non-categorical-enrichment-analysis-output"]], "Performing set operations and visualisation on multiple FeatureSet objects": [[324, "performing-set-operations-and-visualisation-on-multiple-featureset-objects"]], "Saving indices from FeatureSet to a .txt file": [[324, "saving-indices-from-featureset-to-a-txt-file"]], "Working with RankedSet objects": [[324, "working-with-rankedset-objects"]], "Initialize an RankedSet object": [[324, "initialize-an-rankedset-object"]], "Performing single-set GO Enrichment analysis without a background set": [[324, "performing-single-set-go-enrichment-analysis-without-a-background-set"]], "Performing single-set KEGG Enrichment analysis without a background set": [[324, "performing-single-set-kegg-enrichment-analysis-without-a-background-set"]], "Performing single-set enrichment analysis for user-defined attributes without a background set": [[324, "performing-single-set-enrichment-analysis-for-user-defined-attributes-without-a-background-set"]], "Visualizing sets, intersections, and enrichment": [[324, "visualizing-sets-intersections-and-enrichment"]], "Plotting results of enrichment analysis": [[324, "plotting-results-of-enrichment-analysis"]], "Plotting Venn Diagrams and UpSet Plots": [[324, "plotting-venn-diagrams-and-upset-plots"]], "RNAlysis general module": [[324, "rnalysis-general-module"]], "Set and load a Reference Table": [[324, "set-and-load-a-reference-table"], [325, "set-and-load-a-reference-table"]], "What is an Attribute Reference Table?": [[324, "what-is-an-attribute-reference-table"], [325, "what-is-an-attribute-reference-table"]], "What is a Biotype Reference Table?": [[324, "what-is-a-biotype-reference-table"], [325, "what-is-a-biotype-reference-table"]], "Set a Reference Table as default": [[324, "set-a-reference-table-as-default"], [325, "set-a-reference-table-as-default"]], "Load the default Attribute Reference Table path": [[324, "load-the-default-attribute-reference-table-path"]], "Parse C. elegans gene names, WBGene indices and sequence names using regular expressions": [[324, "parse-c-elegans-gene-names-wbgene-indices-and-sequence-names-using-regular-expressions"]], "User guide - graphical interface": [[325, "user-guide-graphical-interface"]], "Analyzing data tables with RNAlysis": [[325, "analyzing-data-tables-with-rnalysis"]], "Working with tables": [[325, "working-with-tables"]], "Loading tables into RNAlysis": [[325, "loading-tables-into-rnalysis"]], "Loading multiple tables into RNAlysis": [[325, "loading-multiple-tables-into-rnalysis"]], "Working with multiple tables and organizing your workspace": [[325, "working-with-multiple-tables-and-organizing-your-workspace"]], "Examining tables": [[325, "examining-tables"]], "Using an Attribute Reference Table to filter tables": [[325, "using-an-attribute-reference-table-to-filter-tables"]], "Using a GTF file or Biotype Reference Table to filter tables or summarize tables": [[325, "using-a-gtf-file-or-biotype-reference-table-to-filter-tables-or-summarize-tables"]], "Working with Differential Expression Tables": [[325, "working-with-differential-expression-tables"]], "Differential expression analysis using DESeq2 through RNAlysis": [[325, "differential-expression-analysis-using-deseq2-through-rnalysis"]], "Differential Expression table format": [[325, "differential-expression-table-format"]], "Filtering operations unique to Differential Expression tables": [[325, "filtering-operations-unique-to-differential-expression-tables"]], "Data visualization and exploratory data analysis with Differential Expression Tables": [[325, "data-visualization-and-exploratory-data-analysis-with-differential-expression-tables"]], "Working with count matrices": [[325, "working-with-count-matrices"]], "Generating a count matrix from a folder of HTSeq-count output .txt files": [[325, "generating-a-count-matrix-from-a-folder-of-htseq-count-output-txt-files"]], "Loading  a pre-made csv file": [[325, "loading-a-pre-made-csv-file"]], "Filtering operations unique to count matrices": [[325, "filtering-operations-unique-to-count-matrices"]], "Normalizing count matrices": [[325, "normalizing-count-matrices"]], "Clustering of count matrices": [[325, "clustering-of-count-matrices"]], "Data visualization and exploratory data analysis of count matrices": [[325, "data-visualization-and-exploratory-data-analysis-of-count-matrices"]], "Sequentially applying functions using Pipelines": [[325, "sequentially-applying-functions-using-pipelines"]], "Applying Pipelines to tables": [[325, "applying-pipelines-to-tables"]], "RNAlysis Gene Sets module": [[325, "rnalysis-gene-sets-module"]], "Working with gene sets": [[325, "working-with-gene-sets"]], "Importing gene sets into RNAlysis": [[325, "importing-gene-sets-into-rnalysis"]], "Copying gene sets from RNAlysis": [[325, "copying-gene-sets-from-rnalysis"]], "Exporting gene sets from RNAlysis": [[325, "exporting-gene-sets-from-rnalysis"]], "Visualizing gene set and table intersections": [[325, "visualizing-gene-set-and-table-intersections"]], "Performing set operations on multiple tables and gene sets": [[325, "performing-set-operations-on-multiple-tables-and-gene-sets"]], "Performing single-set enrichment analysis (enrichment without a background set)": [[325, "performing-single-set-enrichment-analysis-enrichment-without-a-background-set"]], "RNAlysis interactive analysis reports": [[325, "rnalysis-interactive-analysis-reports"]], "Enable report generation": [[325, "enable-report-generation"]], "Generate an analysis report": [[325, "generate-an-analysis-report"]], "Viewing your analysis report": [[325, "viewing-your-analysis-report"]], "Open an analysis report": [[325, "open-an-analysis-report"]], "Interacting with the analysis report": [[325, "interacting-with-the-analysis-report"]], "Access the session output files": [[325, "access-the-session-output-files"]], "Sharing your analysis report": [[325, "sharing-your-analysis-report"]], "RNAlysis settings": [[325, "rnalysis-settings"]]}, "indexentries": {"attribute reference table": [[4, "term-Attribute-Reference-Table"]], "biotype reference table": [[4, "term-Biotype-Reference-Table"]], "countfilter": [[4, "term-CountFilter"]], "deseqfilter": [[4, "term-DESeqFilter"]], "featureset": [[4, "term-FeatureSet"]], "filter": [[4, "term-Filter"]], "filter object": [[4, "term-Filter-object"]], "filter objects": [[4, "term-Filter-objects"]], "foldchangefilter": [[4, "term-FoldChangeFilter"]], "pipeline": [[4, "term-Pipeline"]], "rankedset": [[4, "term-RankedSet"]], "module": [[11, "module-rnalysis.enrichment"], [78, "module-rnalysis.fastq"], [102, "module-rnalysis.filtering"], [312, "module-rnalysis.general"]], "rnalysis.enrichment": [[11, "module-rnalysis.enrichment"]], "featureset (class in rnalysis.enrichment)": [[12, "rnalysis.enrichment.FeatureSet"]], "__init__() (rnalysis.enrichment.featureset method)": [[12, "rnalysis.enrichment.FeatureSet.__init__"]], "add() (rnalysis.enrichment.featureset method)": [[13, "rnalysis.enrichment.FeatureSet.add"]], "biotypes_from_ref_table() (rnalysis.enrichment.featureset method)": [[14, "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table"]], "change_set_name() (rnalysis.enrichment.featureset method)": [[15, "rnalysis.enrichment.FeatureSet.change_set_name"]], "clear() (rnalysis.enrichment.featureset method)": [[16, "rnalysis.enrichment.FeatureSet.clear"]], "copy() (rnalysis.enrichment.featureset method)": [[17, "rnalysis.enrichment.FeatureSet.copy"]], "difference() (rnalysis.enrichment.featureset method)": [[18, "rnalysis.enrichment.FeatureSet.difference"]], "difference_update() (rnalysis.enrichment.featureset method)": [[19, "rnalysis.enrichment.FeatureSet.difference_update"]], "discard() (rnalysis.enrichment.featureset method)": [[20, "rnalysis.enrichment.FeatureSet.discard"]], "filter_by_attribute() (rnalysis.enrichment.featureset method)": [[21, "rnalysis.enrichment.FeatureSet.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.enrichment.featureset method)": [[22, "rnalysis.enrichment.FeatureSet.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.enrichment.featureset method)": [[23, "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations"]], "go_enrichment() (rnalysis.enrichment.featureset method)": [[24, "rnalysis.enrichment.FeatureSet.go_enrichment"]], "intersection() (rnalysis.enrichment.featureset method)": [[25, "rnalysis.enrichment.FeatureSet.intersection"]], "intersection_update() (rnalysis.enrichment.featureset method)": [[26, "rnalysis.enrichment.FeatureSet.intersection_update"]], "isdisjoint() (rnalysis.enrichment.featureset method)": [[27, "rnalysis.enrichment.FeatureSet.isdisjoint"]], "issubset() (rnalysis.enrichment.featureset method)": [[28, "rnalysis.enrichment.FeatureSet.issubset"]], "issuperset() (rnalysis.enrichment.featureset method)": [[29, "rnalysis.enrichment.FeatureSet.issuperset"]], "kegg_enrichment() (rnalysis.enrichment.featureset method)": [[30, "rnalysis.enrichment.FeatureSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.featureset method)": [[31, "rnalysis.enrichment.FeatureSet.non_categorical_enrichment"]], "pop() (rnalysis.enrichment.featureset method)": [[32, "rnalysis.enrichment.FeatureSet.pop"]], "remove() (rnalysis.enrichment.featureset method)": [[33, "rnalysis.enrichment.FeatureSet.remove"]], "save_txt() (rnalysis.enrichment.featureset method)": [[34, "rnalysis.enrichment.FeatureSet.save_txt"]], "symmetric_difference() (rnalysis.enrichment.featureset method)": [[35, "rnalysis.enrichment.FeatureSet.symmetric_difference"]], "symmetric_difference_update() (rnalysis.enrichment.featureset method)": [[36, "rnalysis.enrichment.FeatureSet.symmetric_difference_update"]], "translate_gene_ids() (rnalysis.enrichment.featureset method)": [[37, "rnalysis.enrichment.FeatureSet.translate_gene_ids"]], "union() (rnalysis.enrichment.featureset method)": [[38, "rnalysis.enrichment.FeatureSet.union"]], "update() (rnalysis.enrichment.featureset method)": [[39, "rnalysis.enrichment.FeatureSet.update"]], "user_defined_enrichment() (rnalysis.enrichment.featureset method)": [[40, "rnalysis.enrichment.FeatureSet.user_defined_enrichment"]], "rankedset (class in rnalysis.enrichment)": [[41, "rnalysis.enrichment.RankedSet"]], "__init__() (rnalysis.enrichment.rankedset method)": [[41, "rnalysis.enrichment.RankedSet.__init__"]], "add() (rnalysis.enrichment.rankedset method)": [[42, "rnalysis.enrichment.RankedSet.add"]], "biotypes_from_ref_table() (rnalysis.enrichment.rankedset method)": [[43, "rnalysis.enrichment.RankedSet.biotypes_from_ref_table"]], "change_set_name() (rnalysis.enrichment.rankedset method)": [[44, "rnalysis.enrichment.RankedSet.change_set_name"]], "clear() (rnalysis.enrichment.rankedset method)": [[45, "rnalysis.enrichment.RankedSet.clear"]], "copy() (rnalysis.enrichment.rankedset method)": [[46, "rnalysis.enrichment.RankedSet.copy"]], "difference() (rnalysis.enrichment.rankedset method)": [[47, "rnalysis.enrichment.RankedSet.difference"]], "difference_update() (rnalysis.enrichment.rankedset method)": [[48, "rnalysis.enrichment.RankedSet.difference_update"]], "discard() (rnalysis.enrichment.rankedset method)": [[49, "rnalysis.enrichment.RankedSet.discard"]], "filter_by_attribute() (rnalysis.enrichment.rankedset method)": [[50, "rnalysis.enrichment.RankedSet.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.enrichment.rankedset method)": [[51, "rnalysis.enrichment.RankedSet.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.enrichment.rankedset method)": [[52, "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations"]], "go_enrichment() (rnalysis.enrichment.rankedset method)": [[53, "rnalysis.enrichment.RankedSet.go_enrichment"]], "intersection() (rnalysis.enrichment.rankedset method)": [[54, "rnalysis.enrichment.RankedSet.intersection"]], "intersection_update() (rnalysis.enrichment.rankedset method)": [[55, "rnalysis.enrichment.RankedSet.intersection_update"]], "isdisjoint() (rnalysis.enrichment.rankedset method)": [[56, "rnalysis.enrichment.RankedSet.isdisjoint"]], "issubset() (rnalysis.enrichment.rankedset method)": [[57, "rnalysis.enrichment.RankedSet.issubset"]], "issuperset() (rnalysis.enrichment.rankedset method)": [[58, "rnalysis.enrichment.RankedSet.issuperset"]], "kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[59, "rnalysis.enrichment.RankedSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.rankedset method)": [[60, "rnalysis.enrichment.RankedSet.non_categorical_enrichment"]], "pop() (rnalysis.enrichment.rankedset method)": [[61, "rnalysis.enrichment.RankedSet.pop"]], "remove() (rnalysis.enrichment.rankedset method)": [[62, "rnalysis.enrichment.RankedSet.remove"]], "save_txt() (rnalysis.enrichment.rankedset method)": [[63, "rnalysis.enrichment.RankedSet.save_txt"]], "single_set_enrichment() (rnalysis.enrichment.rankedset method)": [[64, "rnalysis.enrichment.RankedSet.single_set_enrichment"]], "single_set_go_enrichment() (rnalysis.enrichment.rankedset method)": [[65, "rnalysis.enrichment.RankedSet.single_set_go_enrichment"]], "single_set_kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[66, "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment"]], "symmetric_difference() (rnalysis.enrichment.rankedset method)": [[67, "rnalysis.enrichment.RankedSet.symmetric_difference"]], "symmetric_difference_update() (rnalysis.enrichment.rankedset method)": [[68, "rnalysis.enrichment.RankedSet.symmetric_difference_update"]], "translate_gene_ids() (rnalysis.enrichment.rankedset method)": [[69, "rnalysis.enrichment.RankedSet.translate_gene_ids"]], "union() (rnalysis.enrichment.rankedset method)": [[70, "rnalysis.enrichment.RankedSet.union"]], "update() (rnalysis.enrichment.rankedset method)": [[71, "rnalysis.enrichment.RankedSet.update"]], "user_defined_enrichment() (rnalysis.enrichment.rankedset method)": [[72, "rnalysis.enrichment.RankedSet.user_defined_enrichment"]], "enrichment_bar_plot() (in module rnalysis.enrichment)": [[73, "rnalysis.enrichment.enrichment_bar_plot"]], "gene_ontology_graph() (in module rnalysis.enrichment)": [[74, "rnalysis.enrichment.gene_ontology_graph"]], "kegg_pathway_graph() (in module rnalysis.enrichment)": [[75, "rnalysis.enrichment.kegg_pathway_graph"]], "upset_plot() (in module rnalysis.enrichment)": [[76, "rnalysis.enrichment.upset_plot"]], "venn_diagram() (in module rnalysis.enrichment)": [[77, "rnalysis.enrichment.venn_diagram"]], "rnalysis.fastq": [[78, "module-rnalysis.fastq"]], "pairedendpipeline (class in rnalysis.fastq)": [[79, "rnalysis.fastq.PairedEndPipeline"]], "__init__() (rnalysis.fastq.pairedendpipeline method)": [[79, "rnalysis.fastq.PairedEndPipeline.__init__"]], "add_function() (rnalysis.fastq.pairedendpipeline method)": [[80, "rnalysis.fastq.PairedEndPipeline.add_function"]], "apply_to() (rnalysis.fastq.pairedendpipeline method)": [[81, "rnalysis.fastq.PairedEndPipeline.apply_to"]], "export_pipeline() (rnalysis.fastq.pairedendpipeline method)": [[82, "rnalysis.fastq.PairedEndPipeline.export_pipeline"]], "import_pipeline() (rnalysis.fastq.pairedendpipeline class method)": [[83, "rnalysis.fastq.PairedEndPipeline.import_pipeline"]], "remove_last_function() (rnalysis.fastq.pairedendpipeline method)": [[84, "rnalysis.fastq.PairedEndPipeline.remove_last_function"]], "singleendpipeline (class in rnalysis.fastq)": [[85, "rnalysis.fastq.SingleEndPipeline"]], "__init__() (rnalysis.fastq.singleendpipeline method)": [[85, "rnalysis.fastq.SingleEndPipeline.__init__"]], "add_function() (rnalysis.fastq.singleendpipeline method)": [[86, "rnalysis.fastq.SingleEndPipeline.add_function"]], "apply_to() (rnalysis.fastq.singleendpipeline method)": [[87, "rnalysis.fastq.SingleEndPipeline.apply_to"]], "export_pipeline() (rnalysis.fastq.singleendpipeline method)": [[88, "rnalysis.fastq.SingleEndPipeline.export_pipeline"]], "import_pipeline() (rnalysis.fastq.singleendpipeline class method)": [[89, "rnalysis.fastq.SingleEndPipeline.import_pipeline"]], "remove_last_function() (rnalysis.fastq.singleendpipeline method)": [[90, "rnalysis.fastq.SingleEndPipeline.remove_last_function"]], "bowtie2_align_paired_end() (in module rnalysis.fastq)": [[91, "rnalysis.fastq.bowtie2_align_paired_end"]], "bowtie2_align_single_end() (in module rnalysis.fastq)": [[92, "rnalysis.fastq.bowtie2_align_single_end"]], "bowtie2_create_index() (in module rnalysis.fastq)": [[93, "rnalysis.fastq.bowtie2_create_index"]], "featurecounts_paired_end() (in module rnalysis.fastq)": [[94, "rnalysis.fastq.featurecounts_paired_end"]], "featurecounts_single_end() (in module rnalysis.fastq)": [[95, "rnalysis.fastq.featurecounts_single_end"]], "kallisto_create_index() (in module rnalysis.fastq)": [[96, "rnalysis.fastq.kallisto_create_index"]], "kallisto_quantify_paired_end() (in module rnalysis.fastq)": [[97, "rnalysis.fastq.kallisto_quantify_paired_end"]], "kallisto_quantify_single_end() (in module rnalysis.fastq)": [[98, "rnalysis.fastq.kallisto_quantify_single_end"]], "shortstack_align_smallrna() (in module rnalysis.fastq)": [[99, "rnalysis.fastq.shortstack_align_smallrna"]], "trim_adapters_paired_end() (in module rnalysis.fastq)": [[100, "rnalysis.fastq.trim_adapters_paired_end"]], "trim_adapters_single_end() (in module rnalysis.fastq)": [[101, "rnalysis.fastq.trim_adapters_single_end"]], "rnalysis.filtering": [[102, "module-rnalysis.filtering"]], "countfilter (class in rnalysis.filtering)": [[103, "rnalysis.filtering.CountFilter"]], "__init__() (rnalysis.filtering.countfilter method)": [[103, "rnalysis.filtering.CountFilter.__init__"]], "average_replicate_samples() (rnalysis.filtering.countfilter method)": [[104, "rnalysis.filtering.CountFilter.average_replicate_samples"]], "biotypes_from_gtf() (rnalysis.filtering.countfilter method)": [[105, "rnalysis.filtering.CountFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.countfilter method)": [[106, "rnalysis.filtering.CountFilter.biotypes_from_ref_table"]], "box_plot() (rnalysis.filtering.countfilter method)": [[107, "rnalysis.filtering.CountFilter.box_plot"]], "clustergram() (rnalysis.filtering.countfilter method)": [[108, "rnalysis.filtering.CountFilter.clustergram"]], "describe() (rnalysis.filtering.countfilter method)": [[109, "rnalysis.filtering.CountFilter.describe"]], "difference() (rnalysis.filtering.countfilter method)": [[110, "rnalysis.filtering.CountFilter.difference"]], "differential_expression_deseq2() (rnalysis.filtering.countfilter method)": [[111, "rnalysis.filtering.CountFilter.differential_expression_deseq2"]], "differential_expression_limma_voom() (rnalysis.filtering.countfilter method)": [[112, "rnalysis.filtering.CountFilter.differential_expression_limma_voom"]], "drop_columns() (rnalysis.filtering.countfilter method)": [[113, "rnalysis.filtering.CountFilter.drop_columns"]], "enhanced_box_plot() (rnalysis.filtering.countfilter method)": [[114, "rnalysis.filtering.CountFilter.enhanced_box_plot"]], "filter_biotype_from_gtf() (rnalysis.filtering.countfilter method)": [[115, "rnalysis.filtering.CountFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.countfilter method)": [[116, "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.countfilter method)": [[117, "rnalysis.filtering.CountFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.countfilter method)": [[118, "rnalysis.filtering.CountFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.countfilter method)": [[119, "rnalysis.filtering.CountFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.countfilter method)": [[120, "rnalysis.filtering.CountFilter.filter_by_row_name"]], "filter_by_row_sum() (rnalysis.filtering.countfilter method)": [[121, "rnalysis.filtering.CountFilter.filter_by_row_sum"]], "filter_duplicate_ids() (rnalysis.filtering.countfilter method)": [[122, "rnalysis.filtering.CountFilter.filter_duplicate_ids"]], "filter_low_reads() (rnalysis.filtering.countfilter method)": [[123, "rnalysis.filtering.CountFilter.filter_low_reads"]], "filter_missing_values() (rnalysis.filtering.countfilter method)": [[124, "rnalysis.filtering.CountFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.countfilter method)": [[125, "rnalysis.filtering.CountFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.countfilter method)": [[126, "rnalysis.filtering.CountFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.countfilter method)": [[127, "rnalysis.filtering.CountFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.countfilter method)": [[128, "rnalysis.filtering.CountFilter.find_paralogs_panther"]], "fold_change() (rnalysis.filtering.countfilter method)": [[129, "rnalysis.filtering.CountFilter.fold_change"]], "from_dataframe() (rnalysis.filtering.countfilter class method)": [[130, "rnalysis.filtering.CountFilter.from_dataframe"]], "from_folder() (rnalysis.filtering.countfilter class method)": [[131, "rnalysis.filtering.CountFilter.from_folder"]], "from_folder_htseqcount() (rnalysis.filtering.countfilter class method)": [[132, "rnalysis.filtering.CountFilter.from_folder_htseqcount"]], "head() (rnalysis.filtering.countfilter method)": [[133, "rnalysis.filtering.CountFilter.head"]], "intersection() (rnalysis.filtering.countfilter method)": [[134, "rnalysis.filtering.CountFilter.intersection"]], "ma_plot() (rnalysis.filtering.countfilter method)": [[135, "rnalysis.filtering.CountFilter.ma_plot"]], "majority_vote_intersection() (rnalysis.filtering.countfilter method)": [[136, "rnalysis.filtering.CountFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.countfilter method)": [[137, "rnalysis.filtering.CountFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.countfilter method)": [[138, "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.countfilter method)": [[139, "rnalysis.filtering.CountFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.countfilter method)": [[140, "rnalysis.filtering.CountFilter.map_orthologs_phylomedb"]], "normalize_median_of_ratios() (rnalysis.filtering.countfilter method)": [[141, "rnalysis.filtering.CountFilter.normalize_median_of_ratios"]], "normalize_rle() (rnalysis.filtering.countfilter method)": [[142, "rnalysis.filtering.CountFilter.normalize_rle"]], "normalize_tmm() (rnalysis.filtering.countfilter method)": [[143, "rnalysis.filtering.CountFilter.normalize_tmm"]], "normalize_to_quantile() (rnalysis.filtering.countfilter method)": [[144, "rnalysis.filtering.CountFilter.normalize_to_quantile"]], "normalize_to_rpkm() (rnalysis.filtering.countfilter method)": [[145, "rnalysis.filtering.CountFilter.normalize_to_rpkm"]], "normalize_to_rpm() (rnalysis.filtering.countfilter method)": [[146, "rnalysis.filtering.CountFilter.normalize_to_rpm"]], "normalize_to_rpm_htseqcount() (rnalysis.filtering.countfilter method)": [[147, "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount"]], "normalize_to_tpm() (rnalysis.filtering.countfilter method)": [[148, "rnalysis.filtering.CountFilter.normalize_to_tpm"]], "normalize_with_scaling_factors() (rnalysis.filtering.countfilter method)": [[149, "rnalysis.filtering.CountFilter.normalize_with_scaling_factors"]], "number_filters() (rnalysis.filtering.countfilter method)": [[150, "rnalysis.filtering.CountFilter.number_filters"]], "pairplot() (rnalysis.filtering.countfilter method)": [[151, "rnalysis.filtering.CountFilter.pairplot"]], "pca() (rnalysis.filtering.countfilter method)": [[152, "rnalysis.filtering.CountFilter.pca"]], "plot_expression() (rnalysis.filtering.countfilter method)": [[153, "rnalysis.filtering.CountFilter.plot_expression"]], "print_features() (rnalysis.filtering.countfilter method)": [[154, "rnalysis.filtering.CountFilter.print_features"]], "save_csv() (rnalysis.filtering.countfilter method)": [[155, "rnalysis.filtering.CountFilter.save_csv"]], "save_parquet() (rnalysis.filtering.countfilter method)": [[156, "rnalysis.filtering.CountFilter.save_parquet"]], "save_table() (rnalysis.filtering.countfilter method)": [[157, "rnalysis.filtering.CountFilter.save_table"]], "scatter_sample_vs_sample() (rnalysis.filtering.countfilter method)": [[158, "rnalysis.filtering.CountFilter.scatter_sample_vs_sample"]], "sort() (rnalysis.filtering.countfilter method)": [[159, "rnalysis.filtering.CountFilter.sort"]], "sort_by_principal_component() (rnalysis.filtering.countfilter method)": [[160, "rnalysis.filtering.CountFilter.sort_by_principal_component"]], "split_by_attribute() (rnalysis.filtering.countfilter method)": [[161, "rnalysis.filtering.CountFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.countfilter method)": [[162, "rnalysis.filtering.CountFilter.split_by_percentile"]], "split_by_principal_components() (rnalysis.filtering.countfilter method)": [[163, "rnalysis.filtering.CountFilter.split_by_principal_components"]], "split_by_reads() (rnalysis.filtering.countfilter method)": [[164, "rnalysis.filtering.CountFilter.split_by_reads"]], "split_clicom() (rnalysis.filtering.countfilter method)": [[165, "rnalysis.filtering.CountFilter.split_clicom"]], "split_hdbscan() (rnalysis.filtering.countfilter method)": [[166, "rnalysis.filtering.CountFilter.split_hdbscan"]], "split_hierarchical() (rnalysis.filtering.countfilter method)": [[167, "rnalysis.filtering.CountFilter.split_hierarchical"]], "split_kmeans() (rnalysis.filtering.countfilter method)": [[168, "rnalysis.filtering.CountFilter.split_kmeans"]], "split_kmedoids() (rnalysis.filtering.countfilter method)": [[169, "rnalysis.filtering.CountFilter.split_kmedoids"]], "symmetric_difference() (rnalysis.filtering.countfilter method)": [[170, "rnalysis.filtering.CountFilter.symmetric_difference"]], "tail() (rnalysis.filtering.countfilter method)": [[171, "rnalysis.filtering.CountFilter.tail"]], "text_filters() (rnalysis.filtering.countfilter method)": [[172, "rnalysis.filtering.CountFilter.text_filters"]], "transform() (rnalysis.filtering.countfilter method)": [[173, "rnalysis.filtering.CountFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.countfilter method)": [[174, "rnalysis.filtering.CountFilter.translate_gene_ids"]], "union() (rnalysis.filtering.countfilter method)": [[175, "rnalysis.filtering.CountFilter.union"]], "violin_plot() (rnalysis.filtering.countfilter method)": [[176, "rnalysis.filtering.CountFilter.violin_plot"]], "deseqfilter (class in rnalysis.filtering)": [[177, "rnalysis.filtering.DESeqFilter"]], "__init__() (rnalysis.filtering.deseqfilter method)": [[177, "rnalysis.filtering.DESeqFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.deseqfilter method)": [[178, "rnalysis.filtering.DESeqFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[179, "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.deseqfilter method)": [[180, "rnalysis.filtering.DESeqFilter.describe"]], "difference() (rnalysis.filtering.deseqfilter method)": [[181, "rnalysis.filtering.DESeqFilter.difference"]], "drop_columns() (rnalysis.filtering.deseqfilter method)": [[182, "rnalysis.filtering.DESeqFilter.drop_columns"]], "filter_abs_log2_fold_change() (rnalysis.filtering.deseqfilter method)": [[183, "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.deseqfilter method)": [[184, "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[185, "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.deseqfilter method)": [[186, "rnalysis.filtering.DESeqFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.deseqfilter method)": [[187, "rnalysis.filtering.DESeqFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.deseqfilter method)": [[188, "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.deseqfilter method)": [[189, "rnalysis.filtering.DESeqFilter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.deseqfilter method)": [[190, "rnalysis.filtering.DESeqFilter.filter_duplicate_ids"]], "filter_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[191, "rnalysis.filtering.DESeqFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.deseqfilter method)": [[192, "rnalysis.filtering.DESeqFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.deseqfilter method)": [[193, "rnalysis.filtering.DESeqFilter.filter_percentile"]], "filter_significant() (rnalysis.filtering.deseqfilter method)": [[194, "rnalysis.filtering.DESeqFilter.filter_significant"]], "filter_top_n() (rnalysis.filtering.deseqfilter method)": [[195, "rnalysis.filtering.DESeqFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.deseqfilter method)": [[196, "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.deseqfilter method)": [[197, "rnalysis.filtering.DESeqFilter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.deseqfilter class method)": [[198, "rnalysis.filtering.DESeqFilter.from_dataframe"]], "head() (rnalysis.filtering.deseqfilter method)": [[199, "rnalysis.filtering.DESeqFilter.head"]], "intersection() (rnalysis.filtering.deseqfilter method)": [[200, "rnalysis.filtering.DESeqFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.deseqfilter method)": [[201, "rnalysis.filtering.DESeqFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.deseqfilter method)": [[202, "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.deseqfilter method)": [[203, "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.deseqfilter method)": [[204, "rnalysis.filtering.DESeqFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.deseqfilter method)": [[205, "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.deseqfilter method)": [[206, "rnalysis.filtering.DESeqFilter.number_filters"]], "print_features() (rnalysis.filtering.deseqfilter method)": [[207, "rnalysis.filtering.DESeqFilter.print_features"]], "save_csv() (rnalysis.filtering.deseqfilter method)": [[208, "rnalysis.filtering.DESeqFilter.save_csv"]], "save_parquet() (rnalysis.filtering.deseqfilter method)": [[209, "rnalysis.filtering.DESeqFilter.save_parquet"]], "save_table() (rnalysis.filtering.deseqfilter method)": [[210, "rnalysis.filtering.DESeqFilter.save_table"]], "sort() (rnalysis.filtering.deseqfilter method)": [[211, "rnalysis.filtering.DESeqFilter.sort"]], "split_by_attribute() (rnalysis.filtering.deseqfilter method)": [[212, "rnalysis.filtering.DESeqFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.deseqfilter method)": [[213, "rnalysis.filtering.DESeqFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[214, "rnalysis.filtering.DESeqFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.deseqfilter method)": [[215, "rnalysis.filtering.DESeqFilter.symmetric_difference"]], "tail() (rnalysis.filtering.deseqfilter method)": [[216, "rnalysis.filtering.DESeqFilter.tail"]], "text_filters() (rnalysis.filtering.deseqfilter method)": [[217, "rnalysis.filtering.DESeqFilter.text_filters"]], "transform() (rnalysis.filtering.deseqfilter method)": [[218, "rnalysis.filtering.DESeqFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.deseqfilter method)": [[219, "rnalysis.filtering.DESeqFilter.translate_gene_ids"]], "union() (rnalysis.filtering.deseqfilter method)": [[220, "rnalysis.filtering.DESeqFilter.union"]], "volcano_plot() (rnalysis.filtering.deseqfilter method)": [[221, "rnalysis.filtering.DESeqFilter.volcano_plot"]], "filter (class in rnalysis.filtering)": [[222, "rnalysis.filtering.Filter"]], "__init__() (rnalysis.filtering.filter method)": [[222, "rnalysis.filtering.Filter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.filter method)": [[223, "rnalysis.filtering.Filter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.filter method)": [[224, "rnalysis.filtering.Filter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.filter method)": [[225, "rnalysis.filtering.Filter.describe"]], "difference() (rnalysis.filtering.filter method)": [[226, "rnalysis.filtering.Filter.difference"]], "drop_columns() (rnalysis.filtering.filter method)": [[227, "rnalysis.filtering.Filter.drop_columns"]], "filter_biotype_from_gtf() (rnalysis.filtering.filter method)": [[228, "rnalysis.filtering.Filter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.filter method)": [[229, "rnalysis.filtering.Filter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.filter method)": [[230, "rnalysis.filtering.Filter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.filter method)": [[231, "rnalysis.filtering.Filter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.filter method)": [[232, "rnalysis.filtering.Filter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.filter method)": [[233, "rnalysis.filtering.Filter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.filter method)": [[234, "rnalysis.filtering.Filter.filter_duplicate_ids"]], "filter_missing_values() (rnalysis.filtering.filter method)": [[235, "rnalysis.filtering.Filter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.filter method)": [[236, "rnalysis.filtering.Filter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.filter method)": [[237, "rnalysis.filtering.Filter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.filter method)": [[238, "rnalysis.filtering.Filter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.filter method)": [[239, "rnalysis.filtering.Filter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.filter class method)": [[240, "rnalysis.filtering.Filter.from_dataframe"]], "head() (rnalysis.filtering.filter method)": [[241, "rnalysis.filtering.Filter.head"]], "intersection() (rnalysis.filtering.filter method)": [[242, "rnalysis.filtering.Filter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.filter method)": [[243, "rnalysis.filtering.Filter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.filter method)": [[244, "rnalysis.filtering.Filter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.filter method)": [[245, "rnalysis.filtering.Filter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.filter method)": [[246, "rnalysis.filtering.Filter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.filter method)": [[247, "rnalysis.filtering.Filter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.filter method)": [[248, "rnalysis.filtering.Filter.number_filters"]], "print_features() (rnalysis.filtering.filter method)": [[249, "rnalysis.filtering.Filter.print_features"]], "save_csv() (rnalysis.filtering.filter method)": [[250, "rnalysis.filtering.Filter.save_csv"]], "save_parquet() (rnalysis.filtering.filter method)": [[251, "rnalysis.filtering.Filter.save_parquet"]], "save_table() (rnalysis.filtering.filter method)": [[252, "rnalysis.filtering.Filter.save_table"]], "sort() (rnalysis.filtering.filter method)": [[253, "rnalysis.filtering.Filter.sort"]], "split_by_attribute() (rnalysis.filtering.filter method)": [[254, "rnalysis.filtering.Filter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.filter method)": [[255, "rnalysis.filtering.Filter.split_by_percentile"]], "symmetric_difference() (rnalysis.filtering.filter method)": [[256, "rnalysis.filtering.Filter.symmetric_difference"]], "tail() (rnalysis.filtering.filter method)": [[257, "rnalysis.filtering.Filter.tail"]], "text_filters() (rnalysis.filtering.filter method)": [[258, "rnalysis.filtering.Filter.text_filters"]], "transform() (rnalysis.filtering.filter method)": [[259, "rnalysis.filtering.Filter.transform"]], "translate_gene_ids() (rnalysis.filtering.filter method)": [[260, "rnalysis.filtering.Filter.translate_gene_ids"]], "union() (rnalysis.filtering.filter method)": [[261, "rnalysis.filtering.Filter.union"]], "foldchangefilter (class in rnalysis.filtering)": [[262, "rnalysis.filtering.FoldChangeFilter"]], "__init__() (rnalysis.filtering.foldchangefilter method)": [[262, "rnalysis.filtering.FoldChangeFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[263, "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[264, "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.foldchangefilter method)": [[265, "rnalysis.filtering.FoldChangeFilter.describe"]], "difference() (rnalysis.filtering.foldchangefilter method)": [[266, "rnalysis.filtering.FoldChangeFilter.difference"]], "drop_columns() (rnalysis.filtering.foldchangefilter method)": [[267, "rnalysis.filtering.FoldChangeFilter.drop_columns"]], "filter_abs_log2_fold_change() (rnalysis.filtering.foldchangefilter method)": [[268, "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[269, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[270, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[271, "rnalysis.filtering.FoldChangeFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.foldchangefilter method)": [[272, "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.foldchangefilter method)": [[273, "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.foldchangefilter method)": [[274, "rnalysis.filtering.FoldChangeFilter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.foldchangefilter method)": [[275, "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids"]], "filter_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[276, "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.foldchangefilter method)": [[277, "rnalysis.filtering.FoldChangeFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.foldchangefilter method)": [[278, "rnalysis.filtering.FoldChangeFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.foldchangefilter method)": [[279, "rnalysis.filtering.FoldChangeFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.foldchangefilter method)": [[280, "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.foldchangefilter method)": [[281, "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.foldchangefilter class method)": [[282, "rnalysis.filtering.FoldChangeFilter.from_dataframe"]], "head() (rnalysis.filtering.foldchangefilter method)": [[283, "rnalysis.filtering.FoldChangeFilter.head"]], "intersection() (rnalysis.filtering.foldchangefilter method)": [[284, "rnalysis.filtering.FoldChangeFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.foldchangefilter method)": [[285, "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.foldchangefilter method)": [[286, "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.foldchangefilter method)": [[287, "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.foldchangefilter method)": [[288, "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.foldchangefilter method)": [[289, "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.foldchangefilter method)": [[290, "rnalysis.filtering.FoldChangeFilter.number_filters"]], "print_features() (rnalysis.filtering.foldchangefilter method)": [[291, "rnalysis.filtering.FoldChangeFilter.print_features"]], "randomization_test() (rnalysis.filtering.foldchangefilter method)": [[292, "rnalysis.filtering.FoldChangeFilter.randomization_test"]], "save_csv() (rnalysis.filtering.foldchangefilter method)": [[293, "rnalysis.filtering.FoldChangeFilter.save_csv"]], "save_parquet() (rnalysis.filtering.foldchangefilter method)": [[294, "rnalysis.filtering.FoldChangeFilter.save_parquet"]], "save_table() (rnalysis.filtering.foldchangefilter method)": [[295, "rnalysis.filtering.FoldChangeFilter.save_table"]], "sort() (rnalysis.filtering.foldchangefilter method)": [[296, "rnalysis.filtering.FoldChangeFilter.sort"]], "split_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[297, "rnalysis.filtering.FoldChangeFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.foldchangefilter method)": [[298, "rnalysis.filtering.FoldChangeFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[299, "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.foldchangefilter method)": [[300, "rnalysis.filtering.FoldChangeFilter.symmetric_difference"]], "tail() (rnalysis.filtering.foldchangefilter method)": [[301, "rnalysis.filtering.FoldChangeFilter.tail"]], "text_filters() (rnalysis.filtering.foldchangefilter method)": [[302, "rnalysis.filtering.FoldChangeFilter.text_filters"]], "transform() (rnalysis.filtering.foldchangefilter method)": [[303, "rnalysis.filtering.FoldChangeFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.foldchangefilter method)": [[304, "rnalysis.filtering.FoldChangeFilter.translate_gene_ids"]], "union() (rnalysis.filtering.foldchangefilter method)": [[305, "rnalysis.filtering.FoldChangeFilter.union"]], "pipeline (class in rnalysis.filtering)": [[306, "rnalysis.filtering.Pipeline"]], "__init__() (rnalysis.filtering.pipeline method)": [[306, "rnalysis.filtering.Pipeline.__init__"]], "add_function() (rnalysis.filtering.pipeline method)": [[307, "rnalysis.filtering.Pipeline.add_function"]], "apply_to() (rnalysis.filtering.pipeline method)": [[308, "rnalysis.filtering.Pipeline.apply_to"]], "export_pipeline() (rnalysis.filtering.pipeline method)": [[309, "rnalysis.filtering.Pipeline.export_pipeline"]], "import_pipeline() (rnalysis.filtering.pipeline class method)": [[310, "rnalysis.filtering.Pipeline.import_pipeline"]], "remove_last_function() (rnalysis.filtering.pipeline method)": [[311, "rnalysis.filtering.Pipeline.remove_last_function"]], "rnalysis.general": [[312, "module-rnalysis.general"]], "clear_all_cache() (in module rnalysis.general)": [[313, "rnalysis.general.clear_all_cache"]], "clear_gui_cache() (in module rnalysis.general)": [[314, "rnalysis.general.clear_gui_cache"]], "parse_gene_name_string() (in module rnalysis.general)": [[315, "rnalysis.general.parse_gene_name_string"]], "parse_sequence_name_string() (in module rnalysis.general)": [[316, "rnalysis.general.parse_sequence_name_string"]], "parse_wbgene_string() (in module rnalysis.general)": [[317, "rnalysis.general.parse_wbgene_string"]], "print_settings_file() (in module rnalysis.general)": [[318, "rnalysis.general.print_settings_file"]], "reset_settings_file() (in module rnalysis.general)": [[319, "rnalysis.general.reset_settings_file"]], "save_to_csv() (in module rnalysis.general)": [[320, "rnalysis.general.save_to_csv"]], "set_attr_ref_table_path() (in module rnalysis.general)": [[321, "rnalysis.general.set_attr_ref_table_path"]], "set_biotype_ref_table_path() (in module rnalysis.general)": [[322, "rnalysis.general.set_biotype_ref_table_path"]]}})
\ No newline at end of file
+Search.setIndex({"docnames": ["api_reference", "contributing", "faq", "genindex", "glossary", "history", "index", "installation", "quick_start", "readme", "rnalysis", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.add", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.clear", "rnalysis.enrichment.FeatureSet.copy", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.difference_update", "rnalysis.enrichment.FeatureSet.discard", "rnalysis.enrichment.FeatureSet.filter_by_attribute", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.intersection_update", "rnalysis.enrichment.FeatureSet.isdisjoint", "rnalysis.enrichment.FeatureSet.issubset", "rnalysis.enrichment.FeatureSet.issuperset", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.pop", "rnalysis.enrichment.FeatureSet.remove", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.symmetric_difference_update", "rnalysis.enrichment.FeatureSet.translate_gene_ids", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.update", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.add", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.clear", "rnalysis.enrichment.RankedSet.copy", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.difference_update", "rnalysis.enrichment.RankedSet.discard", "rnalysis.enrichment.RankedSet.filter_by_attribute", "rnalysis.enrichment.RankedSet.filter_by_go_annotations", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.intersection_update", "rnalysis.enrichment.RankedSet.isdisjoint", "rnalysis.enrichment.RankedSet.issubset", "rnalysis.enrichment.RankedSet.issuperset", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.pop", "rnalysis.enrichment.RankedSet.remove", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.symmetric_difference_update", "rnalysis.enrichment.RankedSet.translate_gene_ids", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.update", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.enrichment_bar_plot", "rnalysis.enrichment.gene_ontology_graph", "rnalysis.enrichment.kegg_pathway_graph", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.fastq", "rnalysis.fastq.PairedEndPipeline", "rnalysis.fastq.PairedEndPipeline.add_function", "rnalysis.fastq.PairedEndPipeline.apply_to", "rnalysis.fastq.PairedEndPipeline.export_pipeline", "rnalysis.fastq.PairedEndPipeline.import_pipeline", "rnalysis.fastq.PairedEndPipeline.remove_last_function", "rnalysis.fastq.SingleEndPipeline", "rnalysis.fastq.SingleEndPipeline.add_function", "rnalysis.fastq.SingleEndPipeline.apply_to", "rnalysis.fastq.SingleEndPipeline.export_pipeline", "rnalysis.fastq.SingleEndPipeline.import_pipeline", "rnalysis.fastq.SingleEndPipeline.remove_last_function", "rnalysis.fastq.bowtie2_align_paired_end", "rnalysis.fastq.bowtie2_align_single_end", "rnalysis.fastq.bowtie2_create_index", "rnalysis.fastq.featurecounts_paired_end", "rnalysis.fastq.featurecounts_single_end", "rnalysis.fastq.kallisto_create_index", "rnalysis.fastq.kallisto_quantify_paired_end", "rnalysis.fastq.kallisto_quantify_single_end", "rnalysis.fastq.shortstack_align_smallrna", "rnalysis.fastq.trim_adapters_paired_end", "rnalysis.fastq.trim_adapters_single_end", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.differential_expression_limma_voom", "rnalysis.filtering.CountFilter.drop_columns", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_name", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_duplicate_ids", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.find_paralogs_ensembl", "rnalysis.filtering.CountFilter.find_paralogs_panther", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.from_folder_htseqcount", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.map_orthologs_ensembl", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector", "rnalysis.filtering.CountFilter.map_orthologs_panther", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpkm", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_to_tpm", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.save_parquet", "rnalysis.filtering.CountFilter.save_table", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.sort_by_principal_component", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_principal_components", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.drop_columns", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_by_row_name", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl", "rnalysis.filtering.DESeqFilter.find_paralogs_panther", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector", "rnalysis.filtering.DESeqFilter.map_orthologs_panther", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.save_parquet", "rnalysis.filtering.DESeqFilter.save_table", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.drop_columns", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_by_row_name", "rnalysis.filtering.Filter.filter_duplicate_ids", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.find_paralogs_ensembl", "rnalysis.filtering.Filter.find_paralogs_panther", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.map_orthologs_ensembl", "rnalysis.filtering.Filter.map_orthologs_orthoinspector", "rnalysis.filtering.Filter.map_orthologs_panther", "rnalysis.filtering.Filter.map_orthologs_phylomedb", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.save_parquet", "rnalysis.filtering.Filter.save_table", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.drop_columns", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.save_parquet", "rnalysis.filtering.FoldChangeFilter.save_table", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.general", "rnalysis.general.clear_all_cache", "rnalysis.general.clear_gui_cache", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "tutorial", "user_guide", "user_guide_gui"], "filenames": ["api_reference.rst", "contributing.rst", "faq.rst", "genindex.rst", "glossary.rst", "history.rst", "index.rst", "installation.rst", "quick_start.rst", "readme.rst", "rnalysis.rst", "rnalysis.enrichment.rst", "rnalysis.enrichment.FeatureSet.rst", "rnalysis.enrichment.FeatureSet.add.rst", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table.rst", "rnalysis.enrichment.FeatureSet.change_set_name.rst", "rnalysis.enrichment.FeatureSet.clear.rst", "rnalysis.enrichment.FeatureSet.copy.rst", "rnalysis.enrichment.FeatureSet.difference.rst", "rnalysis.enrichment.FeatureSet.difference_update.rst", "rnalysis.enrichment.FeatureSet.discard.rst", "rnalysis.enrichment.FeatureSet.filter_by_attribute.rst", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations.rst", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations.rst", "rnalysis.enrichment.FeatureSet.go_enrichment.rst", "rnalysis.enrichment.FeatureSet.intersection.rst", "rnalysis.enrichment.FeatureSet.intersection_update.rst", "rnalysis.enrichment.FeatureSet.isdisjoint.rst", "rnalysis.enrichment.FeatureSet.issubset.rst", "rnalysis.enrichment.FeatureSet.issuperset.rst", "rnalysis.enrichment.FeatureSet.kegg_enrichment.rst", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment.rst", "rnalysis.enrichment.FeatureSet.pop.rst", "rnalysis.enrichment.FeatureSet.remove.rst", "rnalysis.enrichment.FeatureSet.save_txt.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference_update.rst", "rnalysis.enrichment.FeatureSet.translate_gene_ids.rst", "rnalysis.enrichment.FeatureSet.union.rst", "rnalysis.enrichment.FeatureSet.update.rst", "rnalysis.enrichment.FeatureSet.user_defined_enrichment.rst", "rnalysis.enrichment.RankedSet.rst", "rnalysis.enrichment.RankedSet.add.rst", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table.rst", "rnalysis.enrichment.RankedSet.change_set_name.rst", "rnalysis.enrichment.RankedSet.clear.rst", "rnalysis.enrichment.RankedSet.copy.rst", "rnalysis.enrichment.RankedSet.difference.rst", "rnalysis.enrichment.RankedSet.difference_update.rst", "rnalysis.enrichment.RankedSet.discard.rst", "rnalysis.enrichment.RankedSet.filter_by_attribute.rst", "rnalysis.enrichment.RankedSet.filter_by_go_annotations.rst", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations.rst", "rnalysis.enrichment.RankedSet.go_enrichment.rst", "rnalysis.enrichment.RankedSet.intersection.rst", "rnalysis.enrichment.RankedSet.intersection_update.rst", "rnalysis.enrichment.RankedSet.isdisjoint.rst", "rnalysis.enrichment.RankedSet.issubset.rst", "rnalysis.enrichment.RankedSet.issuperset.rst", "rnalysis.enrichment.RankedSet.kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.non_categorical_enrichment.rst", "rnalysis.enrichment.RankedSet.pop.rst", "rnalysis.enrichment.RankedSet.remove.rst", "rnalysis.enrichment.RankedSet.save_txt.rst", "rnalysis.enrichment.RankedSet.single_set_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_go_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.symmetric_difference.rst", "rnalysis.enrichment.RankedSet.symmetric_difference_update.rst", "rnalysis.enrichment.RankedSet.translate_gene_ids.rst", "rnalysis.enrichment.RankedSet.union.rst", "rnalysis.enrichment.RankedSet.update.rst", "rnalysis.enrichment.RankedSet.user_defined_enrichment.rst", "rnalysis.enrichment.enrichment_bar_plot.rst", "rnalysis.enrichment.gene_ontology_graph.rst", "rnalysis.enrichment.kegg_pathway_graph.rst", "rnalysis.enrichment.upset_plot.rst", "rnalysis.enrichment.venn_diagram.rst", "rnalysis.fastq.rst", "rnalysis.fastq.PairedEndPipeline.rst", "rnalysis.fastq.PairedEndPipeline.add_function.rst", "rnalysis.fastq.PairedEndPipeline.apply_to.rst", "rnalysis.fastq.PairedEndPipeline.export_pipeline.rst", "rnalysis.fastq.PairedEndPipeline.import_pipeline.rst", "rnalysis.fastq.PairedEndPipeline.remove_last_function.rst", "rnalysis.fastq.SingleEndPipeline.rst", "rnalysis.fastq.SingleEndPipeline.add_function.rst", "rnalysis.fastq.SingleEndPipeline.apply_to.rst", "rnalysis.fastq.SingleEndPipeline.export_pipeline.rst", "rnalysis.fastq.SingleEndPipeline.import_pipeline.rst", "rnalysis.fastq.SingleEndPipeline.remove_last_function.rst", "rnalysis.fastq.bowtie2_align_paired_end.rst", "rnalysis.fastq.bowtie2_align_single_end.rst", "rnalysis.fastq.bowtie2_create_index.rst", "rnalysis.fastq.featurecounts_paired_end.rst", "rnalysis.fastq.featurecounts_single_end.rst", "rnalysis.fastq.kallisto_create_index.rst", "rnalysis.fastq.kallisto_quantify_paired_end.rst", "rnalysis.fastq.kallisto_quantify_single_end.rst", "rnalysis.fastq.shortstack_align_smallrna.rst", "rnalysis.fastq.trim_adapters_paired_end.rst", "rnalysis.fastq.trim_adapters_single_end.rst", "rnalysis.filtering.rst", "rnalysis.filtering.CountFilter.rst", "rnalysis.filtering.CountFilter.average_replicate_samples.rst", "rnalysis.filtering.CountFilter.biotypes_from_gtf.rst", "rnalysis.filtering.CountFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.CountFilter.box_plot.rst", "rnalysis.filtering.CountFilter.clustergram.rst", "rnalysis.filtering.CountFilter.describe.rst", "rnalysis.filtering.CountFilter.difference.rst", "rnalysis.filtering.CountFilter.differential_expression_deseq2.rst", "rnalysis.filtering.CountFilter.differential_expression_limma_voom.rst", "rnalysis.filtering.CountFilter.drop_columns.rst", "rnalysis.filtering.CountFilter.enhanced_box_plot.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.CountFilter.filter_by_attribute.rst", "rnalysis.filtering.CountFilter.filter_by_go_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_row_name.rst", "rnalysis.filtering.CountFilter.filter_by_row_sum.rst", "rnalysis.filtering.CountFilter.filter_duplicate_ids.rst", "rnalysis.filtering.CountFilter.filter_low_reads.rst", "rnalysis.filtering.CountFilter.filter_missing_values.rst", "rnalysis.filtering.CountFilter.filter_percentile.rst", "rnalysis.filtering.CountFilter.filter_top_n.rst", "rnalysis.filtering.CountFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.CountFilter.find_paralogs_panther.rst", "rnalysis.filtering.CountFilter.fold_change.rst", "rnalysis.filtering.CountFilter.from_dataframe.rst", "rnalysis.filtering.CountFilter.from_folder.rst", "rnalysis.filtering.CountFilter.from_folder_htseqcount.rst", "rnalysis.filtering.CountFilter.head.rst", "rnalysis.filtering.CountFilter.intersection.rst", "rnalysis.filtering.CountFilter.ma_plot.rst", "rnalysis.filtering.CountFilter.majority_vote_intersection.rst", "rnalysis.filtering.CountFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.CountFilter.map_orthologs_panther.rst", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.CountFilter.normalize_median_of_ratios.rst", "rnalysis.filtering.CountFilter.normalize_rle.rst", "rnalysis.filtering.CountFilter.normalize_tmm.rst", "rnalysis.filtering.CountFilter.normalize_to_quantile.rst", "rnalysis.filtering.CountFilter.normalize_to_rpkm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.rst", "rnalysis.filtering.CountFilter.normalize_to_tpm.rst", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors.rst", "rnalysis.filtering.CountFilter.number_filters.rst", "rnalysis.filtering.CountFilter.pairplot.rst", "rnalysis.filtering.CountFilter.pca.rst", "rnalysis.filtering.CountFilter.plot_expression.rst", "rnalysis.filtering.CountFilter.print_features.rst", "rnalysis.filtering.CountFilter.save_csv.rst", "rnalysis.filtering.CountFilter.save_parquet.rst", "rnalysis.filtering.CountFilter.save_table.rst", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample.rst", "rnalysis.filtering.CountFilter.sort.rst", "rnalysis.filtering.CountFilter.sort_by_principal_component.rst", "rnalysis.filtering.CountFilter.split_by_attribute.rst", "rnalysis.filtering.CountFilter.split_by_percentile.rst", "rnalysis.filtering.CountFilter.split_by_principal_components.rst", "rnalysis.filtering.CountFilter.split_by_reads.rst", "rnalysis.filtering.CountFilter.split_clicom.rst", "rnalysis.filtering.CountFilter.split_hdbscan.rst", "rnalysis.filtering.CountFilter.split_hierarchical.rst", "rnalysis.filtering.CountFilter.split_kmeans.rst", "rnalysis.filtering.CountFilter.split_kmedoids.rst", "rnalysis.filtering.CountFilter.symmetric_difference.rst", "rnalysis.filtering.CountFilter.tail.rst", "rnalysis.filtering.CountFilter.text_filters.rst", "rnalysis.filtering.CountFilter.transform.rst", "rnalysis.filtering.CountFilter.translate_gene_ids.rst", "rnalysis.filtering.CountFilter.union.rst", "rnalysis.filtering.CountFilter.violin_plot.rst", "rnalysis.filtering.DESeqFilter.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.describe.rst", "rnalysis.filtering.DESeqFilter.difference.rst", "rnalysis.filtering.DESeqFilter.drop_columns.rst", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.filter_by_attribute.rst", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_row_name.rst", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids.rst", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.filter_missing_values.rst", "rnalysis.filtering.DESeqFilter.filter_percentile.rst", "rnalysis.filtering.DESeqFilter.filter_significant.rst", "rnalysis.filtering.DESeqFilter.filter_top_n.rst", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.DESeqFilter.find_paralogs_panther.rst", "rnalysis.filtering.DESeqFilter.from_dataframe.rst", "rnalysis.filtering.DESeqFilter.head.rst", "rnalysis.filtering.DESeqFilter.intersection.rst", "rnalysis.filtering.DESeqFilter.majority_vote_intersection.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_panther.rst", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.DESeqFilter.number_filters.rst", "rnalysis.filtering.DESeqFilter.print_features.rst", "rnalysis.filtering.DESeqFilter.save_csv.rst", "rnalysis.filtering.DESeqFilter.save_parquet.rst", "rnalysis.filtering.DESeqFilter.save_table.rst", "rnalysis.filtering.DESeqFilter.sort.rst", "rnalysis.filtering.DESeqFilter.split_by_attribute.rst", "rnalysis.filtering.DESeqFilter.split_by_percentile.rst", "rnalysis.filtering.DESeqFilter.split_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.symmetric_difference.rst", "rnalysis.filtering.DESeqFilter.tail.rst", "rnalysis.filtering.DESeqFilter.text_filters.rst", "rnalysis.filtering.DESeqFilter.transform.rst", "rnalysis.filtering.DESeqFilter.translate_gene_ids.rst", "rnalysis.filtering.DESeqFilter.union.rst", "rnalysis.filtering.DESeqFilter.volcano_plot.rst", "rnalysis.filtering.Filter.rst", "rnalysis.filtering.Filter.biotypes_from_gtf.rst", "rnalysis.filtering.Filter.biotypes_from_ref_table.rst", "rnalysis.filtering.Filter.describe.rst", "rnalysis.filtering.Filter.difference.rst", "rnalysis.filtering.Filter.drop_columns.rst", "rnalysis.filtering.Filter.filter_biotype_from_gtf.rst", "rnalysis.filtering.Filter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.Filter.filter_by_attribute.rst", "rnalysis.filtering.Filter.filter_by_go_annotations.rst", "rnalysis.filtering.Filter.filter_by_kegg_annotations.rst", "rnalysis.filtering.Filter.filter_by_row_name.rst", "rnalysis.filtering.Filter.filter_duplicate_ids.rst", "rnalysis.filtering.Filter.filter_missing_values.rst", "rnalysis.filtering.Filter.filter_percentile.rst", "rnalysis.filtering.Filter.filter_top_n.rst", "rnalysis.filtering.Filter.find_paralogs_ensembl.rst", "rnalysis.filtering.Filter.find_paralogs_panther.rst", "rnalysis.filtering.Filter.from_dataframe.rst", "rnalysis.filtering.Filter.head.rst", "rnalysis.filtering.Filter.intersection.rst", "rnalysis.filtering.Filter.majority_vote_intersection.rst", "rnalysis.filtering.Filter.map_orthologs_ensembl.rst", "rnalysis.filtering.Filter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.Filter.map_orthologs_panther.rst", "rnalysis.filtering.Filter.map_orthologs_phylomedb.rst", "rnalysis.filtering.Filter.number_filters.rst", "rnalysis.filtering.Filter.print_features.rst", "rnalysis.filtering.Filter.save_csv.rst", "rnalysis.filtering.Filter.save_parquet.rst", "rnalysis.filtering.Filter.save_table.rst", "rnalysis.filtering.Filter.sort.rst", "rnalysis.filtering.Filter.split_by_attribute.rst", "rnalysis.filtering.Filter.split_by_percentile.rst", "rnalysis.filtering.Filter.symmetric_difference.rst", "rnalysis.filtering.Filter.tail.rst", "rnalysis.filtering.Filter.text_filters.rst", "rnalysis.filtering.Filter.transform.rst", "rnalysis.filtering.Filter.translate_gene_ids.rst", "rnalysis.filtering.Filter.union.rst", "rnalysis.filtering.FoldChangeFilter.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.describe.rst", "rnalysis.filtering.FoldChangeFilter.difference.rst", "rnalysis.filtering.FoldChangeFilter.drop_columns.rst", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name.rst", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids.rst", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.filter_missing_values.rst", "rnalysis.filtering.FoldChangeFilter.filter_percentile.rst", "rnalysis.filtering.FoldChangeFilter.filter_top_n.rst", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl.rst", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther.rst", "rnalysis.filtering.FoldChangeFilter.from_dataframe.rst", "rnalysis.filtering.FoldChangeFilter.head.rst", "rnalysis.filtering.FoldChangeFilter.intersection.rst", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther.rst", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb.rst", "rnalysis.filtering.FoldChangeFilter.number_filters.rst", "rnalysis.filtering.FoldChangeFilter.print_features.rst", "rnalysis.filtering.FoldChangeFilter.randomization_test.rst", "rnalysis.filtering.FoldChangeFilter.save_csv.rst", "rnalysis.filtering.FoldChangeFilter.save_parquet.rst", "rnalysis.filtering.FoldChangeFilter.save_table.rst", "rnalysis.filtering.FoldChangeFilter.sort.rst", "rnalysis.filtering.FoldChangeFilter.split_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.split_by_percentile.rst", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.symmetric_difference.rst", "rnalysis.filtering.FoldChangeFilter.tail.rst", "rnalysis.filtering.FoldChangeFilter.text_filters.rst", "rnalysis.filtering.FoldChangeFilter.transform.rst", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids.rst", "rnalysis.filtering.FoldChangeFilter.union.rst", "rnalysis.filtering.Pipeline.rst", "rnalysis.filtering.Pipeline.add_function.rst", "rnalysis.filtering.Pipeline.apply_to.rst", "rnalysis.filtering.Pipeline.export_pipeline.rst", "rnalysis.filtering.Pipeline.import_pipeline.rst", "rnalysis.filtering.Pipeline.remove_last_function.rst", "rnalysis.general.rst", "rnalysis.general.clear_all_cache.rst", "rnalysis.general.clear_gui_cache.rst", "rnalysis.general.parse_gene_name_string.rst", "rnalysis.general.parse_sequence_name_string.rst", "rnalysis.general.parse_wbgene_string.rst", "rnalysis.general.print_settings_file.rst", "rnalysis.general.reset_settings_file.rst", "rnalysis.general.save_to_csv.rst", "rnalysis.general.set_attr_ref_table_path.rst", "rnalysis.general.set_biotype_ref_table_path.rst", "tutorial.rst", "user_guide.rst", "user_guide_gui.rst"], "titles": ["API Reference", "How can I contribute to <em>RNAlysis</em>?", "Frequently asked questions", "Index", "Glossary - programmatic interface", "History", "RNAlysis 3.10.1 documentation", "Installation", "<em>RNAlysis</em> quick-start video guide", "What is <em>RNAlysis?</em>", "rnalysis package", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.add", "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.clear", "rnalysis.enrichment.FeatureSet.copy", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.difference_update", "rnalysis.enrichment.FeatureSet.discard", "rnalysis.enrichment.FeatureSet.filter_by_attribute", "rnalysis.enrichment.FeatureSet.filter_by_go_annotations", "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.intersection_update", "rnalysis.enrichment.FeatureSet.isdisjoint", "rnalysis.enrichment.FeatureSet.issubset", "rnalysis.enrichment.FeatureSet.issuperset", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.pop", "rnalysis.enrichment.FeatureSet.remove", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.symmetric_difference_update", "rnalysis.enrichment.FeatureSet.translate_gene_ids", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.update", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.add", "rnalysis.enrichment.RankedSet.biotypes_from_ref_table", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.clear", "rnalysis.enrichment.RankedSet.copy", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.difference_update", "rnalysis.enrichment.RankedSet.discard", "rnalysis.enrichment.RankedSet.filter_by_attribute", "rnalysis.enrichment.RankedSet.filter_by_go_annotations", "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.intersection_update", "rnalysis.enrichment.RankedSet.isdisjoint", "rnalysis.enrichment.RankedSet.issubset", "rnalysis.enrichment.RankedSet.issuperset", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.pop", "rnalysis.enrichment.RankedSet.remove", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.symmetric_difference_update", "rnalysis.enrichment.RankedSet.translate_gene_ids", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.update", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.enrichment_bar_plot", "rnalysis.enrichment.gene_ontology_graph", "rnalysis.enrichment.kegg_pathway_graph", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.fastq", "rnalysis.fastq.PairedEndPipeline", "rnalysis.fastq.PairedEndPipeline.add_function", "rnalysis.fastq.PairedEndPipeline.apply_to", "rnalysis.fastq.PairedEndPipeline.export_pipeline", "rnalysis.fastq.PairedEndPipeline.import_pipeline", "rnalysis.fastq.PairedEndPipeline.remove_last_function", "rnalysis.fastq.SingleEndPipeline", "rnalysis.fastq.SingleEndPipeline.add_function", "rnalysis.fastq.SingleEndPipeline.apply_to", "rnalysis.fastq.SingleEndPipeline.export_pipeline", "rnalysis.fastq.SingleEndPipeline.import_pipeline", "rnalysis.fastq.SingleEndPipeline.remove_last_function", "rnalysis.fastq.bowtie2_align_paired_end", "rnalysis.fastq.bowtie2_align_single_end", "rnalysis.fastq.bowtie2_create_index", "rnalysis.fastq.featurecounts_paired_end", "rnalysis.fastq.featurecounts_single_end", "rnalysis.fastq.kallisto_create_index", "rnalysis.fastq.kallisto_quantify_paired_end", "rnalysis.fastq.kallisto_quantify_single_end", "rnalysis.fastq.shortstack_align_smallrna", "rnalysis.fastq.trim_adapters_paired_end", "rnalysis.fastq.trim_adapters_single_end", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.differential_expression_limma_voom", "rnalysis.filtering.CountFilter.drop_columns", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_name", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_duplicate_ids", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.find_paralogs_ensembl", "rnalysis.filtering.CountFilter.find_paralogs_panther", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.from_folder_htseqcount", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.map_orthologs_ensembl", "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector", "rnalysis.filtering.CountFilter.map_orthologs_panther", "rnalysis.filtering.CountFilter.map_orthologs_phylomedb", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpkm", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_to_tpm", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.save_parquet", "rnalysis.filtering.CountFilter.save_table", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.sort_by_principal_component", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_principal_components", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.drop_columns", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_by_row_name", "rnalysis.filtering.DESeqFilter.filter_duplicate_ids", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl", "rnalysis.filtering.DESeqFilter.find_paralogs_panther", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl", "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector", "rnalysis.filtering.DESeqFilter.map_orthologs_panther", "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.save_parquet", "rnalysis.filtering.DESeqFilter.save_table", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.drop_columns", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_by_row_name", "rnalysis.filtering.Filter.filter_duplicate_ids", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.find_paralogs_ensembl", "rnalysis.filtering.Filter.find_paralogs_panther", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.map_orthologs_ensembl", "rnalysis.filtering.Filter.map_orthologs_orthoinspector", "rnalysis.filtering.Filter.map_orthologs_panther", "rnalysis.filtering.Filter.map_orthologs_phylomedb", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.save_parquet", "rnalysis.filtering.Filter.save_table", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.drop_columns", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_row_name", "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl", "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl", "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector", "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther", "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.save_parquet", "rnalysis.filtering.FoldChangeFilter.save_table", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.general", "rnalysis.general.clear_all_cache", "rnalysis.general.clear_gui_cache", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "A-to-Z tutorial - example analysis", "User guide - programmatic interface", "User guide - graphical interface"], "terms": {"privat": 0, "function": [0, 1, 4, 5, 7, 8, 9, 10, 11, 21, 22, 23, 24, 30, 41, 50, 51, 52, 53, 59, 65, 66, 73, 74, 78, 80, 84, 86, 90, 91, 92, 97, 98, 103, 104, 107, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 172, 173, 174, 176, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 217, 218, 219, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 258, 259, 260, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 302, 303, 304, 306, 307, 308, 311, 312, 323, 324], "ar": [0, 1, 5, 7, 10, 18, 21, 22, 23, 24, 30, 31, 40, 47, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 111, 112, 117, 118, 119, 123, 124, 129, 140, 141, 143, 148, 161, 165, 166, 177, 186, 187, 188, 192, 205, 212, 221, 222, 230, 231, 232, 235, 247, 254, 262, 271, 272, 273, 289, 297, 324, 325], "meant": [0, 103], "us": [0, 1, 4, 5, 6, 7, 8, 10, 12, 14, 21, 22, 24, 30, 31, 37, 40, 41, 43, 50, 51, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 111, 112, 114, 115, 116, 117, 118, 127, 128, 129, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 147, 148, 149, 155, 156, 157, 158, 160, 161, 165, 166, 167, 168, 169, 174, 176, 177, 178, 179, 184, 185, 186, 187, 196, 197, 202, 203, 204, 205, 208, 209, 210, 212, 219, 221, 222, 223, 224, 228, 229, 230, 231, 238, 239, 244, 245, 246, 247, 250, 251, 252, 254, 260, 262, 263, 264, 269, 270, 271, 272, 280, 281, 286, 287, 288, 289, 292, 293, 294, 295, 297, 304, 307, 318, 323], "out": [0, 1, 2, 5, 7, 10, 21, 22, 23, 50, 51, 52, 76, 111, 112, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 143, 150, 162, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 213, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 255, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 298, 302, 324, 325], "context": [0, 5], "do": [0, 5, 6, 7, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 97, 98, 99, 115, 116, 118, 119, 127, 128, 137, 138, 139, 140, 184, 185, 187, 188, 196, 197, 202, 203, 204, 205, 228, 229, 231, 232, 238, 239, 244, 245, 246, 247, 269, 270, 272, 273, 280, 281, 286, 287, 288, 289, 307, 323, 324, 325], "so": [0, 2, 7, 9, 10, 91, 97, 100, 141, 143, 323, 324, 325], "mai": [0, 2, 7, 9, 10, 77, 99, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 323, 324, 325], "lead": [0, 2, 5, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 262, 323, 324, 325], "unexpect": 0, "result": [0, 5, 8, 10, 11, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 91, 92, 94, 95, 97, 98, 111, 112, 124, 161, 162, 164, 165, 166, 167, 168, 169, 173, 192, 212, 213, 214, 218, 235, 254, 255, 259, 292, 297, 299, 308, 312, 323, 325], "The": [0, 1, 2, 4, 5, 7, 8, 9, 10, 18, 24, 25, 30, 31, 38, 40, 47, 53, 54, 59, 60, 64, 65, 66, 70, 72, 74, 75, 78, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 107, 108, 109, 111, 112, 113, 114, 115, 116, 121, 123, 125, 131, 132, 135, 136, 145, 148, 151, 152, 153, 162, 164, 165, 166, 167, 168, 169, 173, 176, 177, 178, 179, 180, 182, 183, 184, 185, 193, 201, 213, 214, 218, 221, 222, 223, 224, 225, 227, 228, 229, 236, 243, 255, 259, 262, 263, 264, 265, 267, 268, 269, 270, 278, 285, 292, 298, 299, 303, 306, 315, 316, 317, 324, 325], "provid": [0, 1, 5, 7, 10, 78, 99, 105, 106, 166, 178, 179, 194, 223, 224, 263, 264, 323, 324, 325], "unifi": [0, 78, 324], "programmat": [0, 1, 5, 6, 7, 9, 78, 323], "interfac": [0, 1, 5, 6, 7, 9, 78, 323], "extern": [0, 5, 7, 78, 324], "tool": [0, 5, 6, 9, 78, 97, 98, 323, 324, 325], "process": [0, 2, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 78, 100, 101, 165, 166, 167, 168, 169, 323, 324, 325], "file": [0, 1, 4, 5, 7, 8, 10, 11, 14, 24, 30, 31, 34, 40, 43, 53, 59, 60, 63, 64, 65, 66, 72, 74, 75, 78, 82, 83, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 105, 111, 112, 115, 116, 131, 132, 145, 147, 148, 149, 155, 156, 157, 177, 178, 184, 185, 208, 209, 210, 222, 223, 228, 229, 250, 251, 252, 262, 263, 269, 270, 292, 293, 294, 295, 309, 310, 312, 318, 319, 320, 321, 322], "those": [0, 2, 8, 10, 75, 78, 91, 92, 141, 144, 165, 166, 167, 168, 169, 312, 323, 324, 325], "current": [0, 1, 2, 5, 10, 18, 21, 22, 23, 25, 35, 38, 47, 50, 51, 52, 54, 67, 70, 78, 99, 103, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 154, 155, 156, 157, 172, 173, 174, 177, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 207, 208, 209, 210, 217, 218, 219, 222, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 249, 250, 251, 252, 258, 259, 260, 262, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 291, 293, 294, 295, 302, 303, 304, 318, 324, 325], "includ": [0, 1, 5, 7, 8, 10, 11, 22, 24, 30, 31, 34, 40, 51, 53, 59, 60, 63, 64, 65, 66, 72, 76, 77, 78, 102, 106, 109, 118, 131, 132, 143, 151, 164, 179, 180, 187, 224, 225, 231, 264, 265, 272, 307, 312, 323, 324, 325], "cutadapt": [0, 5, 9, 78, 100, 101], "adapt": [0, 5, 7, 8, 9, 78, 99, 100, 101], "trim": [0, 5, 7, 8, 9, 10, 78, 99, 100, 101, 143, 325], "kallisto": [0, 5, 7, 9, 78, 96, 97, 98], "rna": [0, 5, 6, 7, 9, 10, 78, 99, 103, 147, 325], "sequenc": [0, 5, 6, 9, 10, 75, 78, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 158, 315, 316, 325], "quantif": [0, 5, 7, 9, 78, 97, 98, 323], "bowtie2": [0, 5, 9, 78, 91, 92, 93, 94, 95], "align": [0, 5, 8, 9, 10, 78, 91, 92, 93, 94, 95, 99, 131, 132, 147, 167, 323, 325], "featurecount": [0, 5, 78, 94, 95], "featur": [0, 4, 5, 7, 8, 9, 10, 11, 12, 21, 22, 23, 24, 30, 31, 34, 37, 40, 41, 50, 51, 52, 53, 59, 60, 63, 65, 66, 69, 72, 75, 76, 77, 78, 94, 95, 97, 98, 103, 105, 106, 110, 115, 116, 117, 118, 119, 121, 123, 124, 125, 126, 127, 128, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 153, 154, 158, 161, 162, 164, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 177, 178, 179, 181, 183, 184, 185, 186, 187, 188, 191, 192, 193, 194, 195, 196, 197, 200, 201, 202, 203, 204, 205, 206, 207, 212, 213, 214, 215, 217, 218, 219, 220, 221, 222, 223, 224, 226, 228, 229, 230, 231, 232, 235, 236, 237, 238, 239, 242, 243, 244, 245, 246, 247, 248, 249, 254, 255, 256, 258, 259, 260, 261, 262, 263, 264, 266, 268, 269, 270, 271, 272, 273, 276, 278, 279, 280, 281, 284, 285, 286, 287, 288, 289, 290, 291, 292, 297, 298, 299, 300, 302, 304, 305, 308, 312, 323, 325], "count": [0, 1, 2, 4, 5, 8, 9, 10, 12, 14, 41, 43, 78, 94, 95, 97, 98, 102, 103, 104, 105, 106, 109, 110, 111, 112, 116, 117, 121, 123, 126, 131, 132, 136, 141, 142, 143, 144, 145, 146, 147, 148, 149, 153, 154, 158, 159, 161, 164, 170, 173, 175, 178, 179, 180, 181, 185, 186, 195, 201, 207, 211, 212, 215, 218, 220, 222, 223, 224, 225, 226, 229, 230, 237, 243, 249, 253, 254, 256, 259, 261, 263, 264, 265, 266, 270, 271, 279, 285, 291, 296, 297, 300, 305, 323], "class": [0, 5, 10, 11, 12, 41, 78, 79, 85, 102, 103, 177, 222, 262, 306, 324], "pairedendpipelin": [0, 5], "base": [0, 2, 4, 5, 7, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 73, 74, 75, 97, 98, 99, 100, 101, 108, 111, 112, 118, 119, 127, 128, 137, 138, 139, 140, 160, 163, 164, 165, 166, 167, 168, 169, 173, 174, 187, 188, 196, 197, 202, 203, 204, 205, 214, 218, 219, 231, 232, 238, 239, 244, 245, 246, 247, 259, 260, 272, 273, 280, 281, 286, 287, 288, 289, 299, 303, 304, 324, 325], "_fastqpipelin": 0, "_func_signatur": 0, "func": [0, 10, 80, 86, 307], "arg": [0, 10, 80, 86, 307], "tupl": [0, 10, 24, 30, 31, 40, 41, 53, 59, 60, 64, 65, 66, 72, 77, 94, 95, 103, 111, 112, 152, 158, 161, 162, 163, 164, 165, 166, 167, 168, 169, 177, 212, 213, 214, 222, 254, 255, 262, 297, 298, 299, 308, 324], "kwarg": [0, 10, 80, 86, 307], "dict": [0, 5, 10, 76, 77, 165, 308], "return": [0, 5, 10, 14, 17, 18, 21, 22, 23, 24, 25, 27, 30, 31, 32, 35, 37, 38, 40, 43, 46, 47, 50, 51, 52, 53, 54, 56, 59, 60, 61, 64, 65, 66, 67, 69, 70, 72, 73, 74, 76, 77, 82, 83, 88, 89, 94, 95, 97, 98, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 253, 254, 255, 256, 257, 258, 259, 260, 261, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 292, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 308, 309, 310, 315, 316, 317, 323, 324, 325], "string": [0, 5, 10, 12, 21, 24, 30, 31, 40, 41, 50, 53, 59, 60, 72, 82, 83, 88, 89, 99, 103, 110, 115, 116, 117, 134, 136, 153, 155, 156, 157, 158, 161, 165, 170, 175, 177, 181, 184, 185, 186, 200, 201, 208, 209, 210, 212, 215, 220, 222, 226, 228, 229, 230, 242, 243, 250, 251, 252, 254, 256, 261, 262, 266, 269, 270, 271, 284, 285, 293, 294, 295, 297, 300, 305, 309, 310, 315, 316, 317, 324], "signatur": [0, 5], "given": [0, 1, 5, 10, 11, 21, 22, 23, 50, 51, 52, 65, 66, 91, 92, 94, 95, 97, 98, 99, 104, 108, 117, 118, 119, 129, 131, 132, 134, 136, 144, 145, 148, 161, 186, 187, 188, 200, 201, 212, 230, 231, 232, 242, 243, 254, 271, 272, 273, 284, 285, 292, 297, 308, 315, 316, 317, 324, 325], "argument": [0, 4, 5, 10, 99, 129, 173, 218, 259, 303, 307, 324], "paramet": [0, 1, 2, 5, 8, 10, 12, 14, 15, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 37, 38, 40, 41, 43, 44, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 82, 83, 84, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 206, 208, 209, 210, 211, 212, 213, 215, 216, 217, 218, 219, 220, 221, 222, 223, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 248, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 290, 292, 293, 294, 295, 296, 297, 298, 300, 301, 302, 303, 304, 305, 306, 308, 309, 310, 311, 323], "method": [0, 5, 7, 8, 9, 10, 20, 22, 24, 30, 31, 40, 49, 51, 53, 59, 60, 64, 65, 66, 72, 97, 98, 103, 108, 118, 141, 142, 143, 144, 145, 148, 155, 156, 157, 165, 166, 177, 187, 208, 209, 210, 222, 231, 250, 251, 252, 262, 272, 293, 294, 295, 323], "keyword": [0, 10, 173, 218, 259, 303, 307, 324], "type": [0, 4, 5, 6, 7, 9, 10, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 73, 75, 77, 83, 89, 91, 92, 93, 94, 95, 99, 105, 107, 108, 109, 110, 114, 115, 118, 119, 124, 127, 128, 129, 134, 135, 136, 137, 138, 139, 140, 145, 148, 160, 161, 162, 163, 164, 170, 171, 174, 175, 176, 178, 180, 181, 184, 187, 188, 192, 196, 197, 200, 201, 202, 203, 204, 205, 212, 213, 214, 215, 216, 219, 220, 221, 223, 225, 226, 228, 231, 232, 235, 238, 239, 242, 243, 244, 245, 246, 247, 254, 255, 256, 257, 260, 261, 263, 265, 266, 269, 272, 273, 280, 281, 284, 285, 286, 287, 288, 289, 292, 297, 298, 299, 300, 301, 304, 305, 306, 307, 308, 310, 312, 315, 316, 317, 320, 321, 322, 323], "str": [0, 5, 10, 12, 14, 15, 21, 22, 23, 24, 30, 31, 34, 37, 40, 41, 43, 44, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 108, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 145, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 166, 169, 170, 172, 173, 174, 175, 176, 177, 178, 179, 181, 182, 184, 185, 186, 187, 188, 189, 193, 195, 196, 197, 198, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 212, 213, 215, 217, 218, 219, 220, 221, 222, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 236, 237, 238, 239, 240, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 256, 258, 259, 260, 261, 262, 263, 264, 266, 267, 269, 270, 271, 272, 273, 274, 279, 280, 281, 282, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 297, 300, 302, 303, 304, 305, 306, 307, 309, 310, 315, 316, 317, 320, 321, 322], "static": 0, "_param_str": 0, "format": [0, 1, 4, 5, 7, 8, 10, 24, 30, 53, 59, 65, 66, 74, 75, 77, 93, 94, 95, 96, 97, 98, 99, 102, 105, 106, 115, 131, 132, 178, 179, 184, 223, 224, 228, 263, 264, 269, 315, 316, 317, 323, 324], "argumentss": 0, "_readable_func_signatur": 0, "human": 0, "readabl": [0, 5, 323], "export_pipelin": [0, 10], "filenam": [0, 4, 5, 10, 21, 34, 50, 63, 82, 83, 88, 89, 103, 117, 161, 177, 186, 212, 222, 230, 254, 262, 271, 297, 309, 310, 320, 324], "option": [0, 2, 4, 5, 10, 12, 24, 30, 37, 40, 53, 59, 69, 72, 74, 75, 76, 77, 82, 88, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 111, 112, 143, 152, 158, 166, 167, 168, 169, 174, 219, 221, 260, 292, 304, 308, 309, 323], "union": [0, 5, 10, 12, 14, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 37, 39, 40, 41, 43, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 69, 71, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 114, 115, 116, 117, 118, 119, 120, 124, 126, 127, 128, 130, 134, 135, 136, 137, 138, 139, 140, 143, 145, 147, 148, 149, 151, 152, 153, 155, 156, 157, 158, 159, 161, 163, 165, 166, 167, 168, 169, 170, 173, 174, 176, 177, 178, 179, 180, 181, 184, 185, 186, 187, 188, 189, 192, 195, 196, 197, 198, 200, 201, 202, 203, 204, 205, 208, 209, 210, 211, 212, 215, 218, 219, 221, 222, 223, 224, 225, 226, 228, 229, 230, 231, 232, 233, 235, 237, 238, 239, 240, 242, 243, 244, 245, 246, 247, 250, 251, 252, 253, 254, 256, 259, 260, 262, 263, 264, 265, 266, 269, 270, 271, 272, 273, 274, 279, 280, 281, 282, 284, 285, 286, 287, 288, 289, 293, 294, 295, 296, 297, 300, 303, 304, 306, 307, 308, 309, 310, 320, 323, 324, 325], "path": [0, 10, 14, 21, 23, 24, 30, 31, 34, 40, 43, 50, 52, 53, 59, 60, 63, 64, 65, 66, 72, 73, 74, 76, 77, 81, 82, 83, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 111, 112, 115, 116, 117, 119, 130, 131, 132, 145, 147, 148, 149, 155, 156, 157, 161, 177, 178, 179, 184, 185, 186, 188, 198, 208, 209, 210, 212, 222, 223, 224, 228, 229, 230, 232, 240, 250, 251, 252, 254, 262, 263, 264, 269, 270, 271, 273, 282, 292, 293, 294, 295, 297, 309, 310, 320, 321, 322, 323, 325], "none": [0, 5, 10, 12, 21, 22, 24, 30, 31, 40, 50, 51, 53, 59, 60, 64, 65, 66, 72, 74, 75, 76, 77, 82, 88, 93, 94, 95, 97, 98, 99, 100, 101, 103, 111, 112, 117, 118, 131, 132, 137, 138, 139, 140, 143, 152, 155, 156, 157, 158, 159, 160, 166, 167, 168, 169, 177, 186, 187, 202, 203, 204, 205, 208, 209, 210, 211, 221, 222, 230, 231, 244, 245, 246, 247, 250, 251, 252, 253, 271, 272, 286, 287, 288, 289, 292, 293, 294, 295, 296, 308, 309, 321, 322, 323], "export": [0, 5, 6, 10, 82, 88, 309, 323, 324], "pipelin": [0, 2, 4, 5, 6, 9, 10, 82, 83, 84, 88, 89, 90, 112], "yaml": [0, 5, 10, 82, 83, 88, 89, 116, 185, 229, 270, 309, 310, 324, 325], "like": [0, 1, 2, 4, 5, 10, 82, 83, 88, 89, 109, 143, 180, 225, 265, 309, 310, 315, 323, 324, 325], "pathlib": [0, 10, 14, 21, 24, 30, 31, 34, 40, 43, 50, 53, 59, 60, 63, 64, 65, 66, 72, 76, 77, 82, 83, 88, 89, 103, 117, 131, 132, 149, 155, 156, 157, 177, 186, 208, 209, 210, 222, 230, 250, 251, 252, 262, 271, 292, 293, 294, 295, 309, 310], "save": [0, 2, 5, 6, 10, 11, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 82, 88, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 111, 112, 124, 131, 132, 155, 156, 157, 161, 162, 164, 165, 166, 167, 168, 169, 173, 177, 192, 208, 209, 210, 212, 213, 214, 218, 222, 235, 250, 251, 252, 254, 255, 259, 262, 292, 293, 294, 295, 297, 299, 308, 309, 312, 320, 323, 325], "instead": [0, 2, 4, 5, 8, 9, 10, 21, 22, 23, 50, 51, 52, 82, 88, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 132, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 307, 309, 323, 324, 325], "i": [0, 4, 5, 6, 7, 10, 13, 14, 20, 21, 22, 23, 24, 30, 31, 32, 33, 35, 37, 40, 42, 43, 49, 50, 51, 52, 53, 59, 60, 61, 62, 64, 65, 66, 67, 69, 72, 73, 74, 75, 76, 77, 82, 84, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 103, 105, 106, 107, 109, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 131, 132, 135, 136, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 158, 159, 163, 165, 166, 167, 168, 169, 172, 173, 174, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 201, 205, 206, 211, 217, 218, 219, 221, 222, 223, 224, 225, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 243, 247, 248, 253, 258, 259, 260, 262, 263, 264, 265, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 285, 289, 290, 292, 296, 302, 303, 304, 309, 311, 315, 316, 317, 319, 323], "list": [0, 1, 4, 5, 6, 9, 10, 12, 21, 22, 23, 24, 30, 31, 34, 40, 41, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 77, 81, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 107, 108, 109, 113, 114, 115, 116, 117, 118, 119, 120, 126, 127, 128, 129, 135, 137, 138, 139, 140, 141, 151, 152, 153, 158, 159, 160, 161, 163, 165, 166, 167, 168, 169, 173, 176, 177, 180, 182, 184, 185, 186, 187, 188, 189, 195, 196, 197, 202, 203, 204, 205, 211, 212, 218, 222, 225, 227, 228, 229, 230, 231, 232, 233, 237, 238, 239, 244, 245, 246, 247, 253, 254, 259, 262, 265, 267, 269, 270, 271, 272, 273, 274, 279, 280, 281, 286, 287, 288, 289, 296, 297, 306, 323, 324, 325], "perform": [0, 2, 4, 5, 6, 9, 10, 11, 22, 24, 31, 51, 53, 60, 65, 99, 102, 108, 118, 125, 152, 159, 160, 162, 163, 187, 193, 211, 213, 231, 236, 253, 255, 272, 292, 296, 323], "classmethod": [0, 10, 83, 89, 130, 131, 132, 198, 240, 282, 310], "import_pipelin": [0, 10, 324], "genericpipelin": [0, 10, 83, 89, 310], "import": [0, 5, 6, 7, 9, 10, 12, 14, 18, 25, 35, 38, 41, 43, 47, 54, 67, 70, 83, 84, 89, 90, 102, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 262, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 306, 307, 308, 310, 311, 315, 316, 317, 318, 321, 322], "from": [0, 1, 2, 4, 5, 6, 8, 9, 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 30, 31, 33, 35, 37, 38, 40, 41, 43, 45, 47, 48, 49, 50, 51, 52, 53, 54, 59, 60, 62, 64, 65, 66, 67, 69, 70, 72, 76, 77, 83, 84, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 105, 106, 109, 110, 113, 115, 116, 117, 118, 119, 120, 121, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 146, 147, 149, 150, 154, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 253, 254, 255, 256, 257, 258, 259, 260, 261, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 276, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 296, 297, 299, 300, 301, 302, 304, 305, 306, 307, 308, 310, 311, 315, 316, 317, 318, 321, 322, 323], "name": [0, 1, 2, 4, 5, 8, 10, 12, 15, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 41, 44, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 83, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 102, 103, 104, 105, 106, 107, 108, 111, 112, 113, 114, 115, 116, 118, 119, 120, 122, 124, 125, 126, 127, 128, 129, 130, 131, 132, 135, 137, 138, 139, 140, 141, 143, 145, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 172, 173, 174, 176, 177, 178, 179, 182, 184, 185, 187, 188, 189, 190, 192, 193, 195, 196, 197, 198, 202, 203, 204, 205, 206, 208, 209, 210, 211, 212, 213, 217, 218, 219, 221, 222, 223, 224, 227, 228, 229, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 244, 245, 246, 247, 248, 250, 251, 252, 253, 254, 255, 258, 259, 260, 262, 263, 264, 267, 268, 269, 270, 272, 273, 274, 275, 276, 279, 280, 281, 282, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 297, 299, 302, 303, 304, 307, 310, 315, 316, 320, 323, 325], "contain": [0, 2, 4, 5, 10, 28, 29, 57, 58, 73, 74, 83, 89, 92, 93, 94, 95, 97, 98, 99, 101, 103, 105, 110, 111, 112, 115, 131, 132, 134, 141, 142, 143, 144, 145, 146, 147, 148, 149, 161, 162, 164, 165, 166, 172, 177, 178, 181, 184, 200, 212, 213, 214, 217, 222, 223, 226, 228, 242, 254, 255, 258, 262, 263, 266, 269, 284, 292, 297, 298, 299, 302, 310, 312, 315, 316, 317, 323, 324, 325], "param": [0, 10, 22, 23, 24, 51, 52, 53, 65, 93, 105, 106, 107, 118, 119, 124, 135, 140, 145, 148, 151, 176, 178, 179, 187, 188, 192, 205, 221, 223, 224, 231, 232, 235, 247, 263, 264, 272, 273, 289, 306, 307, 315, 316, 317, 320, 321, 322], "remove_last_funct": [0, 10, 324], "remov": [0, 9, 10, 16, 19, 20, 32, 45, 48, 49, 61, 84, 90, 103, 120, 121, 122, 123, 124, 125, 137, 138, 139, 140, 177, 189, 190, 192, 193, 194, 202, 203, 204, 205, 222, 233, 234, 235, 236, 244, 245, 246, 247, 262, 274, 275, 277, 278, 286, 287, 288, 289, 311, 324, 325], "last": [0, 10, 84, 90, 122, 126, 137, 138, 139, 140, 159, 171, 190, 195, 202, 203, 204, 205, 211, 216, 234, 237, 244, 245, 246, 247, 253, 257, 275, 279, 286, 287, 288, 289, 296, 301, 311, 323, 324, 325], "wa": [0, 2, 5, 7, 9, 10, 84, 90, 100, 101, 103, 125, 132, 193, 236, 278, 311, 323, 324, 325], "ad": [0, 8, 10, 84, 90, 140, 143, 151, 205, 247, 289, 307, 308, 311, 323, 324, 325], "place": [0, 2, 5, 6, 10, 84, 90, 110, 134, 159, 160, 181, 200, 211, 226, 242, 253, 266, 284, 296, 308, 311, 324, 325], "exampl": [0, 1, 2, 5, 6, 7, 8, 10, 12, 14, 18, 22, 23, 24, 25, 30, 31, 35, 37, 38, 40, 41, 43, 47, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 69, 70, 72, 75, 76, 77, 84, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 106, 107, 108, 109, 110, 111, 112, 114, 115, 116, 117, 118, 119, 121, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 146, 147, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 179, 180, 181, 183, 184, 185, 186, 187, 188, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 224, 225, 226, 228, 229, 230, 231, 232, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 264, 265, 266, 268, 269, 270, 271, 272, 273, 276, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 299, 300, 301, 302, 304, 305, 306, 307, 308, 311, 315, 316, 317, 318, 321, 322, 324, 325], "pipe": [0, 10, 84, 90, 306, 307, 308, 311, 324], "add_funct": [0, 10, 84, 90, 308, 311, 324], "filter_missing_valu": [0, 5, 10, 84, 90, 307, 308, 311, 324], "singleendpipelin": [0, 5], "abc": 0, "_merge_kallisto_output": 0, "output_fold": [0, 5, 10, 81, 87, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 111, 112, 324], "output": [0, 2, 4, 5, 10, 21, 22, 23, 34, 50, 51, 52, 63, 91, 92, 97, 98, 100, 101, 109, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 147, 150, 168, 169, 172, 177, 180, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 222, 225, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 265, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 308, 323], "merg": [0, 1, 10, 99, 166, 167, 323, 324, 325], "csv": [0, 2, 4, 5, 10, 11, 12, 14, 24, 30, 31, 40, 41, 43, 53, 59, 60, 64, 65, 66, 72, 97, 98, 102, 103, 106, 109, 110, 111, 112, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 155, 157, 159, 161, 162, 164, 170, 171, 172, 173, 175, 177, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 208, 210, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 250, 252, 253, 254, 255, 256, 257, 258, 259, 261, 262, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 293, 295, 296, 297, 299, 300, 301, 302, 305, 308, 320, 323], "transcript": [0, 5, 7, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 94, 95, 97, 98, 105, 115, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 174, 178, 184, 187, 188, 196, 197, 202, 203, 204, 205, 219, 223, 228, 231, 232, 238, 239, 244, 245, 246, 247, 260, 263, 269, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324], "estim": [0, 5, 9, 10, 97, 98, 167, 168, 169, 323, 324, 325], "tpm": [0, 5, 10, 97, 98, 123, 148, 158, 164, 323, 324], "bowtie2_align_paired_end": [0, 324], "r1_file": [0, 81, 91, 97, 100, 324], "r2_file": [0, 81, 91, 97, 100, 324], "index_fil": [0, 91, 92, 97, 98, 324], "bowtie2_installation_fold": [0, 91, 92, 93], "liter": [0, 10, 14, 21, 22, 23, 24, 30, 31, 37, 40, 43, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 104, 105, 106, 107, 108, 110, 111, 112, 114, 115, 116, 117, 118, 119, 122, 124, 127, 128, 134, 135, 136, 137, 138, 139, 140, 143, 145, 148, 150, 151, 152, 153, 157, 158, 161, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 176, 178, 179, 181, 184, 185, 186, 187, 188, 190, 191, 192, 196, 197, 200, 201, 202, 203, 204, 205, 206, 210, 212, 215, 217, 218, 219, 220, 221, 223, 224, 226, 228, 229, 230, 231, 232, 234, 235, 238, 239, 242, 243, 244, 245, 246, 247, 248, 252, 254, 256, 258, 259, 260, 261, 263, 264, 266, 269, 270, 271, 272, 273, 275, 276, 280, 281, 284, 285, 286, 287, 288, 289, 290, 295, 297, 300, 302, 303, 304, 305], "auto": [0, 5, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 104, 107, 108, 111, 112, 114, 118, 119, 127, 128, 135, 137, 138, 139, 140, 143, 151, 152, 158, 167, 168, 169, 174, 176, 187, 188, 196, 197, 202, 203, 204, 205, 219, 221, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "new_sample_nam": [0, 91, 92, 94, 95, 97, 98, 99, 323], "mode": [0, 2, 5, 10, 21, 22, 23, 50, 51, 52, 91, 92, 99, 117, 118, 119, 158, 186, 187, 188, 221, 230, 231, 232, 271, 272, 273, 324], "end": [0, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 126, 159, 172, 195, 211, 217, 237, 253, 258, 279, 296, 302, 323, 325], "local": [0, 1, 2, 10, 91, 92, 319, 323], "settings_preset": [0, 91, 92], "veri": [0, 2, 91, 92, 323, 324, 325], "fast": [0, 9, 91, 92], "sensit": [0, 91, 92, 324, 325], "ignore_qu": [0, 91, 92], "bool": [0, 10, 21, 22, 23, 24, 30, 31, 37, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 130, 131, 132, 134, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 158, 159, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 198, 200, 202, 203, 204, 205, 206, 211, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 242, 244, 245, 246, 247, 248, 253, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 282, 284, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 308], "fals": [0, 2, 5, 10, 21, 22, 23, 24, 30, 31, 37, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 158, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 198, 200, 201, 202, 203, 204, 205, 206, 207, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 243, 244, 245, 246, 247, 248, 249, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 282, 284, 285, 286, 287, 288, 289, 290, 291, 292, 302, 303, 304, 307, 308, 323, 324, 325], "quality_score_typ": [0, 91, 92], "phred33": [0, 91, 92], "phred64": [0, 91, 92], "solexa": [0, 91, 92], "qual": [0, 91, 92], "int": [0, 5, 10, 22, 23, 24, 30, 31, 40, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 118, 119, 126, 127, 128, 133, 137, 138, 139, 140, 141, 152, 158, 160, 163, 165, 166, 167, 168, 169, 171, 172, 183, 187, 188, 195, 196, 197, 199, 202, 203, 204, 205, 216, 217, 231, 232, 237, 238, 239, 241, 244, 245, 246, 247, 257, 258, 268, 272, 273, 279, 280, 281, 283, 286, 287, 288, 289, 292, 301, 302], "mate_orient": [0, 91], "fwd": [0, 91], "rev": [0, 91, 93], "min_fragment_length": [0, 91, 94], "nonnegativeint": [0, 10, 91, 92, 93, 94, 100, 101, 126, 141, 168, 169, 195, 237, 279], "0": [0, 2, 6, 7, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 106, 109, 116, 125, 133, 136, 140, 141, 143, 144, 158, 159, 162, 163, 165, 166, 179, 180, 183, 185, 193, 194, 199, 201, 205, 211, 213, 221, 224, 225, 229, 236, 241, 243, 247, 253, 255, 262, 264, 265, 268, 270, 278, 283, 285, 289, 292, 296, 298, 299, 307, 315, 316, 323, 324, 325], "max_fragment_length": [0, 91, 94], "positiveint": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 133, 152, 160, 163, 165, 166, 167, 168, 169, 171, 199, 216, 241, 257, 283, 292, 301], "500": [0, 91, 324], "allow_individual_align": [0, 91], "true": [0, 5, 10, 21, 22, 23, 24, 27, 30, 31, 37, 40, 50, 51, 52, 53, 56, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 104, 105, 106, 107, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 131, 132, 134, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 158, 159, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 200, 202, 203, 204, 205, 206, 211, 217, 218, 219, 221, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 242, 244, 245, 246, 247, 248, 253, 258, 259, 260, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 284, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 307, 308, 323, 324, 325], "allow_disconcordant_align": [0, 91], "random_se": [0, 5, 10, 24, 30, 40, 53, 59, 72, 91, 92, 93, 168, 169, 292, 323, 324, 325], "thread": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 93, 94, 95, 99, 165, 166, 167, 168, 169], "1": [0, 2, 9, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 64, 65, 66, 72, 73, 77, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 106, 107, 109, 111, 112, 114, 124, 125, 133, 136, 140, 141, 143, 144, 151, 158, 159, 162, 163, 165, 166, 171, 173, 176, 179, 180, 183, 192, 193, 194, 199, 201, 205, 211, 213, 216, 218, 221, 224, 225, 235, 236, 241, 243, 247, 253, 255, 257, 259, 264, 265, 268, 278, 283, 285, 289, 292, 296, 298, 301, 303, 307, 315, 324, 325], "pair": [0, 5, 10, 91, 92, 94, 97, 98, 99, 100, 137, 138, 139, 140, 151, 152, 165, 167, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 325], "read": [0, 2, 5, 9, 10, 21, 22, 24, 50, 51, 53, 65, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 107, 111, 112, 114, 117, 118, 123, 132, 139, 140, 141, 143, 144, 145, 146, 147, 148, 149, 153, 158, 164, 165, 176, 186, 187, 204, 205, 230, 231, 246, 247, 271, 272, 288, 289, 312, 325], "individu": [0, 2, 10, 91, 92, 97, 98, 105, 111, 112, 115, 131, 132, 135, 178, 184, 223, 228, 263, 269, 323, 324, 325], "sam": [0, 91, 92, 94, 95, 324, 325], "folder": [0, 2, 5, 10, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 111, 112, 131, 132, 323], "you": [0, 1, 2, 4, 5, 6, 7, 9, 10, 24, 37, 53, 69, 75, 91, 92, 94, 95, 97, 98, 99, 100, 102, 105, 111, 112, 115, 139, 140, 141, 142, 143, 144, 158, 160, 163, 165, 174, 178, 184, 204, 205, 219, 221, 223, 228, 246, 247, 260, 263, 269, 288, 289, 304, 321, 322, 323, 324, 325], "can": [0, 4, 5, 6, 7, 8, 10, 11, 21, 22, 23, 24, 34, 37, 41, 50, 51, 52, 53, 63, 69, 91, 92, 93, 94, 95, 96, 97, 98, 102, 103, 107, 110, 112, 114, 117, 118, 119, 131, 132, 134, 137, 138, 139, 140, 151, 152, 153, 158, 160, 163, 165, 174, 176, 177, 181, 186, 187, 188, 200, 202, 203, 204, 205, 219, 221, 226, 230, 231, 232, 242, 244, 245, 246, 247, 260, 266, 271, 272, 273, 284, 286, 287, 288, 289, 304, 306, 307, 315, 316, 317, 323, 324, 325], "more": [0, 1, 4, 5, 6, 7, 10, 21, 22, 23, 24, 50, 51, 52, 53, 65, 76, 91, 92, 93, 94, 95, 97, 98, 99, 102, 109, 117, 118, 119, 139, 140, 151, 165, 166, 180, 186, 187, 188, 204, 205, 225, 230, 231, 232, 246, 247, 265, 271, 272, 273, 288, 289, 323, 324, 325], "about": [0, 1, 4, 5, 8, 10, 21, 22, 24, 50, 51, 53, 65, 91, 92, 100, 105, 106, 115, 116, 117, 118, 139, 140, 141, 147, 162, 165, 177, 178, 179, 184, 185, 186, 187, 204, 205, 213, 223, 224, 228, 229, 230, 231, 246, 247, 255, 262, 263, 264, 269, 270, 271, 272, 288, 289, 298, 323, 324, 325], "how": [0, 5, 6, 10, 24, 30, 40, 53, 59, 72, 91, 92, 99, 100, 126, 137, 138, 139, 140, 195, 202, 203, 204, 205, 237, 244, 245, 246, 247, 279, 286, 287, 288, 289, 292, 323, 324, 325], "work": [0, 1, 5, 6, 7, 91, 92, 99, 323], "manual": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 91, 92, 97, 98, 292, 324, 325], "exist": [0, 5, 10, 25, 38, 54, 70, 91, 92, 97, 98, 99, 100, 101, 110, 134, 170, 175, 181, 200, 215, 220, 226, 242, 256, 261, 266, 284, 300, 305, 323, 325], "your": [0, 1, 2, 4, 5, 6, 7, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 76, 77, 91, 93, 96, 97, 100, 101, 102, 105, 112, 115, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 165, 178, 184, 187, 188, 196, 197, 202, 203, 204, 205, 223, 228, 231, 232, 238, 239, 244, 245, 246, 247, 263, 269, 272, 273, 280, 281, 286, 287, 288, 289, 323], "should": [0, 1, 5, 7, 10, 75, 91, 92, 94, 95, 97, 98, 99, 100, 103, 104, 105, 109, 111, 112, 115, 121, 123, 141, 143, 145, 148, 160, 163, 165, 173, 177, 178, 180, 184, 218, 223, 225, 228, 259, 262, 263, 265, 269, 323, 324, 325], "sort": [0, 5, 6, 10, 41, 64, 65, 66, 91, 97, 100, 126, 154, 160, 195, 207, 237, 249, 279, 291, 307, 308, 323, 324, 325], "tandem": [0, 91, 97, 100], "thei": [0, 1, 2, 5, 10, 37, 69, 91, 94, 95, 97, 98, 99, 100, 102, 107, 114, 129, 136, 137, 138, 139, 140, 141, 143, 151, 152, 153, 158, 165, 174, 176, 191, 201, 202, 203, 204, 205, 219, 243, 244, 245, 246, 247, 260, 276, 285, 286, 287, 288, 289, 304, 308, 323, 324, 325], "line": [0, 2, 5, 9, 91, 97, 99, 100, 323, 324, 325], "up": [0, 1, 5, 6, 7, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 64, 65, 66, 72, 91, 97, 98, 100, 118, 183, 187, 221, 231, 268, 272, 323, 324, 325], "form": [0, 4, 5, 10, 91, 97, 100, 105, 106, 178, 179, 223, 224, 263, 264, 324], "r1": [0, 10, 91, 97, 100, 140, 205, 247, 289], "r2": [0, 91, 97, 100], "2": [0, 2, 6, 9, 10, 76, 77, 91, 92, 93, 94, 95, 97, 99, 100, 108, 109, 110, 111, 112, 124, 133, 134, 136, 140, 150, 152, 159, 161, 163, 165, 171, 180, 181, 183, 191, 192, 199, 200, 201, 205, 206, 211, 212, 214, 216, 225, 226, 235, 241, 242, 243, 247, 248, 253, 254, 257, 265, 266, 268, 283, 284, 285, 289, 290, 292, 296, 297, 301, 315, 324, 325], "an": [0, 1, 4, 5, 6, 9, 10, 13, 20, 21, 23, 24, 31, 32, 33, 40, 42, 49, 50, 52, 53, 60, 61, 62, 64, 65, 72, 73, 74, 76, 77, 91, 92, 96, 97, 98, 99, 100, 101, 105, 107, 111, 112, 114, 115, 117, 119, 131, 132, 135, 137, 138, 139, 140, 141, 143, 151, 152, 153, 166, 167, 168, 169, 176, 178, 184, 186, 188, 202, 203, 204, 205, 222, 223, 228, 230, 232, 244, 245, 246, 247, 263, 269, 271, 273, 286, 287, 288, 289, 323], "which": [0, 1, 2, 5, 7, 8, 10, 18, 21, 22, 23, 24, 25, 30, 31, 35, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 73, 76, 77, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 105, 106, 109, 111, 112, 115, 116, 117, 118, 119, 122, 123, 125, 126, 131, 132, 143, 144, 147, 149, 160, 162, 163, 164, 165, 166, 167, 173, 177, 178, 179, 180, 184, 185, 186, 187, 188, 190, 191, 193, 194, 195, 213, 218, 222, 223, 224, 225, 228, 229, 230, 231, 232, 234, 236, 237, 255, 259, 262, 263, 264, 265, 269, 270, 271, 272, 273, 275, 276, 279, 292, 306, 323], "well": [0, 2, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 105, 106, 111, 112, 137, 138, 139, 140, 178, 179, 202, 203, 204, 205, 223, 224, 244, 245, 246, 247, 263, 264, 286, 287, 288, 289, 323, 324, 325], "log": [0, 5, 10, 91, 92, 94, 95, 97, 98, 99, 100, 101, 108, 111, 112, 142, 173, 218, 259, 303, 323, 324, 325], "pre": [0, 2, 9, 10, 91, 92, 93, 96, 97, 98, 99, 103, 149, 323], "built": [0, 5, 91, 92, 93, 96, 97, 98, 324, 325], "index": [0, 5, 6, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 91, 92, 93, 94, 95, 96, 97, 98, 99, 120, 122, 141, 189, 190, 233, 234, 274, 275, 317, 323], "target": [0, 10, 91, 92, 93, 96, 97, 98, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 324], "genom": [0, 1, 4, 9, 10, 11, 12, 21, 22, 23, 24, 30, 31, 37, 40, 41, 50, 51, 52, 53, 59, 60, 65, 66, 69, 72, 75, 91, 92, 93, 94, 95, 99, 103, 117, 118, 119, 127, 128, 137, 138, 139, 140, 174, 186, 187, 188, 196, 197, 202, 203, 204, 205, 219, 230, 231, 232, 238, 239, 244, 245, 246, 247, 260, 271, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 312, 323, 324, 325], "either": [0, 5, 8, 9, 10, 24, 30, 31, 35, 40, 53, 59, 60, 64, 65, 66, 67, 72, 73, 76, 77, 91, 92, 97, 98, 100, 101, 117, 134, 170, 186, 200, 215, 230, 242, 256, 271, 284, 300, 323, 324, 325], "download": [0, 2, 5, 7, 91, 92, 93, 96, 97, 98, 323, 324], "websit": [0, 1, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 91, 92, 93, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "menu": [0, 2, 5, 8, 91, 92, 93, 323, 324, 325], "right": [0, 5, 7, 8, 91, 92, 93, 323, 324, 325], "fasta": [0, 91, 92, 93, 96, 97, 98, 99, 323, 324], "bowtie2_create_index": [0, 91, 92, 324], "note": [0, 5, 10, 24, 30, 40, 53, 59, 72, 91, 92, 97, 98, 132, 323, 324, 325], "indic": [0, 5, 10, 18, 21, 22, 23, 24, 25, 30, 31, 35, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 73, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 103, 107, 110, 114, 115, 116, 117, 118, 119, 134, 136, 143, 154, 158, 170, 175, 176, 177, 181, 183, 184, 185, 186, 187, 188, 200, 201, 207, 215, 220, 221, 222, 226, 228, 229, 230, 231, 232, 242, 243, 249, 256, 261, 262, 266, 268, 269, 270, 271, 272, 273, 284, 285, 291, 292, 300, 305, 312, 315, 316, 317, 323, 325], "compos": [0, 91, 92], "multipl": [0, 5, 6, 10, 18, 21, 22, 23, 24, 25, 30, 31, 38, 40, 47, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 70, 72, 76, 91, 92, 107, 114, 117, 118, 119, 126, 129, 151, 152, 153, 159, 161, 165, 166, 167, 168, 169, 175, 176, 186, 187, 188, 195, 211, 212, 220, 230, 231, 232, 237, 253, 254, 261, 271, 272, 273, 279, 296, 297, 305, 323], "bt2": [0, 91, 92, 93, 324], "suffix": [0, 2, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 91, 92, 93, 96, 99, 131, 132, 157, 210, 252, 292, 295], "all": [0, 1, 5, 7, 8, 9, 10, 16, 19, 21, 22, 23, 24, 25, 30, 31, 37, 38, 40, 41, 45, 48, 50, 51, 52, 53, 54, 59, 60, 64, 65, 66, 69, 70, 72, 73, 76, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 107, 108, 109, 111, 112, 114, 115, 116, 117, 118, 119, 121, 122, 123, 124, 125, 127, 128, 131, 132, 134, 135, 137, 138, 139, 140, 141, 143, 144, 145, 148, 151, 152, 153, 162, 164, 165, 166, 167, 168, 169, 173, 174, 176, 177, 180, 183, 184, 185, 186, 187, 188, 190, 192, 193, 194, 196, 197, 200, 202, 203, 204, 205, 213, 218, 219, 222, 225, 228, 229, 230, 231, 232, 234, 235, 236, 238, 239, 242, 244, 245, 246, 247, 255, 259, 260, 262, 265, 268, 269, 270, 271, 272, 273, 275, 277, 278, 280, 281, 284, 286, 287, 288, 289, 298, 304, 307, 308, 323, 324, 325], "same": [0, 4, 5, 6, 10, 77, 91, 92, 93, 94, 96, 97, 98, 103, 104, 107, 114, 126, 127, 128, 135, 141, 151, 152, 153, 159, 161, 165, 166, 167, 168, 169, 176, 177, 195, 196, 197, 211, 212, 222, 237, 238, 239, 253, 254, 279, 280, 281, 296, 297, 323, 324, 325], "locat": [0, 5, 91, 92, 323, 324, 325], "It": [0, 5, 10, 91, 92, 107, 114, 176, 323, 324, 325], "enough": [0, 91, 92, 323, 325], "specifi": [0, 1, 5, 8, 10, 21, 22, 23, 24, 30, 31, 34, 40, 50, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 74, 75, 91, 92, 93, 94, 95, 100, 101, 103, 107, 111, 112, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 131, 132, 143, 145, 148, 150, 151, 152, 153, 158, 159, 161, 162, 163, 164, 165, 167, 172, 173, 176, 177, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 211, 212, 213, 217, 218, 222, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 253, 254, 255, 258, 259, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 292, 296, 297, 298, 302, 303, 320, 323, 324, 325], "one": [0, 2, 5, 6, 7, 10, 21, 22, 23, 31, 37, 38, 50, 51, 52, 60, 69, 70, 76, 91, 92, 94, 95, 99, 100, 103, 111, 112, 117, 118, 119, 123, 152, 161, 162, 164, 167, 168, 169, 170, 174, 175, 186, 187, 188, 212, 213, 215, 219, 220, 230, 231, 232, 254, 255, 256, 260, 261, 271, 272, 273, 297, 298, 300, 304, 305, 323, 324, 325], "main": [0, 5, 91, 92, 323, 324, 325], "default": [0, 1, 2, 4, 5, 10, 14, 21, 22, 23, 24, 30, 31, 37, 40, 43, 50, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 300, 301, 302, 303, 304, 305, 306, 308, 323], "instal": [0, 1, 5, 6, 8, 10, 91, 92, 93, 94, 95, 96, 97, 98, 99, 111, 112, 323, 324, 325], "For": [0, 1, 2, 4, 7, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 108, 109, 111, 112, 118, 119, 125, 127, 128, 137, 138, 139, 140, 151, 163, 165, 166, 167, 169, 174, 180, 183, 187, 188, 193, 196, 197, 202, 203, 204, 205, 219, 225, 231, 232, 236, 238, 239, 244, 245, 246, 247, 260, 265, 268, 272, 273, 278, 280, 281, 286, 287, 288, 289, 292, 304, 307, 323, 324, 325], "c": [0, 2, 7, 9, 10, 23, 24, 30, 31, 40, 52, 53, 59, 60, 64, 65, 66, 72, 91, 92, 93, 94, 95, 96, 97, 98, 111, 112, 119, 121, 123, 129, 131, 132, 140, 141, 142, 143, 144, 146, 147, 149, 164, 188, 205, 232, 247, 273, 289, 292, 323, 325], "program": [0, 2, 6, 7, 10, 91, 92, 93, 94, 95, 96, 97, 98, 111, 112, 323, 324, 325], "5": [0, 2, 6, 7, 10, 91, 92, 93, 99, 100, 101, 109, 121, 123, 125, 133, 136, 140, 143, 163, 164, 165, 171, 172, 180, 193, 199, 201, 205, 216, 217, 225, 236, 241, 243, 247, 257, 258, 265, 278, 283, 285, 289, 292, 301, 302, 307, 316, 317, 323, 324, 325], "set": [0, 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 70, 71, 72, 73, 75, 76, 77, 91, 92, 93, 94, 95, 96, 97, 98, 99, 102, 103, 108, 110, 116, 134, 136, 140, 143, 167, 170, 175, 177, 181, 185, 200, 201, 205, 215, 220, 222, 226, 229, 242, 243, 247, 256, 261, 262, 266, 270, 284, 285, 289, 292, 300, 305, 312, 315, 316, 317, 318, 319, 321, 322], "attempt": [0, 2, 5, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 91, 92, 93, 96, 97, 98, 99, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "find": [0, 2, 5, 9, 10, 91, 92, 93, 96, 97, 98, 99, 127, 128, 163, 165, 166, 196, 197, 238, 239, 280, 281, 323, 324, 325], "automat": [0, 5, 6, 7, 8, 9, 10, 37, 69, 73, 91, 92, 93, 94, 95, 96, 97, 98, 99, 103, 104, 107, 108, 114, 129, 132, 135, 143, 151, 152, 155, 156, 157, 158, 165, 166, 167, 168, 169, 174, 176, 177, 208, 209, 210, 219, 221, 222, 250, 251, 252, 260, 262, 293, 294, 295, 304, 323, 324, 325], "give": [0, 1, 5, 10, 91, 92, 94, 95, 97, 98, 99, 129, 143, 323], "new": [0, 1, 2, 6, 10, 15, 18, 21, 22, 23, 25, 35, 37, 38, 44, 47, 50, 51, 52, 54, 67, 69, 70, 91, 92, 94, 95, 97, 98, 99, 102, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 129, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 161, 162, 164, 165, 166, 167, 168, 169, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 212, 213, 214, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 254, 255, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 292, 297, 299, 302, 303, 304, 308, 323], "each": [0, 2, 4, 5, 10, 24, 30, 31, 40, 53, 59, 60, 72, 76, 91, 92, 94, 95, 97, 98, 99, 100, 101, 104, 105, 106, 111, 112, 122, 135, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 152, 153, 160, 161, 163, 165, 166, 167, 168, 169, 177, 178, 179, 190, 202, 203, 204, 205, 212, 223, 224, 234, 244, 245, 246, 247, 254, 263, 264, 275, 286, 287, 288, 289, 297, 323, 324, 325], "quantifi": [0, 91, 92, 94, 95, 97, 98, 99, 324], "sampl": [0, 1, 5, 9, 10, 31, 60, 91, 92, 94, 95, 97, 98, 99, 104, 107, 108, 111, 112, 114, 123, 141, 142, 143, 144, 149, 151, 152, 153, 158, 164, 166, 176, 323, 324, 325], "If": [0, 1, 2, 7, 8, 9, 10, 21, 22, 23, 24, 30, 31, 33, 37, 40, 50, 51, 52, 53, 59, 60, 62, 64, 65, 66, 69, 72, 73, 76, 91, 92, 94, 95, 97, 98, 99, 104, 107, 108, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 155, 156, 157, 158, 159, 160, 165, 166, 167, 168, 169, 170, 172, 173, 174, 175, 176, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 200, 201, 202, 203, 204, 205, 206, 208, 209, 210, 211, 215, 217, 218, 219, 220, 221, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 242, 243, 244, 245, 246, 247, 248, 250, 251, 252, 253, 256, 258, 259, 260, 261, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 284, 285, 286, 287, 288, 289, 290, 292, 293, 294, 295, 296, 300, 302, 303, 304, 305, 308, 323, 324, 325], "sample_nam": [0, 10, 91, 92, 94, 95, 97, 98, 99, 108], "otherwis": [0, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 73, 91, 92, 94, 95, 97, 98, 99, 100, 101, 105, 106, 135, 137, 138, 139, 140, 145, 148, 153, 159, 160, 165, 166, 167, 168, 169, 174, 178, 179, 202, 203, 204, 205, 211, 219, 223, 224, 244, 245, 246, 247, 253, 260, 263, 264, 286, 287, 288, 289, 296, 304, 308, 323, 324, 325], "order": [0, 2, 4, 5, 8, 10, 31, 40, 60, 64, 72, 91, 92, 94, 95, 97, 98, 99, 100, 101, 102, 103, 121, 123, 126, 148, 154, 159, 160, 161, 164, 195, 207, 211, 212, 237, 249, 253, 254, 279, 291, 296, 297, 307, 323, 324, 325], "match": [0, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 91, 92, 94, 95, 97, 98, 99, 100, 101, 104, 105, 115, 116, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 161, 178, 184, 185, 187, 188, 196, 197, 202, 203, 204, 205, 212, 223, 228, 229, 231, 232, 238, 239, 244, 245, 246, 247, 254, 263, 269, 270, 272, 273, 280, 281, 286, 287, 288, 289, 297, 323, 324, 325], "determin": [0, 5, 9, 10, 14, 22, 24, 30, 31, 37, 40, 43, 51, 53, 59, 60, 64, 65, 66, 69, 72, 73, 76, 77, 91, 92, 93, 98, 99, 100, 105, 106, 107, 108, 114, 115, 116, 118, 122, 135, 136, 145, 148, 151, 152, 158, 165, 166, 167, 168, 169, 174, 176, 178, 179, 184, 185, 187, 190, 194, 201, 219, 221, 223, 224, 228, 229, 231, 234, 243, 260, 263, 264, 269, 270, 272, 275, 285, 304, 308, 323, 324, 325], "look": [0, 1, 2, 5, 6, 91, 92, 97, 98, 323, 324, 325], "involv": [0, 91, 92], "charact": [0, 5, 10, 91, 92, 99, 315, 316], "allow": [0, 1, 2, 5, 9, 10, 91, 92, 94, 95, 100, 101, 102, 165, 323, 324, 325], "clip": [0, 91, 92], "nucleotid": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 91, 92, 99, 100, 101, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "both": [0, 1, 4, 5, 7, 10, 24, 30, 35, 40, 53, 59, 64, 65, 66, 67, 72, 91, 92, 94, 100, 107, 114, 117, 137, 138, 139, 140, 151, 165, 170, 176, 186, 202, 203, 204, 205, 215, 230, 244, 245, 246, 247, 256, 271, 286, 287, 288, 289, 300, 323, 324, 325], "side": [0, 91, 92, 323, 325], "maxim": [0, 91, 92, 324, 325], "score": [0, 10, 24, 30, 40, 53, 59, 72, 73, 74, 91, 92, 94, 95, 100, 101, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289, 292, 323, 324, 325], "preset": [0, 91, 92], "higher": [0, 10, 91, 92, 166, 292, 323, 324, 325], "accur": [0, 1, 5, 91, 92, 324, 325], "take": [0, 5, 7, 9, 10, 76, 91, 92, 140, 165, 205, 247, 289, 323, 324, 325], "longer": [0, 5, 91, 92, 94], "calcul": [0, 5, 10, 18, 24, 25, 30, 31, 35, 38, 40, 47, 53, 54, 59, 60, 64, 65, 66, 67, 70, 72, 91, 92, 110, 129, 134, 136, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 165, 166, 167, 168, 169, 170, 175, 181, 200, 201, 205, 215, 220, 226, 242, 243, 247, 256, 261, 262, 266, 284, 285, 289, 292, 300, 305, 323], "ignor": [0, 10, 91, 92, 145, 148, 299, 324, 325], "qualiti": [0, 5, 91, 92, 94, 95, 100, 101, 324, 325], "treat": [0, 10, 91, 92, 99, 112], "them": [0, 1, 2, 5, 8, 10, 12, 24, 30, 40, 41, 53, 59, 64, 65, 66, 72, 91, 92, 94, 100, 111, 112, 131, 132, 158, 221, 323, 324, 325], "maximum": [0, 10, 91, 92, 94, 100, 101, 164, 167, 168, 169, 324], "encod": [0, 5, 91, 92], "most": [0, 1, 4, 5, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "modern": [0, 91, 92], "setup": [0, 1, 2, 5, 7, 10, 91, 92, 165, 323], "phred": [0, 91, 92], "33": [0, 10, 91, 92, 109, 140, 180, 205, 225, 247, 265, 289], "minimum": [0, 10, 64, 65, 66, 91, 94, 95, 99, 100, 101, 140, 152, 165, 166, 205, 247, 289, 323, 324, 325], "fragment": [0, 91, 94, 95, 98, 323, 324], "length": [0, 10, 91, 94, 96, 98, 126, 145, 148, 159, 195, 211, 237, 253, 279, 296, 323, 324, 325], "valid": [0, 10, 65, 66, 91, 94, 99, 103, 140, 177, 205, 247, 262, 289, 323, 324, 325], "seed": [0, 10, 24, 53, 91, 92, 93, 168, 169, 323, 324, 325], "pseudo": [0, 10, 91, 92, 93, 140, 142, 205, 247, 289], "random": [0, 5, 7, 10, 24, 30, 40, 53, 59, 72, 91, 92, 93, 99, 112, 137, 138, 139, 140, 168, 169, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 292, 323, 325], "number": [0, 4, 5, 9, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 105, 106, 118, 119, 123, 127, 128, 133, 137, 138, 139, 140, 141, 144, 150, 152, 164, 165, 166, 167, 168, 169, 171, 172, 174, 178, 179, 187, 188, 196, 197, 199, 202, 203, 204, 205, 206, 216, 217, 219, 223, 224, 231, 232, 238, 239, 241, 244, 245, 246, 247, 248, 257, 258, 260, 263, 264, 272, 273, 280, 281, 283, 286, 287, 288, 289, 290, 292, 301, 302, 304, 323, 324, 325], "run": [0, 1, 4, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 91, 92, 93, 94, 95, 99, 100, 101, 102, 111, 112, 165, 166, 167, 168, 169, 292, 324, 325], "build": [0, 9, 10, 91, 92, 93, 94, 95, 96, 99, 111, 112, 325], "make": [0, 1, 2, 5, 6, 7, 9, 10, 91, 92, 93, 94, 95, 99, 168, 169, 323, 324, 325], "faster": [0, 5, 8, 91, 92, 93, 94, 95, 99], "bowtie2_align_single_end": [0, 324], "fastq_fold": [0, 92, 98, 99, 101, 324], "singl": [0, 1, 2, 4, 5, 7, 9, 10, 92, 95, 98, 99, 100, 101, 107, 108, 112, 114, 131, 132, 151, 160, 167, 168, 169, 176, 262, 323], "want": [0, 1, 7, 10, 75, 92, 94, 95, 98, 99, 323, 324, 325], "genome_fasta": [0, 93, 99, 324], "index_nam": [0, 93], "bowti": [0, 9, 93], "first": [0, 5, 7, 10, 18, 47, 76, 77, 93, 94, 97, 98, 100, 110, 111, 112, 122, 126, 133, 134, 137, 138, 139, 140, 141, 142, 143, 144, 148, 152, 158, 159, 162, 164, 170, 181, 190, 195, 199, 200, 202, 203, 204, 205, 211, 213, 214, 215, 226, 234, 237, 241, 242, 244, 245, 246, 247, 253, 255, 256, 262, 266, 275, 279, 283, 284, 286, 287, 288, 289, 296, 298, 299, 300, 307, 323, 324, 325], "Be": [0, 93, 96], "awar": [0, 93, 96], "popular": [0, 93, 96, 323], "model": [0, 5, 9, 10, 93, 96, 97, 98, 112, 323, 324, 325], "organ": [0, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 93, 96, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "These": [0, 5, 10, 11, 93, 94, 95, 96, 99, 323, 324, 325], "basenam": [0, 93], "creat": [0, 1, 5, 6, 9, 10, 93, 158, 165, 221, 308], "3": [0, 1, 2, 9, 10, 77, 93, 99, 100, 101, 106, 109, 117, 124, 133, 136, 140, 143, 152, 165, 168, 169, 171, 179, 180, 186, 191, 192, 199, 201, 205, 216, 224, 225, 230, 235, 241, 243, 247, 257, 264, 265, 271, 283, 285, 289, 301, 308, 315, 323, 324, 325], "4": [0, 6, 10, 77, 93, 94, 95, 99, 111, 112, 121, 133, 140, 159, 171, 194, 199, 205, 211, 216, 241, 247, 253, 257, 268, 283, 289, 296, 301, 315, 316, 324, 325], "stem": [0, 93], "suppli": [0, 5, 10, 76, 77, 93, 99, 105, 106, 111, 112, 115, 116, 165, 173, 178, 179, 184, 185, 218, 223, 224, 228, 229, 259, 263, 264, 269, 270, 303, 323, 324, 325], "fa": [0, 10, 93, 140, 205, 247, 289], "gz": [0, 93], "featurecounts_paired_end": [0, 5, 324], "input_fold": [0, 87, 94, 95, 324], "gtf_file": [0, 10, 94, 95, 97, 98, 145, 148, 324], "gtf_feature_typ": [0, 94, 95, 324], "exon": [0, 10, 94, 95, 145, 148, 324], "gtf_attr_nam": [0, 94, 95, 324], "gene_id": [0, 94, 95], "r_installation_fold": [0, 10, 94, 95, 111, 112], "strand": [0, 94, 95, 97, 98, 99, 323], "forward": [0, 5, 94, 95, 97, 98, 323], "revers": [0, 5, 94, 95, 97, 98, 323], "min_mapping_qu": [0, 94, 95], "count_multi_mapping_read": [0, 94, 95], "count_multi_overlapping_read": [0, 94, 95], "ignore_secondari": [0, 94, 95], "count_fraction": [0, 94, 95], "is_long_read": [0, 94, 95], "require_both_map": [0, 94], "count_chimeric_frag": [0, 94], "50": [0, 9, 10, 31, 60, 94, 109, 140, 165, 168, 180, 205, 225, 247, 265, 289, 323, 324], "600": [0, 94], "report_read_assign": [0, 5, 94, 95], "bam": [0, 94, 95, 99, 324, 325], "core": [0, 10, 94, 95, 100, 101, 166], "countfilt": [0, 4, 5, 10, 12, 41, 94, 95, 97, 98, 181, 215, 226, 256, 266, 278, 300, 306, 308, 325], "datafram": [0, 5, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 64, 65, 66, 72, 94, 95, 103, 105, 106, 109, 125, 127, 128, 130, 131, 132, 133, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 162, 171, 177, 178, 179, 180, 193, 196, 197, 198, 199, 202, 203, 204, 205, 213, 216, 222, 223, 224, 225, 236, 238, 239, 240, 241, 244, 245, 246, 247, 255, 257, 262, 263, 264, 265, 280, 281, 282, 283, 286, 287, 288, 289, 292, 301, 320, 324, 325], "assign": [0, 10, 94, 95, 166, 324], "map": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 94, 95, 97, 98, 99, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "rsubread": [0, 94, 95, 324], "matrix": [0, 5, 10, 94, 95, 103, 104, 111, 112, 141, 142, 143, 144, 145, 146, 147, 148, 165, 323, 324], "input": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 72, 94, 95, 107, 108, 114, 127, 128, 131, 132, 137, 138, 139, 140, 151, 152, 153, 155, 156, 157, 176, 196, 197, 202, 203, 204, 205, 208, 209, 210, 238, 239, 244, 245, 246, 247, 250, 251, 252, 280, 281, 286, 287, 288, 289, 293, 294, 295, 323, 324, 325], "summar": [0, 10, 94, 95, 97, 98, 109, 180, 225, 265, 323, 324], "were": [0, 2, 5, 10, 94, 95, 102, 103, 125, 139, 161, 165, 166, 177, 193, 204, 212, 222, 236, 246, 254, 262, 288, 297, 323, 324, 325], "statist": [0, 1, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 94, 95, 97, 98, 105, 106, 109, 165, 166, 167, 168, 169, 178, 179, 180, 223, 224, 225, 262, 263, 264, 265, 323], "quantfi": [0, 94, 95], "r": [0, 5, 7, 9, 10, 73, 74, 75, 77, 94, 95, 97, 98, 111, 112, 140, 142, 143, 144, 151, 205, 247, 289, 323, 324, 325], "script": [0, 1, 2, 5, 10, 94, 111, 112], "gtf": [0, 5, 10, 94, 95, 97, 98, 105, 115, 145, 148, 178, 184, 223, 228, 263, 269, 323, 324], "annot": [0, 1, 2, 5, 9, 10, 22, 23, 24, 30, 40, 51, 52, 53, 59, 64, 65, 66, 72, 94, 95, 97, 98, 118, 119, 127, 128, 137, 138, 139, 140, 145, 148, 158, 187, 188, 196, 197, 202, 203, 204, 205, 221, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "thi": [0, 1, 2, 4, 5, 7, 9, 10, 11, 13, 16, 18, 19, 24, 25, 28, 29, 30, 35, 38, 40, 42, 45, 47, 48, 53, 54, 57, 58, 59, 64, 65, 66, 67, 70, 72, 76, 94, 95, 97, 98, 99, 100, 101, 102, 103, 107, 111, 112, 114, 126, 132, 137, 138, 139, 140, 141, 142, 143, 144, 145, 148, 159, 160, 163, 165, 167, 176, 195, 202, 203, 204, 205, 211, 237, 244, 245, 246, 247, 253, 262, 279, 286, 287, 288, 289, 296, 312, 319, 323, 324, 325], "chromosom": [0, 94, 95, 324], "ones": [0, 10, 30, 40, 59, 64, 72, 94, 95, 97, 98, 145, 148], "select": [0, 2, 5, 8, 10, 94, 95, 166, 323, 324, 325], "row": [0, 1, 4, 5, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 94, 95, 103, 105, 106, 115, 116, 117, 120, 121, 122, 123, 124, 125, 126, 133, 137, 138, 139, 140, 150, 159, 171, 172, 174, 177, 178, 179, 183, 184, 185, 186, 189, 190, 191, 192, 193, 194, 195, 199, 202, 203, 204, 205, 206, 211, 216, 217, 219, 222, 223, 224, 228, 229, 230, 233, 234, 235, 236, 237, 241, 244, 245, 246, 247, 248, 253, 257, 258, 260, 262, 263, 264, 268, 269, 270, 271, 274, 275, 276, 277, 279, 283, 286, 287, 288, 289, 290, 292, 296, 301, 302, 304, 323, 324, 325], "attribut": [0, 4, 5, 9, 10, 11, 21, 22, 23, 31, 40, 50, 51, 52, 60, 64, 65, 66, 72, 76, 77, 94, 95, 103, 105, 115, 117, 118, 119, 161, 177, 178, 184, 186, 187, 188, 212, 222, 223, 228, 230, 231, 232, 254, 262, 263, 269, 271, 272, 273, 297, 306, 318, 321], "group": [0, 5, 8, 10, 94, 95, 103, 104, 107, 114, 122, 140, 141, 151, 152, 153, 165, 176, 190, 205, 234, 247, 275, 289, 292, 323, 324, 325], "eg": [0, 94, 95], "meta": [0, 94, 95], "gene": [0, 1, 2, 4, 5, 6, 9, 10, 11, 12, 14, 22, 23, 24, 30, 31, 37, 40, 41, 43, 51, 52, 53, 59, 60, 64, 65, 66, 69, 72, 73, 75, 94, 95, 97, 98, 103, 104, 105, 106, 115, 118, 119, 127, 128, 137, 138, 139, 140, 141, 142, 143, 144, 145, 148, 153, 158, 160, 163, 165, 166, 174, 177, 178, 179, 184, 187, 188, 194, 196, 197, 202, 203, 204, 205, 219, 221, 223, 224, 228, 231, 232, 238, 239, 244, 245, 246, 247, 260, 262, 263, 264, 269, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 315], "stranded": [0, 94, 95, 97, 98], "data": [0, 1, 4, 5, 6, 9, 10, 73, 94, 95, 97, 98, 99, 102, 105, 106, 115, 116, 131, 132, 137, 138, 139, 140, 151, 152, 153, 155, 156, 157, 158, 160, 163, 165, 166, 167, 168, 169, 173, 178, 179, 184, 185, 202, 203, 204, 205, 208, 209, 210, 218, 221, 223, 224, 228, 229, 244, 245, 246, 247, 250, 251, 252, 259, 263, 264, 269, 270, 286, 287, 288, 289, 293, 294, 295, 303], "where": [0, 2, 4, 5, 8, 10, 21, 22, 23, 31, 50, 51, 52, 60, 76, 77, 94, 95, 97, 98, 99, 117, 118, 119, 158, 163, 186, 187, 188, 230, 231, 232, 271, 272, 273, 320, 323, 324, 325], "must": [0, 10, 33, 62, 65, 66, 94, 95, 99, 100, 101, 107, 111, 112, 114, 126, 141, 151, 152, 153, 159, 165, 167, 176, 195, 211, 237, 253, 279, 296, 308, 324, 325], "satisfi": [0, 94, 95], "least": [0, 5, 7, 10, 21, 22, 23, 38, 50, 51, 52, 65, 66, 70, 94, 99, 100, 111, 112, 117, 118, 119, 123, 136, 139, 164, 165, 175, 186, 187, 188, 201, 204, 220, 230, 231, 232, 243, 246, 261, 271, 272, 273, 285, 288, 305, 323, 324, 325], "criteria": [0, 94, 100, 325], "multi": [0, 94, 95, 99], "nh": [0, 94, 95], "tag": [0, 1, 94, 95], "than": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 72, 94, 95, 100, 101, 143, 150, 183, 206, 248, 268, 290, 292, 307, 323, 324, 325], "found": [0, 5, 10, 94, 95, 100, 101, 122, 137, 138, 139, 140, 165, 166, 190, 202, 203, 204, 205, 234, 244, 245, 246, 247, 275, 286, 287, 288, 289, 323, 324, 325], "overlap": [0, 10, 31, 60, 94, 95, 99, 145, 148, 162, 164, 165, 166, 167, 168, 169, 213, 214, 255, 298, 299, 323, 324, 325], "onli": [0, 4, 5, 7, 10, 21, 22, 23, 24, 30, 31, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 94, 95, 99, 100, 101, 110, 112, 116, 117, 118, 119, 123, 125, 126, 127, 133, 134, 136, 137, 139, 140, 150, 161, 164, 167, 172, 181, 183, 185, 186, 187, 188, 191, 193, 194, 195, 196, 199, 200, 201, 202, 204, 205, 206, 212, 214, 217, 226, 229, 230, 231, 232, 236, 237, 238, 241, 242, 243, 244, 246, 247, 248, 254, 258, 266, 268, 270, 271, 272, 273, 276, 279, 280, 283, 284, 285, 286, 288, 289, 290, 292, 297, 299, 302, 323, 324, 325], "primari": [0, 94, 95, 323, 325], "secondari": [0, 94, 95, 99], "identifi": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 94, 95, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324], "bit": [0, 1, 94, 95, 323], "0x100": [0, 94, 95], "flag": [0, 10, 94, 95, 139, 204, 246, 288], "field": [0, 10, 94, 95, 165, 323, 325], "dataset": [0, 5, 8, 10, 76, 94, 95, 109, 151, 180, 225, 265], "matter": [0, 94, 95, 323, 324, 325], "fraction": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 94, 95, 99, 100, 101, 125, 140, 143, 144, 158, 162, 163, 165, 193, 194, 205, 213, 221, 236, 247, 255, 278, 289, 292, 298, 323], "produc": [0, 94, 95, 98, 324], "long": [0, 5, 10, 94, 95, 105, 106, 178, 179, 223, 224, 263, 264, 323, 324, 325], "nanopor": [0, 94, 95], "pacbio": [0, 94, 95], "detail": [0, 1, 4, 94, 95, 323, 324], "three": [0, 5, 10, 94, 95, 97, 98, 111, 112, 323, 324, 325], "requir": [0, 7, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 94, 97, 98, 99, 100, 140, 205, 247, 289, 292, 323, 324, 325], "successfulli": [0, 2, 5, 94, 323], "befor": [0, 1, 2, 5, 10, 94, 148, 323, 325], "whether": [0, 1, 5, 10, 28, 29, 57, 58, 94, 99, 100, 103, 105, 115, 165, 178, 184, 223, 228, 263, 269, 292, 308, 323, 324, 325], "chimer": [0, 94, 324], "ha": [0, 2, 5, 10, 13, 42, 94, 99, 140, 164, 205, 214, 247, 289, 299, 323, 324, 325], "its": [0, 4, 8, 10, 94, 97, 98, 102, 135, 145, 148, 153, 158, 161, 165, 166, 167, 168, 169, 212, 221, 254, 297, 323, 324, 325], "two": [0, 1, 2, 4, 5, 7, 9, 10, 27, 35, 56, 67, 94, 111, 112, 131, 132, 136, 162, 164, 183, 191, 201, 213, 214, 243, 255, 262, 268, 276, 285, 298, 299, 323, 324, 325], "differ": [0, 1, 4, 5, 6, 10, 35, 36, 67, 68, 94, 97, 98, 137, 138, 139, 140, 149, 152, 165, 168, 169, 170, 202, 203, 204, 205, 215, 244, 245, 246, 247, 256, 286, 287, 288, 289, 292, 300, 323, 324, 325], "shorter": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 94, 100, 101, 165, 166, 167, 168, 169, 323, 324], "pd": [0, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 94, 95, 140, 205, 247, 289], "featurecounts_single_end": [0, 5, 324], "alphabet": [0, 5, 10, 95, 103], "directori": [0, 2, 5, 7, 10, 95, 111, 112, 320, 324, 325], "kallisto_create_index": [0, 97, 98, 324], "transcriptome_fasta": [0, 96], "kallisto_installation_fold": [0, 96, 97, 98, 324], "kmer_length": [0, 96, 324], "31": [0, 6, 9, 10, 96, 140, 205, 247, 289, 324], "make_uniqu": [0, 5, 96, 324], "transcriptom": [0, 1, 96, 97, 98, 323, 324, 325], "idx": [0, 96, 324], "site": [0, 5, 96, 97, 98, 324, 325], "desir": [0, 8, 96, 323], "odd": [0, 96, 324], "between": [0, 2, 4, 5, 6, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 77, 96, 99, 100, 101, 109, 125, 129, 134, 136, 140, 141, 142, 143, 144, 151, 152, 158, 162, 163, 165, 166, 167, 169, 175, 180, 183, 191, 193, 194, 200, 201, 205, 213, 220, 221, 225, 236, 242, 243, 247, 255, 261, 262, 265, 268, 276, 278, 284, 285, 289, 292, 298, 305, 324, 325], "k": [0, 5, 9, 10, 96, 140, 165, 168, 169, 205, 247, 289], "mer": [0, 96, 324], "replac": [0, 5, 96, 324, 325], "repeat": [0, 10, 96, 165, 323, 324], "uniqu": [0, 10, 96, 99, 127, 131, 132, 137, 138, 139, 140, 196, 202, 203, 204, 205, 238, 244, 245, 246, 247, 280, 286, 287, 288, 289], "kallisto_quantify_paired_end": [0, 324], "bootstrap_sampl": [0, 97, 98], "legacy_arg": [0, 97, 98], "abund": [0, 97, 98, 99, 323, 324], "mrna": [0, 5, 97, 98, 323], "own": [0, 10, 76, 77, 97, 98, 135, 153, 165, 166, 167, 168, 169, 323, 324, 325], "sub": [0, 5, 97, 98, 323, 324, 325], "alongsid": [0, 5, 97, 98, 323, 324], "per": [0, 1, 5, 10, 74, 75, 97, 98, 99, 103, 105, 106, 112, 132, 141, 145, 146, 147, 148, 153, 167, 168, 169, 178, 179, 223, 224, 263, 264, 323, 324, 325], "tabl": [0, 1, 4, 5, 9, 10, 21, 23, 24, 30, 31, 37, 40, 50, 52, 53, 59, 60, 64, 69, 72, 73, 74, 76, 77, 97, 98, 103, 105, 106, 111, 112, 113, 115, 116, 117, 119, 120, 131, 132, 137, 138, 139, 140, 147, 149, 157, 160, 161, 163, 174, 177, 178, 179, 182, 184, 185, 186, 188, 189, 202, 203, 204, 205, 210, 212, 219, 222, 223, 224, 227, 228, 229, 230, 232, 233, 244, 245, 246, 247, 252, 254, 260, 262, 263, 264, 267, 269, 270, 271, 273, 274, 286, 287, 288, 289, 295, 297, 298, 304, 312, 318, 321, 322, 323], "scale": [0, 1, 5, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 97, 98, 107, 114, 141, 142, 143, 144, 145, 146, 147, 148, 149, 176, 323, 324, 325], "scaledtpm": [0, 97, 98, 323, 324], "librari": [0, 2, 5, 10, 97, 98, 99, 103, 147, 149, 323, 324], "size": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 76, 77, 97, 98, 99, 107, 108, 114, 135, 151, 152, 158, 165, 166, 176, 221, 292, 323, 324, 325], "describ": [0, 7, 9, 10, 97, 98, 99, 105, 106, 115, 127, 128, 137, 138, 139, 140, 178, 179, 184, 196, 197, 202, 203, 204, 205, 223, 224, 228, 238, 239, 244, 245, 246, 247, 263, 264, 269, 280, 281, 286, 287, 288, 289, 323, 324, 325], "soneson": [0, 97, 98, 323, 324], "et": [0, 5, 9, 10, 22, 24, 51, 53, 65, 97, 98, 99, 118, 141, 144, 187, 231, 272, 323, 324], "al": [0, 5, 9, 10, 22, 24, 51, 53, 65, 97, 98, 99, 118, 141, 144, 187, 231, 272, 323, 324], "2015": [0, 5, 9, 97, 98, 323, 324], "tximport": [0, 97, 98, 323, 324], "packag": [0, 2, 5, 6, 9, 97, 98, 106, 179, 224, 264, 323, 324], "consid": [0, 5, 10, 65, 66, 97, 98, 99, 140, 165, 166, 205, 247, 289, 323, 324, 325], "un": [0, 97, 98, 323, 324], "normal": [0, 2, 4, 5, 9, 10, 97, 98, 102, 103, 107, 112, 114, 132, 141, 142, 143, 144, 145, 146, 147, 148, 149, 153, 165, 176, 307, 323], "therefor": [0, 97, 98, 323, 324, 325], "directli": [0, 5, 97, 98, 323, 324, 325], "infer": [0, 5, 97, 98, 99, 323, 324], "deseq2": [0, 2, 4, 5, 7, 9, 10, 97, 98, 111, 142], "onc": [0, 2, 5, 7, 10, 97, 98, 145, 148, 165, 323, 324, 325], "analysi": [0, 1, 4, 5, 6, 7, 9, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 97, 98, 99, 111, 112, 118, 152, 160, 163, 165, 166, 167, 168, 169, 187, 231, 272], "finish": [0, 2, 5, 97, 98, 323, 324], "resid": [0, 97, 98], "within": [0, 5, 7, 10, 97, 98, 104, 127, 128, 141, 142, 144, 196, 197, 238, 239, 280, 281, 323, 324, 325], "itself": [0, 26, 36, 39, 55, 68, 71, 97, 98, 324, 325], "we": [0, 2, 5, 8, 97, 98, 324, 325], "recommend": [0, 6, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 97, 98, 107, 114, 176, 292, 324, 325], "cdna": [0, 97, 98], "sourc": [0, 1, 6, 9, 10, 97, 98, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 323, 325], "pseudoalign": [0, 97, 98, 323, 324], "learn_bia": [0, 5, 97, 98], "learn": [0, 2, 9, 10, 21, 50, 97, 98, 117, 186, 230, 271, 323, 324, 325], "specif": [0, 2, 5, 8, 9, 10, 22, 23, 24, 30, 31, 40, 51, 52, 53, 59, 60, 72, 97, 98, 113, 118, 119, 120, 160, 163, 182, 187, 188, 189, 227, 231, 232, 233, 262, 267, 272, 273, 274, 292, 324, 325], "bia": [0, 97, 98, 324, 325], "correct": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 97, 98], "accordlingli": [0, 97, 98], "support": [0, 1, 4, 5, 8, 9, 10, 24, 30, 40, 53, 59, 72, 97, 98, 99, 165, 166, 167, 169, 262, 307, 323, 324, 325], "version": [0, 1, 5, 7, 10, 97, 98, 99, 111, 112, 165, 323, 324, 325], "beyond": [0, 97, 98], "48": [0, 5, 10, 97, 98, 106, 140, 179, 205, 224, 247, 264, 289, 324], "seek_fusion_gen": [0, 5, 97, 98], "doe": [0, 5, 10, 20, 21, 22, 23, 24, 30, 40, 49, 50, 51, 52, 53, 59, 64, 65, 66, 72, 97, 98, 117, 118, 119, 131, 132, 165, 166, 167, 168, 169, 186, 187, 188, 230, 231, 232, 262, 271, 272, 273, 323, 324, 325], "addition": [0, 97, 98, 325], "becaus": [0, 97, 98, 323, 324], "potenti": [0, 97, 98, 323, 324, 325], "fusion": [0, 97, 98], "written": [0, 97, 98, 323], "txt": [0, 2, 5, 10, 34, 63, 97, 98, 131, 132], "bootstrap": [0, 97, 98], "affect": [0, 5, 8, 10, 21, 22, 23, 24, 30, 40, 50, 51, 52, 53, 59, 64, 65, 66, 72, 97, 98, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 165, 166, 167, 168, 169, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 302, 303, 304, 323, 324, 325], "valu": [0, 1, 2, 4, 5, 10, 24, 30, 31, 40, 41, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 97, 98, 100, 101, 104, 105, 106, 107, 109, 114, 122, 123, 124, 125, 126, 143, 144, 150, 158, 159, 165, 166, 167, 168, 169, 172, 173, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 206, 211, 217, 218, 221, 223, 224, 225, 234, 235, 236, 237, 248, 253, 258, 259, 262, 263, 264, 265, 275, 276, 277, 278, 279, 290, 292, 296, 302, 303, 307, 323, 324, 325], "addit": [0, 1, 2, 5, 7, 8, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 97, 98, 99, 105, 106, 166, 173, 178, 179, 218, 223, 224, 259, 263, 264, 303, 308, 323, 324, 325], "hdf5": [0, 97, 98], "uncertainti": [0, 97, 98], "express": [0, 2, 4, 5, 6, 8, 9, 10, 41, 97, 98, 102, 104, 111, 112, 123, 141, 142, 143, 144, 153, 164, 165, 166, 167, 168, 169, 177, 315, 316], "level": [0, 2, 10, 41, 97, 98, 99, 100, 101, 111, 112, 164, 323, 324, 325], "sleuth": [0, 97, 98], "downstream": [0, 12, 41, 97, 98, 323, 325], "differenti": [0, 2, 4, 5, 6, 8, 9, 10, 97, 98, 99, 102, 111, 112, 143, 177, 324], "tradit": [0, 97, 98, 323, 324, 325], "edger": [0, 10, 97, 98, 143, 324, 325], "kallisto_quantify_single_end": [0, 324], "average_fragment_length": [0, 98, 324], "float": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 98, 99, 100, 101, 107, 108, 109, 114, 121, 123, 125, 135, 136, 140, 143, 144, 150, 151, 152, 158, 162, 163, 164, 165, 166, 167, 172, 176, 180, 183, 193, 201, 205, 206, 213, 217, 221, 225, 236, 243, 247, 248, 255, 258, 265, 268, 278, 285, 289, 290, 292, 298, 302], "stdev_fragment_length": [0, 98, 324], "averag": [0, 10, 98, 104, 107, 108, 114, 129, 151, 153, 158, 165, 166, 167, 176, 323, 324, 325], "typic": [0, 10, 98, 99, 112], "illumina": [0, 98, 323], "rang": [0, 8, 10, 98, 99, 140, 205, 247, 289, 324], "180": [0, 10, 98, 140, 166, 205, 247, 289], "200bp": [0, 98], "": [0, 1, 2, 5, 8, 9, 10, 12, 18, 22, 24, 25, 38, 47, 51, 53, 54, 65, 70, 76, 77, 98, 99, 103, 109, 111, 112, 118, 140, 141, 142, 143, 144, 147, 155, 156, 157, 165, 177, 180, 187, 205, 208, 209, 210, 222, 225, 231, 247, 250, 251, 252, 262, 265, 272, 289, 293, 294, 295, 323, 324, 325], "best": [0, 1, 2, 6, 10, 98, 99, 168, 169, 324], "instrument": [0, 98], "agil": [0, 98], "bioanalyz": [0, 98], "standard": [0, 5, 10, 98, 152, 153, 173, 218, 259, 303, 323, 324], "deviat": [0, 98, 323, 324], "shortstack_align_smallrna": [0, 5], "shortstack_installation_fold": [0, 99], "known_rna": [0, 99], "trim_adapt": [0, 99], "autotrim": [0, 99], "autotrim_kei": [0, 99], "tcggaccaggcttcattcccc": [0, 99], "multimap_mod": [0, 99], "align_onli": [0, 99], "show_secondary_align": [0, 99], "dicer_min_length": [0, 99], "21": [0, 9, 10, 99, 109, 125, 140, 162, 180, 193, 205, 213, 225, 236, 247, 255, 265, 289, 323, 324, 325], "dicer_max_length": [0, 99], "24": [0, 10, 99, 140, 205, 247, 289], "loci_fil": [0, 99], "locu": [0, 99], "search_microrna": [0, 99], "de": [0, 99, 324, 325], "novo": [0, 99], "known": [0, 99, 323, 324], "strand_cutoff": [0, 99], "8": [0, 2, 6, 9, 10, 99, 117, 133, 140, 171, 186, 199, 205, 216, 230, 241, 247, 257, 271, 276, 283, 289, 299, 301, 317, 323, 324, 325], "min_coverag": [0, 99], "pad": [0, 99], "75": [0, 10, 99, 106, 107, 109, 114, 125, 140, 144, 162, 165, 166, 171, 176, 179, 180, 193, 205, 213, 216, 224, 225, 236, 247, 255, 257, 264, 265, 289, 301, 323, 324, 325], "small": [0, 5, 9, 99, 323, 325], "shortstack": [0, 5, 9, 99], "comput": [0, 1, 2, 5, 8, 9, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 99, 102, 118, 165, 166, 167, 168, 169, 187, 231, 272, 323, 324, 325], "window": [0, 1, 2, 5, 7, 8, 9, 99, 323, 325], "home": [0, 2, 99], "myuser": [0, 99], "anaconda3": [0, 99], "env": [0, 99], "myenv": [0, 99], "bin": [0, 10, 31, 60, 99, 324], "atcguatcgu": [0, 99], "accept": [0, 1, 2, 5, 10, 99, 167, 324, 325], "microrna": [0, 99], "instanc": [0, 10, 21, 22, 23, 50, 51, 52, 73, 99, 104, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 129, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 172, 173, 174, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 202, 203, 204, 205, 206, 217, 218, 219, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 244, 245, 246, 247, 248, 258, 259, 260, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 286, 287, 288, 289, 290, 302, 303, 304], "matur": [0, 99, 324, 325], "mirna": [0, 10, 99, 115, 116, 184, 185, 228, 229, 269, 270, 324], "pull": [0, 6, 99], "http": [0, 1, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "www": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "mirbas": [0, 99], "org": [0, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 99, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "increas": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 323, 324, 325], "accuraci": [0, 10, 99, 165, 323, 324, 325], "identif": [0, 99], "untrim": [0, 99, 101], "coordin": [0, 99], "dna": [0, 9, 99, 324], "mir166": [0, 99], "A": [0, 1, 2, 4, 6, 7, 9, 10, 35, 65, 66, 67, 99, 103, 107, 108, 114, 129, 135, 140, 143, 151, 152, 153, 161, 164, 176, 177, 205, 212, 221, 222, 247, 254, 262, 289, 292, 297, 306, 315, 316, 324, 325], "dure": [0, 5, 10, 99, 158, 221, 323, 324, 325], "procedur": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 99, 323], "discov": [0, 5, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 127, 128, 137, 138, 139, 140, 165, 166, 167, 168, 169, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 323, 324, 325], "scan": [0, 99], "begin": [0, 2, 10, 99, 126, 159, 195, 211, 237, 253, 279, 296, 323, 325], "highli": [0, 5, 10, 99, 164, 323, 324], "present": [0, 10, 13, 42, 99, 107, 114, 151, 152, 153, 176, 323], "nearli": [0, 2, 99], "plant": [0, 99], "high": [0, 1, 9, 99, 323, 324], "non": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 99, 127, 137, 138, 139, 140, 143, 162, 164, 165, 166, 167, 168, 169, 191, 196, 202, 203, 204, 205, 213, 214, 221, 238, 244, 245, 246, 247, 255, 276, 280, 286, 287, 288, 289, 298, 299, 323], "experi": [0, 5, 10, 99, 111, 112, 323, 324, 325], "altern": [0, 7, 99, 324, 325], "handl": [0, 10, 99, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "johnson": [0, 99], "2016": [0, 9, 99], "In": [0, 1, 2, 5, 7, 8, 9, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 165, 166, 167, 168, 169, 323, 324, 325], "weight": [0, 9, 10, 22, 24, 51, 53, 65, 77, 99, 108, 118, 141, 143, 187, 231, 272, 324, 325], "scheme": [0, 99], "placement": [0, 99], "termin": [0, 7, 8, 10, 22, 24, 51, 53, 65, 99, 118, 187, 231, 272, 325], "after": [0, 2, 5, 7, 10, 99, 100, 101, 148, 323, 324, 325], "phase": [0, 99], "occur": [0, 5, 99, 100, 101, 324, 325], "retain": [0, 99], "multimap": [0, 99], "possibli": [0, 99, 323], "lot": [0, 99], "posit": [0, 5, 10, 65, 66, 99, 133, 158, 160, 171, 191, 199, 214, 216, 221, 241, 257, 276, 283, 299, 301, 323, 324, 325], "togeth": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 77, 99, 165, 323, 324, 325], "bound": [0, 5, 10, 99, 143], "discrimin": [0, 99], "dicer": [0, 99], "deriv": [0, 10, 99, 167, 324, 325], "loci": [0, 99], "other": [0, 1, 4, 5, 6, 7, 10, 12, 18, 25, 35, 38, 39, 41, 47, 54, 67, 70, 71, 99, 108, 110, 134, 136, 162, 165, 170, 175, 181, 200, 201, 213, 214, 215, 220, 226, 242, 243, 255, 256, 261, 266, 284, 285, 298, 299, 300, 305, 323, 324, 325], "At": [0, 8, 10, 99, 140, 205, 247, 289, 323, 324, 325], "80": [0, 10, 99, 109, 166, 167, 180, 225, 265], "cluster": [0, 5, 7, 8, 9, 10, 99, 108, 140, 165, 166, 167, 168, 169, 205, 247, 289], "maximun": [0, 99], "analyz": [0, 6, 9, 10, 99, 111, 112, 163, 323], "prevent": [0, 5, 99], "discoveri": [0, 5, 99, 324, 325], "gff3": [0, 10, 99, 145, 148], "bed": [0, 99], "simpl": [0, 8, 99], "tab": [0, 2, 5, 6, 99, 323, 325], "delimit": [0, 2, 5, 10, 99, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305], "chr": [0, 99], "start": [0, 5, 10, 99, 172, 217, 258, 302, 324, 325], "stop": [0, 99], "mutual": [0, 99], "exclus": [0, 99, 323, 324, 325], "inclus": [0, 99], "search": [0, 5, 10, 24, 53, 65, 99, 100, 101], "time": [0, 5, 6, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 99, 165, 166, 167, 168, 169, 324, 325], "t": [0, 5, 7, 8, 9, 10, 31, 34, 60, 63, 99, 117, 140, 170, 186, 205, 215, 230, 247, 256, 271, 289, 300, 323, 324, 325], "confin": [0, 99], "queri": [0, 99], "comprehens": [0, 5, 9, 99], "wide": [0, 9, 99, 323, 324, 325], "alreadi": [0, 5, 13, 42, 99, 103, 323, 324, 325], "caution": [0, 99], "point": [0, 1, 5, 10, 99, 158, 166, 167, 169, 221, 323, 324, 325], "cutoff": [0, 5, 10, 65, 66, 99], "standed": [0, 99], "By": [0, 2, 10, 24, 53, 99, 323, 324, 325], "top": [0, 5, 10, 65, 66, 73, 99, 107, 114, 126, 143, 160, 163, 195, 237, 279, 323, 324, 325], "20": [0, 10, 76, 99, 100, 101, 107, 108, 109, 114, 135, 140, 152, 158, 159, 161, 176, 180, 205, 211, 212, 225, 247, 253, 254, 265, 289, 296, 297, 323, 324, 325], "unstrand": [0, 99, 323], "depth": [0, 99, 323], "unit": [0, 10, 99, 153, 323], "million": [0, 5, 10, 99, 112, 132, 145, 146, 147, 148, 153, 323, 324, 325], "nucleat": [0, 99], "initi": [0, 10, 24, 53, 99, 165, 168, 169, 325], "peak": [0, 99, 323], "continu": [0, 99, 324], "region": [0, 5, 10, 99, 145, 148], "exceed": [0, 99], "distanc": [0, 5, 10, 99, 108, 166, 167, 169], "less": [0, 8, 10, 99, 183, 268, 323, 324, 325], "trim_adapters_paired_end": [0, 5, 324], "three_prime_adapters_r1": [0, 100], "three_prime_adapters_r2": [0, 100], "five_prime_adapters_r1": [0, 100], "five_prime_adapters_r2": [0, 100], "any_position_adapters_r1": [0, 100], "any_position_adapters_r2": [0, 100], "quality_trim": [0, 100, 101], "trim_n": [0, 100, 101], "minimum_read_length": [0, 100, 101], "10": [0, 1, 2, 9, 10, 64, 65, 66, 77, 100, 101, 108, 109, 114, 126, 132, 140, 145, 146, 147, 148, 152, 158, 165, 180, 195, 205, 221, 225, 237, 247, 265, 276, 279, 289, 292, 299, 323, 324, 325], "maximum_read_length": [0, 100, 101], "discard_untrimmed_read": [0, 100, 101, 323], "pair_filter_if": [0, 100], "ani": [0, 1, 2, 4, 5, 8, 10, 22, 24, 41, 51, 53, 65, 100, 101, 102, 108, 118, 163, 165, 173, 187, 218, 231, 259, 272, 303, 308, 315, 316, 317, 323, 324, 325], "error_toler": [0, 100, 101], "minimum_overlap": [0, 100, 101], "allow_indel": [0, 100, 101], "parallel": [0, 2, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 100, 101, 165, 166, 167, 168, 169, 323, 325], "gzip_output": [0, 5, 100, 101], "return_new_filenam": [0, 100], "middl": [0, 2, 100, 101, 323], "low": [0, 100, 101, 324, 325], "below": [0, 1, 5, 10, 100, 101, 125, 162, 164, 166, 183, 193, 213, 236, 255, 268, 298, 323, 324, 325], "removem": [0, 100, 101], "flank": [0, 100, 101, 323], "n": [0, 5, 9, 10, 73, 100, 101, 126, 133, 140, 171, 195, 199, 205, 216, 237, 241, 247, 257, 279, 283, 289, 301, 308, 323, 324, 325], "nnacgtacgtnnnn": [0, 100, 101], "down": [0, 5, 10, 100, 101, 183, 221, 268, 323, 324, 325], "acgtacgt": [0, 100, 101], "discard": [0, 5, 10, 100, 101, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323], "alwai": [0, 1, 2, 5, 10, 100, 132, 323, 324, 325], "combin": [0, 10, 22, 24, 51, 53, 65, 100, 118, 131, 132, 165, 187, 231, 272, 323, 324, 325], "decis": [0, 100], "when": [0, 1, 5, 8, 10, 20, 21, 22, 23, 49, 50, 51, 52, 75, 100, 101, 102, 103, 112, 117, 118, 119, 127, 137, 140, 177, 186, 187, 188, 196, 202, 205, 222, 230, 231, 232, 238, 244, 247, 262, 271, 272, 273, 280, 286, 289, 307, 323, 324, 325], "appli": [0, 4, 5, 6, 10, 21, 22, 23, 41, 50, 51, 52, 100, 103, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 134, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 152, 160, 163, 165, 166, 167, 168, 169, 172, 173, 174, 177, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 217, 218, 219, 222, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 244, 245, 246, 247, 248, 258, 259, 260, 262, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 286, 287, 288, 289, 290, 302, 303, 304, 306, 307, 308], "fulfil": [0, 100], "criterion": [0, 10, 100, 167, 323, 324, 325], "error": [0, 5, 8, 10, 100, 101, 153, 323, 324, 325], "toler": [0, 100, 101], "permit": [0, 100, 101], "lowest": [0, 10, 65, 66, 100, 101, 126, 195, 237, 279, 323], "being": [0, 5, 10, 100, 101, 143, 166, 323, 324, 325], "100": [0, 5, 10, 100, 101, 126, 136, 140, 165, 166, 167, 168, 169, 195, 201, 205, 237, 243, 247, 279, 285, 289, 323, 324, 325], "mismatch": [0, 5, 100, 101], "insert": [0, 100, 101], "delet": [0, 5, 10, 100, 101, 319, 323, 325], "exactli": [0, 1, 10, 35, 67, 100, 101, 111, 112, 145, 148, 170, 215, 256, 262, 300, 317, 323, 324, 325], "avail": [0, 5, 7, 10, 24, 30, 40, 53, 59, 72, 100, 101, 108, 165, 323, 324], "processor": [0, 100, 101], "gzip": [0, 5, 100, 101], "trim_adapters_single_end": [0, 5, 324], "three_prime_adapt": [0, 101, 323], "five_prime_adapt": [0, 101], "any_position_adapt": [0, 101], "intersect": [0, 5, 6, 10, 11, 21, 22, 23, 26, 27, 50, 51, 52, 55, 56, 102, 110, 117, 118, 119, 136, 181, 186, 187, 188, 201, 226, 230, 231, 232, 243, 266, 271, 272, 273, 285, 323], "visual": [0, 2, 4, 5, 6, 7, 9, 10, 11, 102, 152, 165, 166, 167, 168, 169], "tabular": [0, 2, 4, 9, 10, 102, 323, 324], "variou": [0, 4, 5, 8, 10, 12, 41, 102, 103, 177, 323, 324, 325], "oper": [0, 1, 2, 5, 6, 10, 102, 103, 150, 159, 160, 172, 177, 206, 211, 217, 222, 248, 253, 258, 262, 290, 296, 302, 308, 323], "etc": [0, 1, 2, 4, 5, 10, 11, 24, 30, 31, 40, 41, 53, 59, 60, 64, 72, 102, 111, 112, 115, 116, 123, 131, 132, 147, 158, 164, 184, 185, 228, 229, 269, 270, 312, 323, 324, 325], "basic": [0, 2, 4, 5, 7, 10, 102, 323, 324], "exploratori": [0, 9, 10, 102], "analys": [0, 2, 4, 5, 9, 10, 11, 12, 41, 102, 262, 323, 324, 325], "plot": [0, 1, 5, 8, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 102, 107, 108, 114, 135, 151, 152, 153, 158, 165, 166, 167, 168, 169, 176, 221, 307, 323], "pca": [0, 5, 10, 102, 140, 160, 163, 205, 247, 289, 323, 324, 325], "clustergram": [0, 5, 10, 102, 324, 325], "violin": [0, 10, 102, 176], "scatter": [0, 1, 5, 10, 102, 107, 114, 152, 158, 221, 323], "modifi": [0, 1, 5, 8, 10, 102, 103, 159, 160, 165, 177, 211, 222, 253, 262, 296, 323, 324, 325], "easi": [0, 10, 102, 323, 324], "traceback": [0, 10, 102], "fname": [0, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 103, 131, 177, 222, 262, 292, 324], "drop_column": [0, 5, 10, 103, 177, 222], "is_norm": [0, 10, 103, 130, 325], "receiv": [0, 10, 12, 41, 103, 149, 177, 315, 316, 317, 324, 325], "accord": [0, 5, 10, 21, 22, 23, 31, 40, 50, 51, 52, 60, 64, 72, 103, 117, 118, 119, 125, 131, 132, 145, 148, 155, 156, 157, 162, 177, 186, 187, 188, 191, 193, 194, 208, 209, 210, 213, 230, 231, 232, 236, 250, 251, 252, 255, 271, 272, 273, 276, 293, 294, 295, 324, 325], "characterist": [0, 10, 103, 177, 323], "df": [0, 10, 103, 130, 140, 177, 198, 205, 222, 240, 247, 262, 282, 289, 320], "panda": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 103, 105, 106, 109, 133, 171, 177, 178, 179, 180, 199, 216, 222, 223, 224, 225, 241, 257, 262, 263, 264, 265, 283, 292, 301, 320, 324, 325], "content": [0, 10, 103, 177, 222, 262, 323, 324, 325], "upon": [0, 10, 103, 177, 222, 262], "usag": [0, 5, 6, 10, 103, 177, 222, 262, 323, 324], "shape": [0, 10, 103, 109, 177, 180, 222, 225, 262, 265, 324, 325], "column": [0, 1, 2, 4, 5, 10, 21, 50, 73, 74, 76, 77, 103, 104, 105, 106, 109, 111, 112, 113, 117, 123, 124, 125, 126, 129, 133, 135, 141, 143, 145, 146, 147, 148, 149, 150, 159, 162, 171, 172, 173, 177, 178, 179, 180, 182, 186, 192, 193, 195, 199, 206, 211, 213, 216, 217, 218, 222, 223, 224, 225, 227, 230, 235, 236, 237, 241, 248, 253, 255, 257, 258, 259, 262, 263, 264, 265, 267, 271, 279, 283, 290, 292, 296, 301, 302, 323, 324, 325], "dimens": [0, 8, 10, 103, 152, 177, 222, 262, 323], "purpos": [0, 1, 10, 103, 177, 222, 262, 312, 323, 324, 325], "updat": [0, 1, 5, 10, 26, 36, 55, 68, 103, 177, 222, 262, 312, 321, 322, 323, 325], "index_set": [0, 10, 103, 177, 222, 262, 324], "previous": [0, 5, 10, 103, 177, 222, 262, 323, 324, 325], "index_str": [0, 5, 10, 103, 177, 222, 262, 324], "separ": [0, 2, 5, 7, 10, 103, 104, 131, 132, 154, 163, 165, 177, 207, 222, 249, 262, 291, 323, 324, 325], "newlin": [0, 10, 103, 154, 177, 207, 222, 249, 262, 291, 324], "triplic": [0, 10, 103], "nest": [0, 5, 10, 103, 104, 112, 141, 151, 165], "a_rep1": [0, 10, 103], "a_rep2": [0, 10, 103], "a_rep3": [0, 10, 103], "b_rep1": [0, 10, 103], "b_rep2": [0, 10, 103], "_b_rep3": [0, 10, 103], "_avg_subsampl": 0, "sample_group": [0, 10, 104, 141], "groupedcolumn": [0, 10, 104, 107, 114, 141, 151, 152, 153, 165, 176], "mean": [0, 1, 2, 5, 10, 65, 66, 104, 106, 108, 109, 111, 129, 135, 141, 142, 143, 145, 148, 165, 168, 179, 180, 224, 225, 264, 265, 323], "median": [0, 5, 10, 104, 107, 108, 114, 125, 141, 142, 145, 148, 176, 193, 236, 278, 323, 324, 325], "geometric_mean": [0, 10, 104, 145, 148], "new_column_nam": [0, 10, 104], "avarag": 0, "subsampl": 0, "replic": [0, 4, 5, 10, 104, 107, 111, 112, 114, 141, 151, 152, 153, 158, 165, 176, 323, 324, 325], "everi": [0, 1, 4, 5, 10, 21, 22, 23, 50, 51, 52, 65, 66, 117, 118, 119, 152, 158, 165, 186, 187, 188, 230, 231, 232, 271, 272, 273, 292, 323, 324, 325], "member": [0, 10, 20, 33, 49, 62, 166], "pass": [0, 1, 324], "user": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 21, 24, 31, 40, 50, 53, 60, 64, 65, 72, 76, 77, 105, 106, 111, 112, 115, 116, 117, 166, 167, 169, 178, 179, 184, 185, 186, 223, 224, 228, 229, 230, 263, 264, 269, 270, 271, 323], "object": [0, 4, 5, 10, 12, 18, 21, 22, 23, 24, 25, 30, 31, 34, 35, 38, 40, 41, 47, 50, 51, 52, 53, 54, 59, 60, 63, 64, 65, 66, 67, 70, 72, 73, 77, 103, 104, 105, 106, 107, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 158, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 241, 242, 243, 244, 245, 246, 247, 248, 249, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 312, 320, 325], "To": [0, 2, 7, 8, 9, 10, 21, 22, 24, 50, 51, 53, 65, 107, 111, 112, 114, 117, 118, 141, 142, 143, 144, 151, 152, 153, 165, 176, 186, 187, 230, 231, 271, 272, 323, 324, 325], "condit": [0, 4, 10, 103, 104, 107, 111, 112, 114, 129, 141, 151, 152, 153, 176, 191, 262, 276, 323, 324, 325], "inner": [0, 10, 107, 114, 151, 152, 153, 176], "sample1a": [0, 10, 107, 114, 151, 152, 153, 176], "sample1b": [0, 10, 107, 114, 151, 152, 153, 176], "sample1c": [0, 10, 107, 114, 151, 152, 153, 176], "sample2a": [0, 10, 107, 114, 151, 152, 153, 176], "sample2b": [0, 10, 107, 114, 151, 152, 153, 176], "sample2c": [0, 10, 107, 114, 151, 152, 153, 176], "sample3": [0, 10, 107, 114, 151, 152, 153, 176, 324, 325], "sample6": [0, 10, 107, 114, 151, 152, 153, 176], "follow": [0, 1, 2, 7, 8, 9, 10, 111, 112, 165, 323, 324, 325], "sample1": [0, 10, 158, 324, 325], "sample2": [0, 10, 158, 324, 325], "sample_list": 0, "_from_str": 0, "msg": 0, "split": [0, 4, 5, 10, 161, 162, 163, 164, 165, 166, 167, 168, 169, 212, 213, 214, 254, 255, 297, 298, 299, 307, 323, 324, 325], "promprt": 0, "print": [0, 5, 10, 18, 25, 35, 38, 47, 54, 67, 70, 154, 207, 249, 291, 315, 316, 317, 318, 323, 324], "comma": [0, 2, 5, 7, 10, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305, 323], "seper": [0, 324], "_inplac": 0, "new_df": 0, "opposit": [0, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 148, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 307, 323, 324, 325], "inplac": [0, 5, 10, 21, 22, 23, 37, 50, 51, 52, 69, 104, 110, 113, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 159, 160, 165, 166, 167, 168, 169, 172, 173, 174, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 200, 201, 202, 203, 204, 205, 206, 211, 217, 218, 219, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 242, 243, 244, 245, 246, 247, 248, 253, 258, 259, 260, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 284, 285, 286, 287, 288, 289, 290, 292, 296, 302, 303, 304, 307, 308, 323, 324, 325], "printout_oper": 0, "filter_update_kwarg": 0, "execut": [0, 7, 8, 324], "choic": [0, 2, 5, 6, 323, 324, 325], "post": [0, 1], "filtrat": 0, "_is_norm": 0, "properti": [0, 10], "_numeric_column": 0, "numer": [0, 5, 10, 111, 112, 129, 262, 268, 276, 282, 292, 299, 323, 324, 325], "_pca_plot": 0, "final_df": 0, "pc1_var": 0, "pc2_var": 0, "label": [0, 5, 10, 73, 74, 75, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221, 325], "titl": [0, 5, 10, 21, 50, 73, 74, 75, 76, 77, 107, 108, 114, 117, 135, 151, 152, 158, 176, 186, 221, 230, 271, 323, 324, 325], "title_fonts": [0, 10, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221], "label_fonts": [0, 10, 107, 114, 135, 151, 152, 158, 176, 221], "tick_fonts": [0, 10, 107, 108, 114, 135, 151, 152, 158, 176, 221], "proportional_ax": [0, 5, 10, 152], "plot_grid": [0, 5, 10, 152], "legend": [0, 5, 10, 152, 325], "figur": [0, 5, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 107, 108, 114, 135, 151, 152, 153, 158, 165, 166, 167, 168, 169, 176, 221, 323, 324, 325], "intern": [0, 323], "varianc": [0, 5, 10, 143, 152, 325], "explain": [0, 1, 5, 10, 152, 323, 324, 325], "pc": [0, 5, 323], "second": [0, 1, 2, 10, 35, 67, 76, 77, 152, 158, 162, 164, 170, 213, 214, 215, 255, 256, 262, 298, 299, 300, 323, 324, 325], "draw": [0, 10, 73, 152, 323, 324, 325], "color": [0, 5, 8, 10, 76, 77, 152, 158, 221, 323, 325], "axi": [0, 5, 10, 31, 60, 73, 74, 75, 107, 114, 135, 151, 152, 153, 158, 176, 221, 324, 325], "_set_op": 0, "return_typ": [0, 10, 110, 134, 136, 170, 175, 181, 200, 201, 215, 220, 226, 242, 243, 256, 261, 266, 284, 285, 300, 305], "op": 0, "symmetr": [0, 5, 10, 35, 36, 67, 68, 170, 215, 256, 300, 324, 325], "symmetric_differ": [0, 10], "_sort": 0, "ascend": [0, 10, 126, 154, 159, 160, 195, 207, 211, 237, 249, 253, 279, 291, 296, 307], "na_posit": [0, 10, 126, 159, 195, 211, 237, 253, 279, 296, 307], "v": [0, 5, 10, 126, 140, 159, 195, 205, 211, 221, 237, 247, 253, 279, 289, 296, 323, 324], "descend": [0, 10, 126, 159, 160, 195, 211, 237, 253, 279, 296], "have": [0, 1, 2, 4, 5, 7, 10, 24, 27, 30, 34, 40, 53, 56, 59, 63, 64, 65, 66, 72, 103, 121, 123, 126, 144, 150, 159, 164, 166, 172, 177, 191, 195, 206, 211, 217, 237, 248, 253, 258, 276, 279, 290, 296, 302, 323, 324, 325], "put": [0, 1, 10, 126, 159, 195, 211, 237, 253, 279, 296], "nan": [0, 5, 10, 109, 124, 126, 159, 180, 192, 195, 211, 225, 235, 237, 253, 265, 279, 296, 323, 324, 325], "copi": [0, 1, 2, 5, 7, 8, 10, 159, 160, 211, 253, 296, 323], "without": [0, 4, 5, 9, 10, 64, 65, 66, 159, 160, 165, 211, 253, 296, 307, 323], "origin": [0, 1, 5, 8, 10, 24, 30, 31, 37, 40, 53, 59, 60, 64, 65, 66, 69, 72, 110, 116, 117, 121, 123, 124, 125, 126, 132, 134, 137, 138, 139, 140, 150, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 172, 174, 181, 183, 185, 186, 191, 192, 193, 194, 195, 200, 202, 203, 204, 205, 206, 211, 212, 213, 214, 217, 219, 226, 229, 230, 235, 236, 237, 242, 244, 245, 246, 247, 248, 253, 254, 255, 258, 260, 266, 268, 270, 271, 276, 279, 284, 286, 287, 288, 289, 290, 292, 296, 297, 299, 302, 304, 308, 323, 324, 325], "average_replicate_sampl": [0, 5, 10], "e": [0, 2, 5, 9, 10, 104, 111, 112, 140, 205, 247, 289, 323, 324, 325], "g": [0, 2, 5, 9, 10, 77, 104, 111, 112, 140, 205, 247, 289, 323, 324, 325], "biolog": [0, 8, 10, 41, 104, 323, 324, 325], "technic": [0, 10, 104, 323, 324, 325], "conta": [0, 10, 104, 141], "biotypes_from_gtf": [0, 10], "gtf_path": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "attribute_nam": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "biotyp": [0, 4, 5, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 72, 105, 106, 115, 116, 178, 179, 184, 185, 223, 224, 228, 229, 263, 264, 269, 270, 318, 322], "gene_biotyp": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "transcript_biotyp": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "gene_typ": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "transcript_typ": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "feature_typ": [0, 10, 105, 115, 145, 148, 178, 184, 223, 228, 263, 269], "long_format": [0, 5, 10, 105, 106, 178, 179, 223, 224, 263, 264], "drawn": [0, 10, 24, 31, 40, 53, 60, 64, 65, 72, 76, 77, 105, 106, 115, 116, 178, 179, 184, 185, 223, 224, 228, 229, 263, 264, 269, 270, 323], "transfer": [0, 10, 105, 115, 178, 184, 223, 228, 263, 269], "id": [0, 2, 4, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 105, 115, 118, 119, 122, 127, 128, 137, 138, 139, 140, 158, 174, 178, 184, 187, 188, 190, 196, 197, 202, 203, 204, 205, 219, 221, 223, 228, 231, 232, 234, 238, 239, 244, 245, 246, 247, 260, 263, 269, 272, 273, 275, 280, 281, 286, 287, 288, 289, 304, 323], "short": [0, 1, 2, 10, 105, 106, 178, 179, 223, 224, 263, 264, 323, 325], "state": [0, 5, 10, 105, 106, 178, 179, 223, 224, 263, 264, 307], "also": [0, 2, 4, 5, 7, 8, 10, 41, 105, 106, 131, 132, 137, 138, 139, 140, 165, 178, 179, 202, 203, 204, 205, 223, 224, 244, 245, 246, 247, 263, 264, 286, 287, 288, 289, 308, 323, 324, 325], "descript": [0, 1, 2, 5, 10, 11, 78, 102, 105, 106, 109, 178, 179, 180, 223, 224, 225, 263, 264, 265, 312, 323, 324, 325], "rtype": [0, 10, 24, 53, 65, 105, 106, 178, 179, 223, 224, 263, 264], "show": [0, 1, 5, 7, 10, 22, 24, 51, 53, 65, 76, 105, 106, 109, 118, 133, 151, 158, 171, 178, 179, 180, 187, 199, 216, 221, 223, 224, 225, 231, 241, 257, 263, 264, 265, 272, 283, 301, 323, 324, 325], "belong": [0, 10, 21, 22, 23, 50, 51, 52, 105, 106, 117, 118, 119, 161, 165, 178, 179, 186, 187, 188, 212, 223, 224, 230, 231, 232, 254, 263, 264, 271, 272, 273, 297, 323, 324, 325], "biotypes_from_ref_t": [0, 4, 5, 10, 324], "ref": [0, 10, 14, 21, 43, 50, 106, 116, 117, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 292, 297, 324], "predefin": [0, 5, 8, 10, 14, 21, 24, 30, 31, 40, 43, 50, 53, 59, 60, 64, 72, 76, 77, 106, 116, 117, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 297, 325], "ce11": [0, 10, 106, 179, 224, 264], "d": [0, 9, 10, 14, 43, 106, 110, 125, 133, 134, 136, 140, 162, 170, 171, 175, 179, 181, 183, 191, 193, 194, 199, 200, 201, 205, 213, 214, 215, 216, 220, 222, 224, 226, 236, 241, 242, 243, 247, 255, 256, 257, 261, 264, 266, 283, 284, 285, 289, 300, 301, 305, 308, 324], "test": [0, 1, 2, 5, 7, 9, 10, 12, 14, 24, 30, 31, 40, 41, 43, 53, 59, 60, 64, 65, 66, 72, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 308, 323], "test_fil": [0, 10, 12, 14, 41, 43, 106, 109, 110, 116, 117, 121, 123, 124, 125, 126, 129, 131, 132, 133, 134, 136, 141, 142, 143, 144, 146, 147, 149, 150, 154, 159, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 179, 180, 181, 183, 185, 186, 191, 192, 193, 194, 195, 199, 200, 201, 206, 207, 211, 212, 213, 214, 215, 216, 217, 218, 220, 222, 224, 225, 226, 229, 230, 235, 236, 237, 241, 242, 243, 248, 249, 253, 254, 255, 256, 257, 258, 259, 261, 264, 265, 266, 268, 270, 271, 276, 279, 283, 284, 285, 290, 291, 292, 296, 297, 299, 300, 301, 302, 305, 308, 324], "test_deseq": [0, 10, 14, 43, 106, 110, 125, 133, 134, 136, 150, 162, 170, 171, 175, 179, 181, 193, 199, 200, 201, 206, 213, 214, 215, 216, 220, 224, 226, 236, 241, 242, 243, 248, 255, 256, 257, 261, 264, 266, 283, 284, 285, 290, 300, 301, 305, 324], "view": [0, 5, 7, 8, 10, 106, 179, 224, 264, 323], "biotype_ref_table_for_test": [0, 10, 14, 43, 106, 116, 179, 185, 224, 229, 264, 270, 292, 324], "protein_cod": [0, 10, 14, 24, 30, 31, 40, 43, 53, 59, 60, 72, 106, 115, 116, 179, 184, 185, 224, 228, 229, 264, 269, 270, 292, 324, 325], "26": [0, 10, 14, 43, 106, 109, 110, 124, 134, 140, 150, 179, 180, 181, 191, 192, 200, 205, 206, 214, 224, 225, 226, 235, 242, 247, 248, 264, 265, 266, 284, 289, 290, 324], "pseudogen": [0, 4, 10, 14, 43, 106, 115, 116, 179, 184, 185, 224, 228, 229, 264, 269, 270, 324, 325], "unknown": [0, 10, 14, 43, 106, 179, 224, 264, 324], "basemean": [0, 10, 106, 124, 133, 150, 171, 179, 192, 199, 206, 216, 224, 235, 241, 248, 257, 264, 283, 290, 301, 308, 324, 325], "padj": [0, 10, 106, 133, 171, 177, 179, 198, 199, 216, 224, 241, 257, 264, 283, 301, 308, 324, 325], "max": [0, 10, 73, 106, 109, 128, 138, 139, 140, 145, 148, 179, 180, 197, 203, 204, 205, 224, 225, 239, 245, 246, 247, 264, 265, 281, 287, 288, 289, 324], "1823": [0, 10, 106, 179, 224, 264, 324], "089609": [0, 10, 106, 179, 224, 264, 324], "005060e": [0, 10, 106, 179, 224, 264, 324], "90": [0, 10, 106, 109, 140, 171, 179, 180, 205, 216, 224, 225, 247, 257, 264, 265, 289, 301, 324, 325], "9": [0, 6, 9, 10, 106, 109, 116, 133, 140, 171, 179, 180, 185, 199, 205, 216, 224, 225, 229, 241, 247, 257, 264, 265, 270, 283, 289, 292, 301, 315, 316, 323, 324, 325], "290000e": [0, 10, 106, 171, 179, 216, 224, 257, 264, 301, 324], "68": [0, 10, 106, 140, 171, 179, 205, 216, 224, 247, 257, 264, 289, 301, 324], "2688": [0, 10, 106, 179, 224, 264, 324, 325], "043701": [0, 10, 106, 179, 224, 264, 324], "800000e": [0, 10, 106, 133, 179, 199, 224, 241, 264, 283, 324], "94": [0, 9, 10, 106, 140, 171, 179, 205, 216, 224, 247, 257, 264, 289, 301, 324, 325], "2085": [0, 10, 106, 179, 224, 264, 324], "995094": [0, 10, 106, 179, 224, 264, 324], "070000e": [0, 10, 106, 133, 179, 199, 224, 241, 264, 283, 324], "152": [0, 10, 106, 179, 224, 264, 324], "x": [0, 2, 5, 7, 10, 21, 22, 23, 50, 51, 52, 65, 66, 106, 107, 108, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 133, 135, 140, 143, 150, 151, 152, 158, 163, 171, 172, 173, 176, 179, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 199, 205, 206, 216, 217, 218, 221, 224, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 241, 247, 248, 257, 258, 259, 264, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 283, 289, 290, 292, 301, 302, 303, 323, 324, 325], "box_plot": [0, 5, 10], "notch": [0, 10, 107], "ylabel": [0, 10, 73, 74, 75, 107, 114, 158, 176], "log10": [0, 10, 107, 114, 158, 173, 176, 218, 221, 259, 303], "16": [0, 6, 10, 107, 114, 123, 140, 151, 152, 158, 164, 165, 176, 205, 221, 247, 289, 316, 324], "12": [0, 6, 9, 10, 77, 107, 108, 114, 126, 135, 140, 151, 152, 158, 165, 176, 195, 205, 221, 237, 247, 276, 279, 289, 299, 324, 325], "box": [0, 2, 5, 7, 10, 107, 114, 152, 160, 163, 165, 166, 167, 168, 169, 173, 176, 218, 259, 303, 323, 325], "absolut": [0, 10, 107, 114, 132, 176, 183, 221, 268, 323, 324, 325], "25": [0, 6, 10, 64, 65, 66, 107, 109, 114, 124, 125, 140, 176, 180, 192, 193, 194, 205, 225, 235, 236, 247, 265, 289, 308, 324], "percentil": [0, 5, 10, 107, 109, 114, 125, 162, 176, 180, 193, 213, 225, 236, 255, 265, 278, 298, 324], "white": [0, 10, 107, 114, 176], "dot": [0, 10, 74, 75, 107, 114, 158, 176], "add": [0, 1, 5, 8, 10, 77, 107, 114, 307, 323, 325], "confid": [0, 10, 107, 140, 205, 247, 289], "interv": [0, 10, 107], "y": [0, 2, 5, 7, 9, 10, 31, 60, 73, 74, 75, 107, 108, 114, 135, 140, 143, 151, 152, 153, 158, 176, 205, 221, 247, 289, 324, 325], "30": [0, 10, 107, 108, 109, 114, 135, 140, 151, 152, 158, 176, 180, 205, 221, 225, 247, 265, 289], "font": [0, 5, 10, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221], "graph": [0, 2, 5, 6, 10, 24, 30, 53, 59, 65, 66, 73, 74, 75, 107, 108, 114, 135, 151, 152, 158, 176, 221, 323, 324, 325], "15": [0, 9, 10, 107, 109, 114, 117, 135, 140, 151, 152, 158, 159, 161, 165, 176, 180, 186, 205, 211, 212, 221, 225, 230, 247, 253, 254, 265, 271, 289, 296, 297, 324, 325], "tick": [0, 5, 10, 107, 108, 114, 135, 151, 152, 158, 176, 221], "matplotlib": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 76, 77, 107, 108, 114, 135, 151, 152, 158, 176, 221, 324, 325], "add_scatt": [0, 10, 107, 114], "columnnam": [0, 10, 108, 113, 124, 125, 126, 129, 135, 143, 150, 158, 162, 172, 173, 182, 192, 193, 195, 206, 213, 217, 218, 227, 235, 236, 237, 248, 255, 258, 259, 267, 279, 290, 302, 307], "metric": [0, 5, 10, 108, 165, 166, 167, 169, 323], "euclidean": [0, 10, 108, 165, 166, 167, 169, 323, 324, 325], "linkag": [0, 10, 108, 165, 167, 323, 324, 325], "complet": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 77, 108, 111, 112, 158, 167, 221, 323, 325], "ward": [0, 10, 108, 165, 167, 323], "centroid": [0, 10, 108, 168, 169], "hierarch": [0, 5, 9, 10, 108, 165, 167, 323], "relev": [0, 5, 10, 108, 323, 324, 325], "condition1_rep1": [0, 10, 108], "condition1_rep2": [0, 10, 108], "condition1_rep3": [0, 10, 108], "condition2_rep1": [0, 10, 108], "condition3_rep1": [0, 10, 108], "condition3_rep2": [0, 10, 108], "ham": [0, 10, 108, 166, 169], "correl": [0, 1, 10, 108, 151, 323, 324, 325], "scipi": [0, 9, 10, 108], "spatial": [0, 10, 108, 323, 324, 325], "pdist": [0, 10, 108], "possibl": [0, 1, 2, 5, 10, 108, 324], "see": [0, 1, 4, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 108, 109, 111, 112, 118, 119, 127, 128, 133, 137, 138, 139, 140, 151, 165, 166, 167, 169, 171, 180, 187, 188, 196, 197, 199, 202, 203, 204, 205, 216, 225, 231, 232, 238, 239, 241, 244, 245, 246, 247, 257, 265, 272, 273, 280, 281, 283, 286, 287, 288, 289, 301, 323, 324, 325], "document": [0, 2, 5, 9, 10, 108, 109, 133, 151, 171, 180, 199, 216, 225, 241, 257, 265, 283, 301, 323, 324, 325], "onlin": [0, 2, 10, 108, 324, 325], "hierarchi": [0, 10, 108, 323, 324, 325], "01": [0, 6, 10, 109, 140, 180, 205, 225, 247, 265, 289], "99": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "central": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "tendenc": [0, 10, 109, 180, 225, 265], "dispers": [0, 9, 10, 109, 180, 225, 265, 323], "distribut": [0, 2, 10, 109, 180, 225, 265, 323, 324, 325], "exclud": [0, 10, 22, 24, 30, 40, 51, 53, 59, 64, 65, 66, 72, 109, 118, 144, 180, 187, 225, 231, 265, 272, 323, 324, 325], "inform": [0, 2, 4, 5, 8, 10, 109, 141, 147, 151, 180, 225, 265, 323, 324, 325], "fall": [0, 10, 109, 180, 225, 265], "25th": [0, 10, 109, 125, 180, 193, 225, 236, 265], "50th": [0, 10, 109, 180, 225, 265], "75th": [0, 10, 109, 125, 180, 193, 225, 236, 265], "summari": [0, 2, 5, 10, 109, 180, 225, 265, 323, 324, 325], "seri": [0, 4, 5, 6, 10, 109, 180, 225, 262, 265, 324, 325], "numpi": [0, 9, 10, 109, 166, 180, 225, 265, 324], "np": [0, 10, 109, 180, 225, 265], "cond1": [0, 2, 10, 109, 126, 141, 154, 159, 173, 180, 195, 207, 211, 218, 225, 237, 249, 253, 259, 265, 279, 291, 296, 324, 325], "cond2": [0, 2, 10, 109, 126, 141, 159, 180, 195, 211, 225, 237, 253, 265, 279, 296, 324, 325], "cond3": [0, 2, 10, 109, 141, 159, 180, 211, 225, 253, 265, 296, 324, 325], "cond4": [0, 10, 109, 141, 159, 173, 180, 211, 218, 225, 253, 259, 265, 296, 324, 325], "22": [0, 6, 9, 10, 109, 116, 117, 121, 123, 126, 140, 141, 142, 143, 144, 146, 147, 149, 161, 164, 165, 172, 173, 180, 185, 186, 195, 205, 212, 217, 218, 225, 229, 230, 237, 247, 254, 258, 259, 265, 268, 270, 271, 276, 279, 289, 292, 297, 299, 302, 308, 324], "000000": [0, 10, 109, 180, 225, 265], "2515": [0, 10, 109, 180, 225, 265], "590909": [0, 10, 109, 180, 225, 265], "2209": [0, 10, 109, 180, 225, 265], "227273": [0, 10, 109, 180, 225, 265], "4230": [0, 10, 109, 180, 225, 265], "3099": [0, 10, 109, 180, 225, 265], "818182": [0, 10, 109, 180, 225, 265], "std": [0, 10, 109, 180, 225, 265], "4820": [0, 10, 109, 180, 225, 265], "512674": [0, 10, 109, 180, 225, 265], "4134": [0, 10, 109, 180, 225, 265], "948493": [0, 10, 109, 180, 225, 265], "7635": [0, 10, 109, 180, 225, 265], "832664": [0, 10, 109, 180, 225, 265], "5520": [0, 10, 109, 180, 225, 265], "394522": [0, 10, 109, 180, 225, 265], "min": [0, 10, 73, 109, 145, 148, 180, 225, 265], "6": [0, 6, 9, 10, 109, 123, 133, 140, 145, 146, 147, 148, 164, 171, 180, 199, 205, 216, 225, 241, 247, 257, 265, 283, 289, 292, 301, 316, 323, 324, 325], "250000": [0, 10, 109, 180, 225, 265], "57": [0, 10, 109, 140, 159, 166, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "500000": [0, 10, 109, 180, 225, 265], "52": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289, 324, 325], "23": [0, 6, 10, 109, 140, 159, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "2637": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "2479": [0, 10, 109, 180, 225, 265], "6030": [0, 10, 109, 180, 225, 265], "4669": [0, 10, 109, 180, 225, 265], "750000": [0, 10, 109, 180, 225, 265], "15054": [0, 10, 109, 180, 225, 265], "950000": [0, 10, 109, 180, 225, 265], "12714": [0, 10, 109, 180, 225, 265], "290000": [0, 10, 109, 180, 225, 265], "21955": [0, 10, 109, 180, 225, 265], "390000": [0, 10, 109, 180, 225, 265], "15603": [0, 10, 109, 180, 225, 265], "510000": [0, 10, 109, 180, 225, 265], "15056": [0, 10, 109, 180, 225, 265], "12746": [0, 10, 109, 180, 225, 265], "22027": [0, 10, 109, 180, 225, 265], "15639": [0, 10, 109, 180, 225, 265], "decil": [0, 10, 109, 180, 225, 265], "arang": [0, 10, 109, 180, 225, 265], "200000": [0, 10, 109, 180, 225, 265], "400000": [0, 10, 109, 180, 225, 265], "700000": [0, 10, 109, 180, 225, 265], "600000": [0, 10, 109, 180, 225, 265], "40": [0, 10, 109, 140, 165, 167, 180, 205, 225, 247, 265, 289, 324], "28": [0, 6, 10, 109, 110, 124, 125, 134, 140, 150, 162, 180, 181, 183, 192, 193, 200, 205, 206, 213, 214, 225, 226, 235, 236, 242, 247, 248, 255, 265, 266, 284, 289, 290, 308, 324], "800000": [0, 10, 109, 180, 225, 265], "14": [0, 2, 7, 10, 77, 109, 117, 140, 166, 168, 169, 180, 186, 205, 225, 230, 247, 265, 271, 276, 289, 299], "60": [0, 10, 109, 140, 159, 165, 180, 205, 211, 225, 247, 253, 265, 289, 296, 324, 325], "82": [0, 10, 109, 140, 166, 171, 180, 205, 216, 225, 247, 257, 265, 289, 301, 324, 325], "106": [0, 10, 109, 180, 225, 265], "44": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "70": [0, 10, 109, 140, 171, 180, 205, 216, 225, 247, 257, 265, 289, 301, 324], "484": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "395": [0, 10, 109, 180, 225, 265], "305": [0, 10, 109, 180, 225, 265], "302": [0, 10, 109, 133, 140, 180, 199, 205, 225, 241, 247, 265, 283, 289, 324], "3398": [0, 10, 109, 180, 225, 265], "3172": [0, 10, 109, 140, 180, 205, 225, 247, 265, 289], "7981": [0, 10, 109, 180, 225, 265], "6213": [0, 10, 109, 180, 225, 265], "8722": [0, 10, 109, 180, 225, 265], "100000": [0, 10, 109, 180, 225, 265], "7941": [0, 10, 109, 180, 225, 265], "16449": [0, 10, 109, 180, 225, 265], "12129": [0, 10, 109, 180, 225, 265], "900000": [0, 10, 109, 180, 225, 265], "keep": [0, 1, 10, 22, 23, 24, 30, 40, 51, 52, 53, 59, 64, 65, 66, 72, 110, 116, 117, 118, 119, 122, 123, 125, 126, 127, 134, 137, 138, 139, 140, 150, 172, 181, 183, 185, 186, 187, 188, 190, 191, 193, 194, 195, 196, 200, 202, 203, 204, 205, 206, 217, 226, 229, 230, 231, 232, 234, 236, 237, 238, 242, 244, 245, 246, 247, 248, 258, 266, 268, 270, 271, 272, 273, 275, 276, 279, 280, 284, 286, 287, 288, 289, 290, 292, 302, 323, 324, 325], "NOT": [0, 10, 18, 47, 110, 132, 170, 181, 215, 226, 256, 266, 300, 324, 325], "done": [0, 1, 2, 5, 10, 21, 22, 23, 37, 50, 51, 52, 69, 110, 117, 118, 119, 134, 165, 174, 181, 186, 187, 188, 200, 219, 226, 230, 231, 232, 242, 260, 266, 271, 272, 273, 284, 304, 323, 324, 325], "wbgene": [0, 5, 10, 110, 136, 170, 175, 181, 201, 215, 220, 226, 243, 256, 261, 266, 285, 300, 305, 315, 316, 317, 325], "deseqfilt": [0, 4, 5, 10, 110, 111, 112, 170, 226, 256, 266, 300, 306, 308], "a_set": [0, 10, 110, 134, 136, 181, 200, 201, 226, 242, 243, 266, 284, 285, 324], "wbgene00000001": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 110, 134, 136, 181, 200, 201, 226, 242, 243, 266, 284, 285, 324, 325], "wbgene00000002": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 110, 133, 134, 136, 170, 175, 181, 199, 200, 201, 215, 220, 226, 241, 242, 243, 256, 261, 266, 283, 284, 285, 300, 305, 324, 325], "wbgene00000003": [0, 10, 18, 25, 38, 47, 54, 70, 110, 133, 134, 136, 170, 175, 181, 199, 200, 201, 215, 220, 226, 241, 242, 243, 256, 261, 266, 283, 284, 285, 300, 305, 324, 325], "wbgene00007063": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007064": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007066": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007067": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007069": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00007071": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007074": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007075": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007076": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007077": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007078": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00007079": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00014997": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043987": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043988": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043989": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00043990": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00044022": [0, 10, 110, 154, 170, 175, 181, 207, 215, 220, 226, 249, 256, 261, 266, 291, 300, 305, 324], "wbgene00044951": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077502": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077503": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "wbgene00077504": [0, 10, 110, 154, 159, 170, 175, 181, 207, 211, 215, 220, 226, 249, 253, 256, 261, 266, 291, 296, 300, 305, 324, 325], "leav": [0, 10, 110, 116, 117, 121, 123, 124, 125, 126, 134, 150, 161, 162, 164, 165, 166, 167, 168, 169, 172, 181, 183, 185, 186, 191, 192, 193, 194, 195, 200, 206, 212, 213, 214, 217, 226, 229, 230, 235, 236, 237, 242, 248, 254, 255, 258, 266, 268, 270, 271, 276, 279, 284, 290, 292, 297, 299, 302, 308, 323, 324, 325], "differential_expression_deseq2": [0, 5, 10], "design_matrix": [0, 10, 111, 112], "comparison": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 111, 112, 292, 323, 324, 325], "iter": [0, 10, 22, 24, 31, 40, 51, 53, 60, 64, 65, 72, 76, 111, 112, 118, 131, 132, 158, 168, 169, 187, 231, 272], "algorithm": [0, 1, 10, 111, 165, 166, 167, 168, 169, 323, 324, 325], "unnorm": [0, 5, 10, 111], "raw": [0, 2, 10, 103, 111, 151, 323, 325], "design": [0, 5, 10, 111, 112, 323, 325], "experiment": [0, 10, 22, 24, 51, 53, 65, 111, 112, 118, 141, 187, 231, 272, 323, 324, 325], "factor": [0, 1, 5, 10, 111, 112, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 205, 247, 289, 324, 325], "guid": [0, 1, 4, 5, 6, 7, 9, 10, 21, 22, 24, 50, 51, 53, 65, 111, 112, 117, 118, 166, 167, 169, 186, 187, 230, 231, 271, 272, 323], "tutori": [0, 2, 5, 6, 7, 9, 10, 111, 112], "formula": [0, 10, 111, 112, 323, 324, 325], "numerator_valu": [0, 10, 111, 112], "denominator_valu": [0, 10, 111, 112], "what": [0, 1, 5, 6, 8, 10, 111, 112, 136, 201, 243, 285, 323], "element": [0, 5, 10, 13, 16, 18, 19, 20, 25, 32, 33, 35, 38, 42, 45, 47, 48, 49, 54, 61, 62, 67, 70, 111, 112, 152, 323], "fold": [0, 2, 4, 5, 9, 10, 41, 73, 74, 75, 111, 112, 129, 177, 183, 191, 214, 221, 262, 268, 276, 292, 299, 323, 325], "chang": [0, 1, 2, 4, 9, 10, 15, 41, 44, 111, 112, 129, 177, 183, 191, 194, 214, 221, 262, 268, 276, 292, 299, 323, 325], "denomin": [0, 5, 10, 111, 112, 129, 262, 268, 276, 282, 292, 299, 323, 324, 325], "differential_expression_limma_voom": [0, 5, 10], "random_effect": [0, 10, 112], "limma": [0, 5, 9, 10, 112, 144, 324, 325], "voom": [0, 5, 9, 10, 112], "effect": [0, 5, 10, 13, 42, 112, 165, 323, 324, 325], "drop": [0, 10, 37, 69, 103, 113, 137, 138, 139, 140, 174, 177, 182, 202, 203, 204, 205, 219, 222, 227, 244, 245, 246, 247, 260, 267, 286, 287, 288, 289, 304, 323, 325], "fro": [0, 10, 113, 182, 227, 267], "mthe": [0, 10, 113, 182, 227, 267], "enhanced_box_plot": [0, 5, 10], "enhanc": [0, 5, 10, 114], "rpm": [0, 10, 114, 123, 132, 146, 147, 158, 164, 324, 325], "filter_biotype_from_gtf": [0, 10], "lincrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270, 324, 325], "ncrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "pirna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270, 324, 325], "rrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "snorna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "snrna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "trna": [0, 10, 115, 116, 184, 185, 228, 229, 269, 270], "anyth": [0, 1, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302, 323], "BUT": [0, 10, 21, 22, 23, 50, 51, 52, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 302], "expect": [0, 5, 10, 21, 22, 23, 24, 30, 31, 40, 50, 51, 52, 53, 59, 60, 64, 65, 66, 72, 73, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 150, 172, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 206, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 248, 258, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 290, 292, 302, 323, 324, 325], "filter_biotype_from_ref_t": [0, 4, 5, 10, 292, 324], "defin": [0, 4, 5, 9, 10, 11, 21, 24, 31, 40, 50, 53, 60, 64, 65, 72, 76, 77, 116, 117, 152, 185, 186, 229, 230, 270, 271, 321, 322], "whose": [0, 5, 10, 116, 121, 123, 124, 125, 135, 143, 152, 183, 185, 192, 193, 194, 229, 235, 236, 268, 270, 278, 323, 324, 325], "13": [0, 10, 116, 140, 159, 167, 185, 205, 211, 229, 247, 253, 270, 289, 292, 296, 323, 324, 325], "filter_by_attribut": [0, 4, 5, 10, 292, 324], "attribute1": [0, 10, 117, 161, 186, 212, 230, 254, 271, 292, 297, 324, 325], "attr_ref_table_for_exampl": [0, 10, 117, 161, 186, 212, 230, 254, 271, 292, 297, 324], "7": [0, 1, 2, 6, 9, 10, 117, 125, 133, 140, 161, 162, 165, 186, 193, 199, 205, 212, 213, 230, 236, 241, 247, 254, 255, 271, 283, 289, 292, 297, 323, 324, 325], "OR": [0, 10, 117, 170, 186, 215, 230, 256, 271, 300], "attribute3": [0, 10, 117, 186, 230, 271, 324, 325], "AND": [0, 10, 117, 186, 230, 271], "19": [0, 6, 9, 10, 117, 140, 165, 186, 205, 230, 247, 271, 289, 324, 325], "don": [0, 2, 5, 7, 8, 10, 117, 186, 230, 271, 323, 324, 325], "filter_by_go_annot": [0, 5, 10], "go_id": [0, 10, 22, 51, 118, 187, 231, 272], "arabodopsi": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 187, 188, 231, 232, 272, 273], "thaliana": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "caenorhabd": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324, 325], "elegan": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 325], "danio": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "rerio": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "drosophila": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "melanogast": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "escherichia": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "coli": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "homo": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "sapien": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "mu": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "musculu": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "saccharomyc": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "cerevisia": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "schizosaccharomyc": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "pomb": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 128, 138, 139, 140, 187, 188, 197, 203, 204, 205, 231, 232, 239, 245, 246, 247, 272, 273, 281, 287, 288, 289], "gene_id_typ": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "uniprotkb": [0, 8, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 324, 325], "ac": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniparc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref50": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref90": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "uniref100": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "crc64": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ensembl": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 165, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 324, 325], "protein": [0, 4, 9, 10, 22, 23, 24, 30, 31, 37, 40, 51, 52, 53, 59, 60, 65, 66, 69, 72, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 292, 304, 324, 325], "geneid": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "kegg": [0, 5, 9, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323], "patric": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ucsc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "wbparasit": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "arachnoserv": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "araport": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "conoserv": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "dictybas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "echobas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "euhcvdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "flybas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genecard": [0, 8, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genereview": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "hgnc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "legiolist": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "leproma": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "maizegdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "mgi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "mim": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "nextprot": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "opentarget": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "orphanet": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pharmgkb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pombas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pseudocap": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "rgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "sgd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "tuberculist": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "veupathdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "vgnc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "wormbas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323, 324, 325], "xenbas": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "zfin": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "eggnog": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genetre": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "hogenom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "oma": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304, 323], "orthodb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "treefam": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ccd": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "embl": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genbank": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "ddbj": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cd": [0, 1, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "gi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "pir": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "refseq": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "chitar": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genewiki": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "genomernai": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "phi": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "collectf": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "biocyc": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "plantreactom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "reactom": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "unipathwai": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "cptac": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "proteomicsdb": [0, 10, 22, 23, 24, 30, 37, 51, 52, 53, 59, 65, 66, 69, 75, 118, 119, 127, 128, 137, 138, 139, 140, 174, 187, 188, 196, 197, 202, 203, 204, 205, 219, 231, 232, 238, 239, 244, 245, 246, 247, 260, 272, 273, 280, 281, 286, 287, 288, 289, 304], "propagate_annot": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "evidence_typ": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "phylogenet": [0, 9, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "author": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "curat": [0, 10, 22, 24, 30, 51, 53, 59, 65, 66, 118, 187, 231, 272, 323, 324, 325], "electron": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "excluded_evidence_typ": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "databas": [0, 5, 6, 9, 10, 22, 24, 51, 53, 65, 118, 127, 128, 137, 138, 139, 140, 187, 196, 197, 202, 203, 204, 205, 231, 238, 239, 244, 245, 246, 247, 272, 280, 281, 286, 287, 288, 289], "excluded_databas": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "qualifi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "contributes_to": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "colocalizes_with": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "excluded_qualifi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "go": [0, 1, 2, 5, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 74, 118, 119, 187, 188, 231, 232, 272, 273, 323], "term": [0, 4, 5, 9, 10, 22, 24, 51, 53, 65, 66, 118, 168, 169, 187, 231, 272, 323], "ncbi": [0, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "taxon": [0, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "fetch": [0, 1, 5, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "featureset": [0, 4, 5, 10, 41, 43, 44, 47, 51, 52, 53, 54, 59, 60, 63, 65, 66, 67, 69, 70, 72, 76, 77, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 325], "rnacentr": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "entrez": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 75, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "server": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "full": [0, 2, 7, 8, 10, 22, 23, 24, 30, 31, 34, 40, 51, 52, 53, 59, 60, 63, 64, 65, 66, 72, 103, 118, 119, 127, 128, 131, 132, 137, 138, 139, 140, 166, 167, 169, 177, 187, 188, 196, 197, 202, 203, 204, 205, 222, 231, 232, 238, 239, 244, 245, 246, 247, 262, 272, 273, 280, 281, 286, 287, 288, 289, 292, 320, 323, 324, 325], "legal": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 165, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323], "uniprot": [0, 5, 9, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 324, 325], "help": [0, 1, 2, 5, 8, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 160, 163, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289, 323, 324, 325], "api_idmap": [0, 10, 22, 23, 24, 30, 51, 52, 53, 59, 65, 66, 118, 119, 127, 128, 137, 138, 139, 140, 187, 188, 196, 197, 202, 203, 204, 205, 231, 232, 238, 239, 244, 245, 246, 247, 272, 273, 280, 281, 286, 287, 288, 289], "propag": [0, 2, 10, 22, 24, 30, 40, 51, 53, 59, 65, 72, 118, 187, 231, 272, 323], "classic": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "dag": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "tree": [0, 10, 22, 24, 51, 53, 65, 118, 166, 187, 231, 272, 323, 324, 325], "root": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "elim": [0, 2, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "node": [0, 2, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "signific": [0, 5, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 64, 65, 66, 72, 73, 118, 187, 194, 221, 231, 272, 292, 323, 324, 325], "manner": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "children": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "rel": [0, 5, 10, 22, 24, 51, 53, 65, 118, 142, 187, 231, 272, 323, 324, 325], "parent": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "allm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "proopag": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "alexa": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "pubm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "nlm": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "nih": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "gov": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "16606683": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "m": [0, 1, 5, 7, 9, 10, 22, 24, 51, 53, 65, 118, 140, 143, 187, 205, 231, 247, 272, 289, 324, 325], "evid": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 323], "code": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 22, 24, 30, 31, 40, 51, 53, 59, 60, 65, 72, 118, 187, 231, 272, 292, 323], "categori": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 323, 324, 325], "consortium": [0, 9, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "geneontologi": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "doc": [0, 1, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272, 324, 325], "amigo": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "xref": [0, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "spefici": [0, 5, 10, 22, 24, 51, 53, 65, 118, 187, 231, 272], "filter_by_kegg_annot": [0, 5, 10], "kegg_id": [0, 10, 23, 52, 119, 188, 232, 273], "pathwai": [0, 5, 9, 10, 23, 30, 52, 59, 66, 75, 119, 188, 232, 273, 323], "would": [0, 1, 2, 4, 5, 10, 23, 52, 119, 188, 232, 273, 323, 324, 325], "cel04020": [0, 10, 23, 52, 119, 188, 232, 273], "calcium": [0, 10, 23, 52, 119, 188, 232, 273], "signal": [0, 10, 23, 52, 119, 188, 232, 273, 323, 324, 325], "filter_by_row_nam": [0, 5, 10], "row_nam": [0, 10, 120, 189, 233, 274], "filter_by_row_sum": [0, 10], "threshold": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 121, 123, 136, 164, 166, 167, 183, 194, 201, 221, 243, 268, 285, 292, 323, 324, 325], "sum": [0, 1, 10, 121, 324, 325], "belov": [0, 10, 121], "minim": [0, 5, 10, 121, 123, 164, 165, 167, 323, 324, 325], "18": [0, 10, 121, 140, 205, 247, 268, 289, 324, 325], "filter_duplicate_id": [0, 5, 10], "neither": [0, 10, 35, 67, 122, 190, 234, 275], "duplic": [0, 5, 10, 122, 190, 234, 275], "filter_low_read": [0, 10, 165, 166, 167, 168, 169, 324], "lowli": [0, 5, 10, 123, 164], "rpkm": [0, 5, 10, 123, 145, 148, 158, 164], "miss": [0, 5, 10, 20, 49, 124, 192, 235, 277, 323, 325], "check": [0, 1, 10, 124, 192, 235, 323], "filt": [0, 10, 124, 150, 172, 173, 192, 206, 217, 218, 235, 248, 258, 259, 290, 302], "test_deseq_with_nan": [0, 10, 124, 192, 235, 308, 324], "filt_no_nan": [0, 10, 124, 192, 235], "filt_no_nan_basemean": [0, 10, 124, 192, 235], "27": [0, 6, 10, 124, 140, 191, 192, 205, 235, 247, 289, 324], "filt_no_nan_basemean_pv": [0, 10, 124, 192, 235], "pval": [0, 10, 124, 192, 235, 292, 324, 325], "filter_percentil": [0, 5, 10, 324], "entri": [0, 1, 10, 76, 77, 125, 152, 193, 236, 278, 324], "abov": [0, 2, 10, 125, 162, 167, 193, 213, 236, 255, 278, 298, 323, 324, 325], "pvalu": [0, 10, 125, 133, 171, 193, 199, 216, 236, 241, 257, 283, 301, 324, 325], "log2foldchang": [0, 10, 125, 133, 162, 171, 177, 191, 193, 198, 199, 213, 214, 216, 236, 241, 255, 257, 276, 283, 301, 324, 325], "vuls": [0, 10, 125, 193, 236], "filter_top_n": [0, 5, 10, 308, 324], "mani": [0, 1, 2, 5, 8, 10, 24, 30, 40, 53, 59, 72, 126, 195, 237, 279, 292, 323, 324, 325], "highest": [0, 10, 126, 127, 137, 140, 195, 196, 202, 205, 237, 238, 244, 247, 279, 280, 286, 289, 323], "find_paralogs_ensembl": [0, 10], "acanthochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "polyacanthu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "accipit": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nisu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ailuropoda": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanoleuca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amazona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "collaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amphilophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "citrinellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "amphiprion": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ocellari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "percula": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anaba": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "testudineu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "platyrhyncho": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zonorhyncha": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anoli": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "carolinensi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "anser": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "brachyrhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cygnoid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aotu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nancymaa": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "apteryx": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "haastii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "owenii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rowi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aquila": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysaeto": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "astatotilapia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calliptera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "astyanax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mexicanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pachon": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "athen": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cunicularia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "balaenoptera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "betta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "splenden": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bo": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "grunnien": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "indicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hybrid": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "mutu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tauru": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "bubo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "buteo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "japonicu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "cairina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "domestica": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "calidri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pugnax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pygmaea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "callithrix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "jacchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "callorhinchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "milii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "camarhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parvulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "camelu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dromedariu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cani": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "lupu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "dingo": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiari": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "familiarisbasenji": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisbox": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisgreatdan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "familiarisgsd": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "capra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hircu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "blackbeng": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "carassiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "auratu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carlito": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "syrichta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "castor": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "canadensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catagonu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "wagneri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catharu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ustulatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cavia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aperea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "porcellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cebu": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "imit": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "cercocebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ati": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cervu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hanglu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "yarkandensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chelonoidi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "abingdonii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chelydra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "serpentina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chinchilla": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lanigera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chlorocebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sabaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "choloepu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hoffmanni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysemi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "picta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bellii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chrysolophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pictu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ciona": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "intestinali": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "savignyi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "clupea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "harengu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "colobu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "angolensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "palliatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "corvu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moneduloid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cottoperca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gobio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coturnix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "japonica": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cricetulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "griseu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chok1gshd": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "crigri": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "picr": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "crocodylu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "porosu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyanist": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caeruleu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyclopteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lumpu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cynoglossu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "semilaevi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyprinodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "variegatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyprinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carpio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "germanmirror": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hebaor": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "huangh": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "dasypu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "novemcinctu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "delphinapteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leuca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "denticep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "clupeoid": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dicentrarchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "labrax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dipodomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ordii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dromaiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "novaehollandia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "echenei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "naucrat": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "echinop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "telfairi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "electrophoru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "electricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "eptatretu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "burgeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "equu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "asinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caballu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "erinaceu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "europaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "erpetoichthi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calabaricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "erythrura": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gouldia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "esox": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "luciu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "falco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tinnunculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "feli": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "catu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "ficedula": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "albicolli": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fukomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "damarensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fundulu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "heteroclitu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gadu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "morhua": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gallu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "gca000002315v5": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "gca016700215v2": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "gambusia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "affini": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gasterosteu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aculeatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "geospiza": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "forti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gopheru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "agassizii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "evgoodei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gorilla": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "gouania": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "willdenowi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "haplochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "burtoni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "heterocephalu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "glaber": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "femal": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "male": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286, 324, 325], "hippocampu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "come": [0, 5, 10, 127, 137, 140, 165, 196, 202, 205, 238, 244, 247, 280, 286, 289, 323, 324, 325], "hucho": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ictaluru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "punctatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ictidomi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tridecemlineatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "jaculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "junco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "hyemali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kryptolebia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marmoratu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "labru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bergylta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "larimichthi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "crocea": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "late": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "calcarif": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laticauda": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laticaudata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latimeria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "chalumna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lepidothrix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coronata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lepisosteu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "oculatu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "leptobrachium": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leishanens": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lonchura": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "striata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "loxodonta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "africana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lynx": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "macaca": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "fasciculari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mulatta": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "nemestrina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maluru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cyaneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "samu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "manacu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vitellinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mandrillu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leucophaeu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marmota": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mastacembelu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "armatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maylandia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zebra": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "meleagri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gallopavo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melopsittacu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "undulatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "merion": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "unguiculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mesocricetu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "microcebu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "microtu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ochrogast": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mola": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monodelphi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "monodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monocero": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "monopteru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "albu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "moschiferu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caroli": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "129s1svimj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "aj": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "akrj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "balbcj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "c3hhej": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "c57bl6nj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "casteij": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "cbaj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "dba2j": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "fvbnj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "lpj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "nodshiltj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "nzohlltj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pwkphj": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "wsbeij": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pahari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spicilegu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spretu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mustela": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "putoriu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "furo": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "myoti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lucifugu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "myripristi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murdjan": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "naja": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nannospalax": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "galili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neogobiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanostomu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neolamprologu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "brichardi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "neovison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vison": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nomascu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leucogeni": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "notamacropu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "eugenii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "notechi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scutatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nothobranchiu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "furzeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nothoprocta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "perdicaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "numida": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ochotona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "princep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "octodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "degu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oncorhynchu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kisutch": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mykiss": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tshawytscha": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oreochromi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aureu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "niloticu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ornithorhynchu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "anatinu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "oryctolagu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cuniculu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "oryzia": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "javanicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latip": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "hni": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hsok": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "melastigma": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinensi": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "otolemur": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "garnettii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "otu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sunia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ovi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rambouillet": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pan": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "paniscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "troglodyt": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "panthera": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "leo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pardu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tigri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "altaica": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "papio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anubi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parambassi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ranga": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paramormyrop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "kingsleya": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "major": [0, 1, 10, 127, 128, 136, 137, 138, 139, 140, 196, 197, 201, 202, 203, 204, 205, 238, 239, 243, 244, 245, 246, 247, 280, 281, 285, 286, 287, 288, 289, 323, 325], "pavo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cristatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pelodiscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pelusio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "castaneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "periophthalmu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "magnuspinnatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "peromyscu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maniculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bairdii": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "petromyzon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "marinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phascolarcto": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "cinereu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phasianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "colchicu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "phocoena": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "physet": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "catodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "piliocolobu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tephroscel": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "podarci": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "murali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "poecilia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "formosa": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "latipinna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "mexicana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "reticulata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pogona": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vitticep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pongo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "abelii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "procavia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "capensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "prolemur": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "simu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "propithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "coquer": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pseudonaja": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "textili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pteropu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vampyru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pundamilia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nyererei": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "pygocentru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nattereri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rattu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "norvegicu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "shrspbbbutx": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "shrutx": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "wkybbb": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "rhinolophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ferrumequinum": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rhinopithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "bieti": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "roxellana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "saimiri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "boliviensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "fasciatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salmo": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salar": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "trutta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "salvat": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "meriana": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sander": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lucioperca": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sarcophilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "harrisii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sciuru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vulgari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scleropag": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "formosu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "scophthalmu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maximu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "serinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "canaria": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "seriola": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dumerili": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "lalandi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dorsali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sinocyclocheilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "anshuiensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "grahami": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rhinocer": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sorex": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "araneu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sparu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "aurata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "spermophilu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "dauricu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sphaeramia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "orbiculari": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "sphenodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "stachyri": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "ruficep": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "stegast": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "partitu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "strigop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "habroptila": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "strix": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "occidentali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "caurina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "struthio": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "australi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "suricata": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "suricatta": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "su": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "scrofa": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "bamei": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "berkshir": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "hampshir": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "jinhua": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "landrac": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "largewhit": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "meishan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "pietrain": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "rongchang": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "tibetan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "usmarc": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "wuzhishan": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "taeniopygia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "guttata": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "takifugu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "rubrip": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "terrapen": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "carolina": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "triungui": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tetraodon": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "nigroviridi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "theropithecu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "gelada": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tupaia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "belangeri": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "tursiop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "truncatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "urocitellu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "parryii": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ursu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "americanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maritimu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "thibetanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "varanu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "komodoensi": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vicugna": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "paco": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vombatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ursinu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "vulp": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "xenopu": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "tropicali": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289], "xiphophoru": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "couchianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "maculatu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zalophu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "californianu": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zonotrichia": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "zosterop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "laterali": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "melanop": [0, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "filter_percent_ident": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "paralog": [0, 4, 5, 10, 127, 128, 196, 197, 238, 239, 280, 281, 323, 324, 325], "speci": [0, 10, 127, 128, 137, 138, 139, 140, 196, 197, 202, 203, 204, 205, 238, 239, 244, 245, 246, 247, 280, 281, 286, 287, 288, 289, 324, 325], "encount": [0, 5, 10, 127, 137, 140, 196, 202, 205, 238, 244, 247, 280, 286, 289], "ortholog": [0, 5, 10, 127, 137, 138, 139, 140, 196, 202, 203, 204, 205, 238, 244, 245, 246, 247, 280, 286, 287, 288, 289], "percent_ident": [0, 10, 127, 137, 196, 202, 238, 244, 280, 286], "find_paralogs_panth": [0, 10], "amborella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichopoda": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "anophel": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gambia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aquifex": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aeolicu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "arabidopsi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 324, 325], "ashbya": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gossypii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bacillu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cereu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "subtili": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bacteroid": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thetaiotaomicron": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "batrachochytrium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dendrobatidi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brachypodium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "distachyon": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bradyrhizobium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "diazoefficien": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "branchiostoma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "florida": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brassica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "napu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "rapa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "subsp": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pekinensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "briggsa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "candida": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "albican": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "capsicum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "annuum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chlamydia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trachomati": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chlamydomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "reinhardtii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "chloroflexu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aurantiacu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "citru": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "clostridium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "botulinum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "coxiella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "burnetii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cryptococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neoforman": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cucumi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sativu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "daphnia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pulex": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "deinococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "radioduran": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dictyoglomu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "turgidum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "dictyostelium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "discoideum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "purpureum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "emericella": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "nidulan": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "entamoeba": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "histolytica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "erythranth": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "eucalyptu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "grandi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "fusobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nucleatum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "geobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sulfurreducen": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "giardia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gloeobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "violaceu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "glycin": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gossypium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "hirsutum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "haemophilu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "influenza": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "halobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "salinarum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helianthu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "annuu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helicobact": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pylori": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "hordeum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vulgar": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ixod": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "scapulari": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "juglan": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "regia": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "klebsormidium": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "niten": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "korarchaeum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cryptofilum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lactuca": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "sativa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "leishmania": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "leptospira": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "interrogan": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "listeria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "monocytogen": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "manihot": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "esculenta": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "marchantia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "polymorpha": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "medicago": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "truncatula": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "methanocaldococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "jannaschii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "methanosarcina": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "acetivoran": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "monosiga": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brevicolli": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "musa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "acuminata": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "malaccensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "mycobacterium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tuberculosi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neisseria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "meningitidi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "serogroup": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "b": [0, 1, 2, 9, 10, 35, 67, 77, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289, 323, 325], "nelumbo": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nucifera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nematostella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vectensi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "neosartorya": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "fumigata": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "neurospora": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "crassa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nicotiana": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tabacum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "nitrosopumilu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "oryza": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "paramecium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tetraurelia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "phaeosphaeria": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "nodorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "physcomitrella": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "paten": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "phytophthora": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ramorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "plasmodium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "falciparum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "populu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichocarpa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pristionchu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pacificu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "prunu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "persica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pseudomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aeruginosa": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "puccinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "gramini": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pyrobaculum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aerophilum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "rhodopirellula": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "baltica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ricinu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "communi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "salmonella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "typhimurium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sclerotinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sclerotiorum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "selaginella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "moellendorffii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "setaria": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "italica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "shewanella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "oneidensi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "solanum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lycopersicum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tuberosum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sorghum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "bicolor": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "spinacia": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "oleracea": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "staphylococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "streptococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pneumonia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "streptomyc": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "coelicolor": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "strongylocentrotu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "purpuratu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "sulfolobu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "solfataricu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "synechocysti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thalassiosira": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pseudonana": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "theobroma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cacao": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thermococcu": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "kodakaraensi": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "thermodesulfovibrio": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yellowstonii": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "thermotoga": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "maritima": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "tribolium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "castaneum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vaginali": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trichoplax": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "adhaeren": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "triticum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "aestivum": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "trypanosoma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "brucei": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "ustilago": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "maydi": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vibrio": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "cholera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "viti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "vinifera": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "xanthomona": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "campestri": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yarrowia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "lipolytica": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "yersinia": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pesti": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "zea": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "zostera": [0, 10, 128, 138, 139, 197, 203, 204, 239, 245, 246, 281, 287, 288], "marina": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "helobdella": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "robusta": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "mycoplasma": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "genitalium": [0, 10, 128, 138, 139, 140, 197, 203, 204, 205, 239, 245, 246, 247, 281, 287, 288, 289], "pantherdb": [0, 10, 128, 139, 197, 204, 239, 246, 281, 288], "fold_chang": [0, 5, 10, 324], "numer_nam": [0, 10, 129], "denom_nam": [0, 10, 129], "foldchangefilt": [0, 4, 10, 129, 306, 308], "generar": [0, 10, 129], "counted_fold_chang": [0, 10, 129, 324], "cond1_rep1": [0, 10, 129, 324], "cond1_rep2": [0, 10, 129, 324], "cond2_rep1": [0, 10, 129, 324], "cond_2rep2": [0, 10, 129], "f": [0, 9, 10, 24, 53, 65, 129, 140, 205, 247, 268, 276, 289, 292, 299, 324], "cond2_rep2": [0, 10, 129, 324], "from_fold": [0, 5, 10], "folder_path": [0, 10, 131, 132], "save_csv": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 131, 132, 292, 324], "input_format": [0, 10, 131, 132], "over": [0, 1, 5, 10, 24, 53, 131, 132, 164, 324, 325], "uncount": [0, 10, 131, 132, 147, 324], "htcount": [0, 10, 131, 132], "joint": [0, 10, 131, 132], "counted_fnam": [0, 10, 131, 132, 324], "uncounted_fnam": [0, 10, 131, 132, 324], "unalign": [0, 10, 131, 132, 324, 325], "under": [0, 5, 10, 24, 30, 31, 34, 40, 53, 59, 60, 63, 64, 65, 66, 72, 131, 132, 153, 292, 323, 324, 325], "need": [0, 1, 7, 8, 10, 131, 132, 164, 323, 324, 325], "test_count_from_fold": [0, 10, 131, 132, 324], "from_folder_htseqcount": [0, 5, 10, 324], "norm_to_rpm": [0, 10, 132, 324], "htseq": [0, 9, 10, 132, 147], "regardless": [0, 10, 132, 323], "defualt": [0, 10, 132], "fill": [0, 10, 132], "name_for_reads_csv_fil": [0, 10, 132, 324], "name_for_uncounted_reads_csv_fil": [0, 10, 132, 324], "head": [0, 10, 159, 211, 253, 296, 324, 325], "6820": [0, 10, 133, 199, 241, 283, 324], "755327": [0, 10, 133, 199, 241, 283, 324], "567762": [0, 10, 133, 199, 241, 283, 324], "000000e": [0, 10, 133, 199, 241, 283, 324], "00": [0, 10, 133, 140, 165, 199, 205, 241, 247, 283, 289, 324], "3049": [0, 10, 133, 199, 241, 283, 324], "625670": [0, 10, 133, 199, 241, 283, 324], "138071": [0, 10, 133, 199, 241, 283, 324], "660000e": [0, 10, 133, 199, 241, 283, 324], "280000e": [0, 10, 133, 199, 241, 283, 324], "298": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "wbgene00000004": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 133, 136, 170, 175, 199, 201, 215, 220, 241, 243, 256, 261, 283, 285, 300, 305, 324, 325], "1432": [0, 10, 133, 199, 241, 283, 324], "911791": [0, 10, 133, 199, 241, 283, 324], "111737": [0, 10, 133, 199, 241, 283, 324], "400000e": [0, 10, 133, 171, 199, 216, 241, 257, 283, 301, 324], "237": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "920000e": [0, 10, 133, 199, 241, 283, 324], "233": [0, 10, 133, 199, 241, 283, 324], "wbgene00000005": [0, 10, 38, 70, 133, 170, 175, 199, 215, 220, 241, 256, 261, 283, 300, 305, 324, 325], "4028": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "154186": [0, 10, 133, 199, 241, 283, 324], "534112": [0, 10, 133, 199, 241, 283, 324], "700000e": [0, 10, 133, 171, 199, 216, 241, 257, 283, 301, 324], "228": [0, 10, 133, 199, 241, 283, 324], "225": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "wbgene00000006": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70, 133, 170, 175, 199, 215, 220, 241, 256, 261, 283, 300, 305, 324, 325], "1230": [0, 10, 133, 199, 241, 283, 324], "585240": [0, 10, 133, 199, 241, 283, 324], "157428": [0, 10, 133, 199, 241, 283, 324], "216": [0, 10, 133, 140, 167, 199, 205, 241, 247, 283, 289, 324], "590000e": [0, 10, 133, 199, 241, 283, 324], "213": [0, 10, 133, 140, 199, 205, 241, 247, 283, 289, 324], "appear": [0, 5, 10, 18, 24, 30, 35, 40, 47, 53, 59, 64, 65, 66, 67, 72, 73, 136, 201, 243, 285, 315, 316, 317, 323, 324, 325], "correspond": [0, 4, 10, 149, 152, 158, 161, 165, 166, 167, 168, 169, 212, 254, 297, 324, 325], "myset": [0, 10], "nwbgene00000003": [0, 10], "nwbgene12345678": [0, 10], "mystr": [0, 10], "ma_plot": [0, 5, 10], "ref_column": [0, 10, 135, 143], "split_plot": [0, 10, 135, 153, 165, 166, 167, 168, 169], "ma": [0, 5, 10, 135, 140, 205, 247, 289], "chosen": [0, 10, 135, 143, 324], "upper": [0, 10, 135, 143, 324, 325], "quartil": [0, 10, 135, 143], "closest": [0, 5, 10, 135, 143], "majority_vote_intersect": [0, 5, 10], "majority_threshold": [0, 10, 136, 201, 243, 285], "majority_threhold": [0, 5, 10, 136, 201, 243, 285], "vote": [0, 10, 136, 201, 243, 285, 323, 325], "equival": [0, 10, 35, 67, 136, 201, 243, 285], "uphold": [0, 10, 136, 201, 243, 285], "b_set": [0, 10, 136, 201, 243, 285], "map_orthologs_ensembl": [0, 10], "map_to_organ": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "map_from_organ": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "non_unique_mod": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289], "remove_unmapped_gen": [0, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304], "nearest": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 323, 324, 325], "translat": [0, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304, 324, 325], "unmap": [0, 10, 137, 138, 139, 140, 202, 203, 204, 205, 244, 245, 246, 247, 286, 287, 288, 289, 324], "could": [0, 1, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 262, 286, 287, 288, 289, 304, 323, 324, 325], "remain": [0, 5, 10, 37, 69, 137, 138, 139, 140, 174, 202, 203, 204, 205, 219, 244, 245, 246, 247, 260, 286, 287, 288, 289, 304, 323, 324, 325], "map_orthologs_orthoinspector": [0, 10], "orthoinspector": [0, 5, 9, 10, 138, 203, 245, 287], "map_orthologs_panth": [0, 10], "filter_least_diverg": [0, 10, 139, 204, 246, 288], "diverg": [0, 10, 139, 204, 246, 288], "map_orthologs_phylomedb": [0, 10], "azorhizobium": [0, 10, 140, 205, 247, 289], "caulinodan": [0, 10, 140, 205, 247, 289], "ORS": [0, 10, 140, 205, 247, 289], "571": [0, 10, 140, 205, 247, 289], "buchnera": [0, 10, 140, 205, 247, 289], "aphidicola": [0, 10, 140, 205, 247, 289], "g002": [0, 10, 140, 205, 247, 289], "myzu": [0, 10, 140, 205, 247, 289], "cellulomona": [0, 10, 140, 205, 247, 289], "gilvu": [0, 10, 140, 205, 247, 289], "atcc": [0, 10, 140, 205, 247, 289], "13127": [0, 10, 140, 205, 247, 289], "thermophilum": [0, 10, 140, 205, 247, 289], "h": [0, 9, 10, 140, 205, 247, 289], "methylophilu": [0, 10, 140, 205, 247, 289], "methylotrophu": [0, 10, 140, 205, 247, 289], "dsm": [0, 10, 140, 205, 247, 289], "46235": [0, 10, 140, 205, 247, 289], "53528": [0, 10, 140, 205, 247, 289], "pelobact": [0, 10, 140, 205, 247, 289], "carbinolicu": [0, 10, 140, 205, 247, 289], "2380": [0, 10, 140, 205, 247, 289], "putrefacien": [0, 10, 140, 205, 247, 289], "cn": [0, 10, 140, 205, 247, 289], "32": [0, 2, 10, 140, 165, 205, 247, 289, 324, 325], "myxococcu": [0, 10, 140, 205, 247, 289], "fulvu": [0, 10, 140, 205, 247, 289], "hw": [0, 10, 140, 205, 247, 289], "xanthu": [0, 10, 140, 205, 247, 289], "dk": [0, 10, 140, 205, 247, 289], "1622": [0, 10, 140, 205, 247, 289], "stigmatella": [0, 10, 140, 205, 247, 289], "aurantiaca": [0, 10, 140, 205, 247, 289], "dw4": [0, 10, 140, 205, 247, 289], "cystobact": [0, 10, 140, 205, 247, 289], "fuscu": [0, 10, 140, 205, 247, 289], "2262": [0, 10, 140, 205, 247, 289], "chondromyc": [0, 10, 140, 205, 247, 289], "apiculatu": [0, 10, 140, 205, 247, 289], "436": [0, 10, 140, 205, 247, 289], "sorangium": [0, 10, 140, 205, 247, 289], "cellulosum": [0, 10, 140, 205, 247, 289], "so0157": [0, 10, 140, 205, 247, 289], "vitreoscilla": [0, 10, 140, 205, 247, 289], "stercoraria": [0, 10, 140, 205, 247, 289], "513": [0, 10, 140, 205, 247, 289], "herpetosiphon": [0, 10, 140, 205, 247, 289], "785": [0, 10, 140, 205, 247, 289], "simonsiella": [0, 10, 140, 205, 247, 289], "muelleri": [0, 10, 140, 205, 247, 289], "29453": [0, 10, 140, 205, 247, 289], "hyphomona": [0, 10, 140, 205, 247, 289], "jannaschiana": [0, 10, 140, 205, 247, 289], "vp2": [0, 10, 140, 205, 247, 289], "flectobacillu": [0, 10, 140, 205, 247, 289], "103": [0, 10, 140, 167, 205, 247, 289], "cyclobacterium": [0, 10, 140, 205, 247, 289], "marinum": [0, 10, 140, 205, 247, 289], "745": [0, 10, 140, 205, 247, 289], "runella": [0, 10, 140, 205, 247, 289], "slithyformi": [0, 10, 140, 205, 247, 289], "19594": [0, 10, 140, 205, 247, 289], "spirosoma": [0, 10, 140, 205, 247, 289], "lingual": [0, 10, 140, 205, 247, 289], "74": [0, 9, 10, 140, 167, 169, 171, 205, 216, 247, 257, 289, 301, 324, 325], "rubinisphaera": [0, 10, 140, 205, 247, 289], "brasiliensi": [0, 10, 140, 205, 247, 289], "5305": [0, 10, 140, 205, 247, 289], "planctopiru": [0, 10, 140, 205, 247, 289], "limnophila": [0, 10, 140, 205, 247, 289], "3776": [0, 10, 140, 205, 247, 289], "gimesia": [0, 10, 140, 205, 247, 289], "mari": [0, 10, 140, 205, 247, 289], "8797": [0, 10, 140, 205, 247, 289], "blastopirellula": [0, 10, 140, 205, 247, 289], "3645": [0, 10, 140, 205, 247, 289], "pirellula": [0, 10, 140, 205, 247, 289], "staleyi": [0, 10, 140, 205, 247, 289], "6068": [0, 10, 140, 205, 247, 289], "isosphaera": [0, 10, 140, 205, 247, 289], "pallida": [0, 10, 140, 205, 247, 289], "43644": [0, 10, 140, 205, 247, 289], "methylocysti": [0, 10, 140, 205, 247, 289], "parvu": [0, 10, 140, 205, 247, 289], "obbp": [0, 10, 140, 205, 247, 289], "borreliella": [0, 10, 140, 205, 247, 289], "burgdorferi": [0, 10, 140, 205, 247, 289], "b31": [0, 10, 140, 205, 247, 289], "borrelia": [0, 10, 140, 205, 247, 289], "hermsii": [0, 10, 140, 205, 247, 289], "dah": [0, 10, 140, 205, 247, 289], "parkeri": [0, 10, 140, 205, 247, 289], "slo": [0, 10, 140, 205, 247, 289], "turicata": [0, 10, 140, 205, 247, 289], "91e135": [0, 10, 140, 205, 247, 289], "anserina": [0, 10, 140, 205, 247, 289], "ba2": [0, 10, 140, 205, 247, 289], "sediminispirochaeta": [0, 10, 140, 205, 247, 289], "bajacaliforniensi": [0, 10, 140, 205, 247, 289], "16054": [0, 10, 140, 205, 247, 289], "spirochaeta": [0, 10, 140, 205, 247, 289], "thermophila": [0, 10, 140, 205, 247, 289], "6192": [0, 10, 140, 205, 247, 289], "treponema": [0, 10, 140, 205, 247, 289], "denticola": [0, 10, 140, 205, 247, 289], "35405": [0, 10, 140, 205, 247, 289], "brachyspira": [0, 10, 140, 205, 247, 289], "hyodysenteria": [0, 10, 140, 205, 247, 289], "wa1": [0, 10, 140, 205, 247, 289], "pallidum": [0, 10, 140, 205, 247, 289], "nichol": [0, 10, 140, 205, 247, 289], "phagedeni": [0, 10, 140, 205, 247, 289], "f0421": [0, 10, 140, 205, 247, 289], "bryantii": [0, 10, 140, 205, 247, 289], "nk4a124": [0, 10, 140, 205, 247, 289], "saccharophilum": [0, 10, 140, 205, 247, 289], "2985": [0, 10, 140, 205, 247, 289], "succinifacien": [0, 10, 140, 205, 247, 289], "2489": [0, 10, 140, 205, 247, 289], "biflexa": [0, 10, 140, 205, 247, 289], "serovar": [0, 10, 140, 205, 247, 289], "patoc": [0, 10, 140, 205, 247, 289], "strain": [0, 10, 140, 205, 247, 289], "pari": [0, 10, 140, 205, 247, 289], "lai": [0, 10, 140, 205, 247, 289], "56601": [0, 10, 140, 205, 247, 289], "borgpetersenii": [0, 10, 140, 205, 247, 289], "hardjo": [0, 10, 140, 205, 247, 289], "bovi": [0, 10, 140, 205, 247, 289], "l550": [0, 10, 140, 205, 247, 289], "leptospirillum": [0, 10, 140, 205, 247, 289], "ferrooxidan": [0, 10, 140, 205, 247, 289], "c2": [0, 10, 140, 205, 247, 289], "leptonema": [0, 10, 140, 205, 247, 289], "illini": [0, 10, 140, 205, 247, 289], "21528": [0, 10, 140, 205, 247, 289], "novispirillum": [0, 10, 140, 205, 247, 289], "itersonii": [0, 10, 140, 205, 247, 289], "12639": [0, 10, 140, 205, 247, 289], "aquaspirillum": [0, 10, 140, 205, 247, 289], "serpen": [0, 10, 140, 205, 247, 289], "azospirillum": [0, 10, 140, 205, 247, 289], "sp": [0, 10, 140, 205, 247, 289], "b510": [0, 10, 140, 205, 247, 289], "campylobact": [0, 10, 140, 205, 247, 289], "76339": [0, 10, 140, 205, 247, 289], "fetu": [0, 10, 140, 205, 247, 289], "venereali": [0, 10, 140, 205, 247, 289], "nctc": [0, 10, 140, 205, 247, 289], "10354": [0, 10, 140, 205, 247, 289], "jejuni": [0, 10, 140, 205, 247, 289], "414": [0, 10, 140, 205, 247, 289], "concisu": [0, 10, 140, 205, 247, 289], "13826": [0, 10, 140, 205, 247, 289], "curvu": [0, 10, 140, 205, 247, 289], "525": [0, 9, 10, 140, 168, 205, 247, 289], "92": [0, 10, 140, 165, 166, 205, 247, 289], "lari": [0, 10, 140, 205, 247, 289], "rm2100": [0, 10, 140, 205, 247, 289], "rectu": [0, 10, 140, 205, 247, 289], "rm3267": [0, 10, 140, 205, 247, 289], "showa": [0, 10, 140, 205, 247, 289], "csunswcd": [0, 10, 140, 205, 247, 289], "sputorum": [0, 10, 140, 205, 247, 289], "biovar": [0, 10, 140, 205, 247, 289], "26695": [0, 10, 140, 205, 247, 289], "acinonychi": [0, 10, 140, 205, 247, 289], "sheeba": [0, 10, 140, 205, 247, 289], "cinaedi": [0, 10, 140, 205, 247, 289], "ccug": [0, 10, 140, 205, 247, 289], "18818": [0, 10, 140, 205, 247, 289], "baa": [0, 10, 140, 205, 247, 289], "847": [0, 10, 140, 205, 247, 289], "49179": [0, 10, 140, 205, 247, 289], "fennellia": [0, 10, 140, 205, 247, 289], "mry12": [0, 10, 140, 205, 247, 289], "0050": [0, 10, 140, 205, 247, 289], "12198": [0, 10, 140, 205, 247, 289], "pseudoalteromona": [0, 10, 140, 205, 247, 289], "haloplankti": [0, 10, 140, 205, 247, 289], "14393": [0, 10, 140, 205, 247, 289], "brucella": [0, 10, 140, 205, 247, 289], "abortu": [0, 10, 140, 205, 247, 289], "2308": [0, 10, 140, 205, 247, 289], "25840": [0, 10, 140, 205, 247, 289], "elizabethkingia": [0, 10, 140, 205, 247, 289], "meningoseptica": [0, 10, 140, 205, 247, 289], "13253": [0, 10, 140, 205, 247, 289], "nbrc": [0, 10, 140, 205, 247, 289], "12535": [0, 10, 140, 205, 247, 289], "flavobacterium": [0, 10, 140, 205, 247, 289], "aquatil": [0, 10, 140, 205, 247, 289], "lmg": [0, 10, 140, 205, 247, 289], "4008": [0, 10, 140, 205, 247, 289], "11947": [0, 10, 140, 205, 247, 289], "empedobact": [0, 10, 140, 205, 247, 289], "brevi": [0, 10, 140, 205, 247, 289], "14943": [0, 10, 140, 205, 247, 289], "43319": [0, 10, 140, 205, 247, 289], "chryseobacterium": [0, 10, 140, 205, 247, 289], "gleum": [0, 10, 140, 205, 247, 289], "35910": [0, 10, 140, 205, 247, 289], "psychroflexu": [0, 10, 140, 205, 247, 289], "gondwanensi": [0, 10, 140, 205, 247, 289], "acam": [0, 10, 140, 205, 247, 289], "indologen": [0, 10, 140, 205, 247, 289], "14944": [0, 10, 140, 205, 247, 289], "myroid": [0, 10, 140, 205, 247, 289], "odoratu": [0, 10, 140, 205, 247, 289], "2801": [0, 10, 140, 205, 247, 289], "sphingobacterium": [0, 10, 140, 205, 247, 289], "spiritivorum": [0, 10, 140, 205, 247, 289], "33861": [0, 10, 140, 205, 247, 289], "francisella": [0, 10, 140, 205, 247, 289], "cf": [0, 10, 140, 205, 247, 289], "tularensi": [0, 10, 140, 205, 247, 289], "novicida": [0, 10, 140, 205, 247, 289], "3523": [0, 10, 140, 205, 247, 289], "paracoccu": [0, 10, 140, 205, 247, 289], "denitrifican": [0, 10, 140, 205, 247, 289], "pd1222": [0, 10, 140, 205, 247, 289], "thermu": [0, 10, 140, 205, 247, 289], "aquaticu": [0, 10, 140, 205, 247, 289], "y51mc23": [0, 10, 140, 205, 247, 289], "thermophilu": [0, 10, 140, 205, 247, 289], "hb8": [0, 10, 140, 205, 247, 289], "meiothermu": [0, 10, 140, 205, 247, 289], "ruber": [0, 10, 140, 205, 247, 289], "1279": [0, 10, 140, 205, 247, 289], "xanthobact": [0, 10, 140, 205, 247, 289], "autotrophicu": [0, 10, 140, 205, 247, 289], "py2": [0, 10, 140, 205, 247, 289], "comamona": [0, 10, 140, 205, 247, 289], "testosteroni": [0, 10, 140, 205, 247, 289], "kf": [0, 10, 140, 205, 247, 289], "pao1": [0, 10, 140, 205, 247, 289], "atlantica": [0, 10, 140, 205, 247, 289], "t6c": [0, 10, 140, 205, 247, 289], "burkholderia": [0, 10, 140, 205, 247, 289], "cepacia": [0, 10, 140, 205, 247, 289], "brevundimona": [0, 10, 140, 205, 247, 289], "diminuta": [0, 10, 140, 205, 247, 289], "470": [0, 10, 140, 205, 247, 289], "fluorescen": [0, 10, 140, 205, 247, 289], "ncimb": [0, 10, 140, 205, 247, 289], "11764": [0, 10, 140, 205, 247, 289], "fragi": [0, 10, 140, 205, 247, 289], "b25": [0, 10, 140, 205, 247, 289], "mendocina": [0, 10, 140, 205, 247, 289], "nk": [0, 10, 140, 205, 247, 289], "pseudoalcaligen": [0, 10, 140, 205, 247, 289], "ad6": [0, 10, 140, 205, 247, 289], "putida": [0, 10, 140, 205, 247, 289], "kt2440": [0, 10, 140, 205, 247, 289], "ralstonia": [0, 10, 140, 205, 247, 289], "solanacearum": [0, 10, 140, 205, 247, 289], "gmi1000": [0, 10, 140, 205, 247, 289], "stutzeri": [0, 10, 140, 205, 247, 289], "mf28": [0, 10, 140, 205, 247, 289], "syringa": [0, 10, 140, 205, 247, 289], "pv": [0, 10, 140, 205, 247, 289], "b728a": [0, 10, 140, 205, 247, 289], "pickettii": [0, 10, 140, 205, 247, 289], "dtp0602": [0, 10, 140, 205, 247, 289], "gluma": [0, 10, 140, 205, 247, 289], "bgr1": [0, 10, 140, 205, 247, 289], "translucen": [0, 10, 140, 205, 247, 289], "dar61454": [0, 10, 140, 205, 247, 289], "citri": [0, 10, 140, 205, 247, 289], "306": [0, 10, 140, 169, 205, 247, 289], "pxo99a": [0, 10, 140, 205, 247, 289], "azotobact": [0, 10, 140, 205, 247, 289], "chroococcum": [0, 10, 140, 205, 247, 289], "8003": [0, 10, 140, 205, 247, 289], "vinelandii": [0, 10, 140, 205, 247, 289], "dj": [0, 10, 140, 205, 247, 289], "agrobacterium": [0, 10, 140, 205, 247, 289], "radiobact": [0, 10, 140, 205, 247, 289], "k84": [0, 10, 140, 205, 247, 289], "rhizogen": [0, 10, 140, 205, 247, 289], "s4": [0, 10, 140, 205, 247, 289], "japonicum": [0, 10, 140, 205, 247, 289], "sinorhizobium": [0, 10, 140, 205, 247, 289], "fredii": [0, 10, 140, 205, 247, 289], "usda": [0, 10, 140, 205, 247, 289], "257": [0, 10, 140, 205, 247, 289], "mesorhizobium": [0, 10, 140, 205, 247, 289], "loti": [0, 10, 140, 205, 247, 289], "cj3sym": [0, 10, 140, 205, 247, 289], "meliloti": [0, 10, 140, 205, 247, 289], "1021": [0, 10, 140, 205, 247, 289], "rhizobium": [0, 10, 140, 205, 247, 289], "leguminosarum": [0, 10, 140, 205, 247, 289], "bv": [0, 10, 140, 205, 247, 289], "vicia": [0, 10, 140, 205, 247, 289], "gb30": [0, 10, 140, 205, 247, 289], "tropici": [0, 10, 140, 205, 247, 289], "ciat": [0, 10, 140, 205, 247, 289], "899": [0, 10, 140, 205, 247, 289], "neorhizobium": [0, 10, 140, 205, 247, 289], "galega": [0, 10, 140, 205, 247, 289], "orientali": [0, 10, 140, 205, 247, 289], "hambi": [0, 10, 140, 205, 247, 289], "540": [0, 10, 140, 205, 247, 289], "methylobacillu": [0, 10, 140, 205, 247, 289], "flagellatu": [0, 10, 140, 205, 247, 289], "kt": [0, 10, 140, 205, 247, 289], "glycogen": [0, 10, 140, 205, 247, 289], "jcm": [0, 10, 140, 205, 247, 289], "2850": [0, 10, 140, 205, 247, 289], "methylorubrum": [0, 10, 140, 205, 247, 289], "extorquen": [0, 10, 140, 205, 247, 289], "am1": [0, 10, 140, 205, 247, 289], "methylococcu": [0, 10, 140, 205, 247, 289], "capsulatu": [0, 10, 140, 205, 247, 289], "bath": [0, 10, 140, 205, 247, 289], "methylomona": [0, 10, 140, 205, 247, 289], "methanica": [0, 10, 140, 205, 247, 289], "mc09": [0, 10, 140, 205, 247, 289], "methylosinu": [0, 10, 140, 205, 247, 289], "trichosporium": [0, 10, 140, 205, 247, 289], "ob3b": [0, 10, 140, 205, 247, 289], "acetobact": [0, 10, 140, 205, 247, 289], "aceti": [0, 10, 140, 205, 247, 289], "23746": [0, 10, 140, 205, 247, 289], "komagataeibact": [0, 10, 140, 205, 247, 289], "hansenii": [0, 10, 140, 205, 247, 289], "23769": [0, 10, 140, 205, 247, 289], "pasteurianu": [0, 10, 140, 205, 247, 289], "3p3": [0, 10, 140, 205, 247, 289], "gluconobact": [0, 10, 140, 205, 247, 289], "oxydan": [0, 10, 140, 205, 247, 289], "h24": [0, 10, 140, 205, 247, 289], "legionella": [0, 10, 140, 205, 247, 289], "pneumophila": [0, 10, 140, 205, 247, 289], "hackelia": [0, 10, 140, 205, 247, 289], "longbeacha": [0, 10, 140, 205, 247, 289], "nsw150": [0, 10, 140, 205, 247, 289], "tatlockia": [0, 10, 140, 205, 247, 289], "micdadei": [0, 10, 140, 205, 247, 289], "fluoribact": [0, 10, 140, 205, 247, 289], "dumoffii": [0, 10, 140, 205, 247, 289], "ny": [0, 10, 140, 205, 247, 289], "acinetobact": [0, 10, 140, 205, 247, 289], "baumannii": [0, 10, 140, 205, 247, 289], "calcoaceticu": [0, 10, 140, 205, 247, 289], "anc": [0, 10, 140, 205, 247, 289], "3680": [0, 10, 140, 205, 247, 289], "moraxella": [0, 10, 140, 205, 247, 289], "catarrhali": [0, 10, 140, 205, 247, 289], "o35": [0, 10, 140, 205, 247, 289], "cinerea": [0, 10, 140, 205, 247, 289], "14685": [0, 10, 140, 205, 247, 289], "flavescen": [0, 10, 140, 205, 247, 289], "nrl30031": [0, 10, 140, 205, 247, 289], "h210": [0, 10, 140, 205, 247, 289], "gonorrhoea": [0, 10, 140, 205, 247, 289], "nccp11945": [0, 10, 140, 205, 247, 289], "lactamica": [0, 10, 140, 205, 247, 289], "020": [0, 10, 140, 205, 247, 289], "06": [0, 6, 10, 140, 205, 247, 289], "mc58": [0, 10, 140, 205, 247, 289], "mucosa": [0, 10, 140, 205, 247, 289], "25996": [0, 10, 140, 205, 247, 289], "polysaccharea": [0, 10, 140, 205, 247, 289], "43768": [0, 10, 140, 205, 247, 289], "sicca": [0, 10, 140, 205, 247, 289], "29256": [0, 10, 140, 205, 247, 289], "elongata": [0, 10, 140, 205, 247, 289], "glycolytica": [0, 10, 140, 205, 247, 289], "29315": [0, 10, 140, 205, 247, 289], "33926": [0, 10, 140, 205, 247, 289], "thermomicrobium": [0, 10, 140, 205, 247, 289], "roseum": [0, 10, 140, 205, 247, 289], "5159": [0, 10, 140, 205, 247, 289], "kingella": [0, 10, 140, 205, 247, 289], "33394": [0, 10, 140, 205, 247, 289], "kinga": [0, 10, 140, 205, 247, 289], "23330": [0, 10, 140, 205, 247, 289], "orali": [0, 10, 140, 205, 247, 289], "51147": [0, 10, 140, 205, 247, 289], "alcaligen": [0, 10, 140, 205, 247, 289], "faecali": [0, 10, 140, 205, 247, 289], "bordetella": [0, 10, 140, 205, 247, 289], "bronchiseptica": [0, 10, 140, 205, 247, 289], "rb50": [0, 10, 140, 205, 247, 289], "parapertussi": [0, 10, 140, 205, 247, 289], "bpp5": [0, 10, 140, 205, 247, 289], "pertussi": [0, 10, 140, 205, 247, 289], "tohama": [0, 10, 140, 205, 247, 289], "avium": [0, 10, 140, 205, 247, 289], "197n": [0, 10, 140, 205, 247, 289], "acidiphilium": [0, 10, 140, 205, 247, 289], "angustum": [0, 10, 140, 205, 247, 289], "35903": [0, 10, 140, 205, 247, 289], "cryptum": [0, 10, 140, 205, 247, 289], "jf": [0, 10, 140, 205, 247, 289], "acidocella": [0, 10, 140, 205, 247, 289], "facili": [0, 10, 140, 205, 247, 289], "35904": [0, 10, 140, 205, 247, 289], "ochrobactrum": [0, 10, 140, 205, 247, 289], "anthropi": [0, 10, 140, 205, 247, 289], "49188": [0, 10, 140, 205, 247, 289], "polaribact": [0, 10, 140, 205, 247, 289], "irgensii": [0, 10, 140, 205, 247, 289], "p": [0, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 140, 177, 194, 205, 221, 247, 289, 292, 323, 324, 325], "beijerinckia": [0, 10, 140, 205, 247, 289], "indica": [0, 10, 140, 205, 247, 289], "9039": [0, 10, 140, 205, 247, 289], "chromobacterium": [0, 10, 140, 205, 247, 289], "violaceum": [0, 10, 140, 205, 247, 289], "12472": [0, 10, 140, 205, 247, 289], "eikenella": [0, 10, 140, 205, 247, 289], "corroden": [0, 10, 140, 205, 247, 289], "23834": [0, 10, 140, 205, 247, 289], "zymomona": [0, 10, 140, 205, 247, 289], "mobili": [0, 10, 140, 205, 247, 289], "zm4": [0, 10, 140, 205, 247, 289], "31821": [0, 10, 140, 205, 247, 289], "citrobact": [0, 10, 140, 205, 247, 289], "koseri": [0, 10, 140, 205, 247, 289], "895": [0, 10, 140, 205, 247, 289], "freundii": [0, 10, 140, 205, 247, 289], "mgh": [0, 10, 140, 205, 247, 289], "56": [0, 10, 140, 205, 247, 289], "klebsiella": [0, 10, 140, 205, 247, 289], "aerogen": [0, 10, 140, 205, 247, 289], "kctc": [0, 10, 140, 205, 247, 289], "2190": [0, 10, 140, 169, 205, 247, 289], "pantoea": [0, 10, 140, 205, 247, 289], "agglomeran": [0, 10, 140, 205, 247, 289], "enterobact": [0, 10, 140, 205, 247, 289], "cloaca": [0, 10, 140, 205, 247, 289], "13047": [0, 10, 140, 205, 247, 289], "erwinia": [0, 10, 140, 205, 247, 289], "amylovora": [0, 10, 140, 205, 247, 289], "cfbp1430": [0, 10, 140, 205, 247, 289], "ananati": [0, 10, 140, 205, 247, 289], "20103": [0, 10, 140, 205, 247, 289], "pectobacterium": [0, 10, 140, 205, 247, 289], "carotovorum": [0, 10, 140, 205, 247, 289], "pc1": [0, 10, 140, 205, 247, 289, 323], "dickeya": [0, 10, 140, 205, 247, 289], "chrysanthemi": [0, 10, 140, 205, 247, 289], "ech1591": [0, 10, 140, 205, 247, 289], "shimwellia": [0, 10, 140, 205, 247, 289], "blatta": [0, 10, 140, 205, 247, 289], "4481": [0, 10, 140, 205, 247, 289], "105725": [0, 10, 140, 205, 247, 289], "fergusonii": [0, 10, 140, 205, 247, 289], "b253": [0, 10, 140, 205, 247, 289], "atlantibact": [0, 10, 140, 205, 247, 289], "hermannii": [0, 10, 140, 205, 247, 289], "105704": [0, 10, 140, 205, 247, 289], "pseudescherichia": [0, 10, 140, 205, 247, 289], "vulneri": [0, 10, 140, 205, 247, 289], "102420": [0, 10, 140, 205, 247, 289], "hafnia": [0, 10, 140, 205, 247, 289], "alvei": [0, 10, 140, 205, 247, 289], "fb1": [0, 10, 140, 205, 247, 289], "oxytoca": [0, 10, 140, 205, 247, 289], "morganella": [0, 10, 140, 205, 247, 289], "morganii": [0, 10, 140, 205, 247, 289], "proteu": [0, 10, 140, 205, 247, 289], "mirabili": [0, 10, 140, 205, 247, 289], "hi4320": [0, 10, 140, 205, 247, 289], "providencia": [0, 10, 140, 205, 247, 289], "rettgeri": [0, 10, 140, 205, 247, 289], "1131": [0, 10, 140, 205, 247, 289], "stuartii": [0, 10, 140, 205, 247, 289], "25827": [0, 10, 140, 205, 247, 289], "serratia": [0, 10, 140, 205, 247, 289], "liquefacien": [0, 10, 140, 205, 247, 289], "27592": [0, 10, 140, 205, 247, 289], "marcescen": [0, 10, 140, 205, 247, 289], "db11": [0, 10, 140, 205, 247, 289], "odorifera": [0, 10, 140, 205, 247, 289], "4582": [0, 10, 140, 205, 247, 289], "shigella": [0, 10, 140, 205, 247, 289], "boydii": [0, 10, 140, 205, 247, 289], "cdc": [0, 10, 140, 205, 247, 289], "3083": [0, 10, 140, 205, 247, 289], "dysenteria": [0, 10, 140, 205, 247, 289], "1617": [0, 10, 140, 205, 247, 289], "flexneri": [0, 10, 140, 205, 247, 289], "2a": [0, 10, 140, 205, 247, 289], "301": [0, 10, 140, 205, 247, 289], "sonnei": [0, 10, 140, 205, 247, 289], "ss046": [0, 10, 140, 205, 247, 289], "xenorhabdu": [0, 10, 140, 205, 247, 289], "nematophila": [0, 10, 140, 205, 247, 289], "19061": [0, 10, 140, 205, 247, 289], "enterocolitica": [0, 10, 140, 205, 247, 289], "lc20": [0, 10, 140, 205, 247, 289], "intermedia": [0, 10, 140, 205, 247, 289], "29909": [0, 10, 140, 205, 247, 289], "co92": [0, 10, 140, 205, 247, 289], "pseudotuberculosi": [0, 10, 140, 205, 247, 289], "edwardsiella": [0, 10, 140, 205, 247, 289], "tarda": [0, 10, 140, 205, 247, 289], "15947": [0, 10, 140, 205, 247, 289], "105688": [0, 10, 140, 205, 247, 289], "aeromona": [0, 10, 140, 205, 247, 289], "hydrophila": [0, 10, 140, 205, 247, 289], "7966": [0, 10, 140, 205, 247, 289], "salmonicida": [0, 10, 140, 205, 247, 289], "a449": [0, 10, 140, 205, 247, 289], "media": [0, 10, 140, 205, 247, 289], "w": [0, 9, 10, 140, 205, 247, 289], "veronii": [0, 10, 140, 205, 247, 289], "b565": [0, 10, 140, 205, 247, 289], "photobacterium": [0, 10, 140, 205, 247, 289], "phosphoreum": [0, 10, 140, 205, 247, 289], "ant": [0, 10, 140, 205, 247, 289], "2200": [0, 10, 140, 165, 166, 168, 205, 247, 289], "s14": [0, 10, 140, 205, 247, 289], "alginolyticu": [0, 10, 140, 205, 247, 289], "15630": [0, 10, 140, 205, 247, 289], "17749": [0, 10, 140, 205, 247, 289], "o395": [0, 10, 140, 205, 247, 289], "aliivibrio": [0, 10, 140, 205, 247, 289], "fischeri": [0, 10, 140, 205, 247, 289], "es114": [0, 10, 140, 205, 247, 289], "parahaemolyticu": [0, 10, 140, 205, 247, 289], "rimd": [0, 10, 140, 205, 247, 289], "2210633": [0, 10, 140, 205, 247, 289], "proteolyticu": [0, 10, 140, 205, 247, 289], "13287": [0, 10, 140, 205, 247, 289], "vulnificu": [0, 10, 140, 205, 247, 289], "grimontia": [0, 10, 140, 205, 247, 289], "hollisa": [0, 10, 140, 205, 247, 289], "cip": [0, 10, 140, 205, 247, 289], "101886": [0, 10, 140, 205, 247, 289], "mimicu": [0, 10, 140, 205, 247, 289], "mb451": [0, 10, 140, 205, 247, 289], "campbellii": [0, 10, 140, 205, 247, 289], "1116": [0, 10, 140, 205, 247, 289], "diazotrophicu": [0, 10, 140, 205, 247, 289], "103148": [0, 10, 140, 205, 247, 289], "plesiomona": [0, 10, 140, 205, 247, 289], "shigelloid": [0, 10, 140, 205, 247, 289], "73": [0, 10, 140, 205, 247, 289], "aggregatibact": [0, 10, 140, 205, 247, 289], "actinomycetemcomitan": [0, 10, 140, 205, 247, 289], "hk1651": [0, 10, 140, 205, 247, 289], "actinobacillu": [0, 10, 140, 205, 247, 289], "pleuropneumonia": [0, 10, 140, 205, 247, 289], "4074": [0, 10, 140, 205, 247, 289], "sui": [0, 10, 140, 205, 247, 289], "h91": [0, 10, 140, 205, 247, 289], "0380": [0, 10, 140, 205, 247, 289], "19761": [0, 10, 140, 205, 247, 289], "equuli": [0, 10, 140, 205, 247, 289], "urea": [0, 10, 140, 205, 247, 289], "25976": [0, 10, 140, 205, 247, 289], "haemolyticu": [0, 10, 140, 205, 247, 289], "m21639": [0, 10, 140, 205, 247, 289], "rd": [0, 10, 140, 205, 247, 289], "kw20": [0, 10, 140, 205, 247, 289], "avibacterium": [0, 10, 140, 205, 247, 289], "paragallinarum": [0, 10, 140, 205, 247, 289], "221": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "parainfluenza": [0, 10, 140, 205, 247, 289], "t3t1": [0, 10, 140, 205, 247, 289], "histophilu": [0, 10, 140, 205, 247, 289], "somni": [0, 10, 140, 205, 247, 289], "129pt": [0, 10, 140, 205, 247, 289], "aphrophilu": [0, 10, 140, 205, 247, 289], "nj8700": [0, 10, 140, 205, 247, 289], "paraphrohaemolyticu": [0, 10, 140, 205, 247, 289], "hk411": [0, 10, 140, 205, 247, 289], "glaesserella": [0, 10, 140, 205, 247, 289], "parasui": [0, 10, 140, 205, 247, 289], "zj0906": [0, 10, 140, 205, 247, 289], "segni": [0, 10, 140, 205, 247, 289], "33393": [0, 10, 140, 205, 247, 289], "pasteurella": [0, 10, 140, 205, 247, 289], "multocida": [0, 10, 140, 205, 247, 289], "gallibacterium": [0, 10, 140, 205, 247, 289], "anati": [0, 10, 140, 205, 247, 289], "umn179": [0, 10, 140, 205, 247, 289], "bettya": [0, 10, 140, 205, 247, 289], "2042": [0, 10, 140, 205, 247, 289], "dagmati": [0, 10, 140, 205, 247, 289], "43325": [0, 10, 140, 205, 247, 289], "rodentibact": [0, 10, 140, 205, 247, 289], "pneumotropicu": [0, 10, 140, 205, 247, 289], "anaplasma": [0, 10, 140, 205, 247, 289], "israel": [0, 10, 140, 205, 247, 289], "marginal": [0, 10, 140, 205, 247, 289], "st": [0, 10, 140, 205, 247, 289], "bartonella": [0, 10, 140, 205, 247, 289], "bacilliformi": [0, 10, 140, 205, 247, 289], "kc583": [0, 10, 140, 205, 247, 289], "rsa": [0, 10, 140, 205, 247, 289], "493": [0, 10, 140, 205, 247, 289], "ehrlichia": [0, 10, 140, 205, 247, 289], "ruminantium": [0, 10, 140, 205, 247, 289], "welgevonden": [0, 10, 140, 205, 247, 289], "rickettsia": [0, 10, 140, 205, 247, 289], "conorii": [0, 10, 140, 205, 247, 289], "malish": [0, 10, 140, 205, 247, 289], "prowazekii": [0, 10, 140, 205, 247, 289], "madrid": [0, 10, 140, 205, 247, 289], "rickettsii": [0, 10, 140, 205, 247, 289], "iowa": [0, 10, 140, 205, 247, 289], "orientia": [0, 10, 140, 205, 247, 289], "tsutsugamushi": [0, 10, 140, 205, 247, 289], "boryong": [0, 10, 140, 205, 247, 289], "typhi": [0, 10, 140, 205, 247, 289], "wilmington": [0, 10, 140, 205, 247, 289], "akari": [0, 10, 140, 205, 247, 289], "hartford": [0, 10, 140, 205, 247, 289], "cutlack": [0, 10, 140, 205, 247, 289], "mckiel": [0, 10, 140, 205, 247, 289], "quintana": [0, 10, 140, 205, 247, 289], "toulous": [0, 10, 140, 205, 247, 289], "elizabetha": [0, 10, 140, 205, 247, 289], "f9251": [0, 10, 140, 205, 247, 289], "49927": [0, 10, 140, 205, 247, 289], "uw": [0, 10, 140, 205, 247, 289], "cx": [0, 10, 140, 205, 247, 289], "fragili": [0, 10, 140, 205, 247, 289], "3_1_12": [0, 10, 140, 205, 247, 289], "vpi": [0, 10, 140, 205, 247, 289], "5482": [0, 10, 140, 205, 247, 289], "uniformi": [0, 10, 140, 205, 247, 289], "8492": [0, 10, 140, 205, 247, 289], "vulgatu": [0, 10, 140, 205, 247, 289], "8482": [0, 10, 140, 205, 247, 289], "parabacteroid": [0, 10, 140, 205, 247, 289], "distasoni": [0, 10, 140, 205, 247, 289], "8503": [0, 10, 140, 205, 247, 289], "gracili": [0, 10, 140, 205, 247, 289], "rm3268": [0, 10, 140, 205, 247, 289], "sebaldella": [0, 10, 140, 205, 247, 289], "termitidi": [0, 10, 140, 205, 247, 289], "33386": [0, 10, 140, 205, 247, 289], "ureolyticu": [0, 10, 140, 205, 247, 289], "butyrivibrio": [0, 10, 140, 205, 247, 289], "fibrisolven": [0, 10, 140, 205, 247, 289], "nd3005": [0, 10, 140, 205, 247, 289], "fibrobact": [0, 10, 140, 205, 247, 289], "succinogen": [0, 10, 140, 205, 247, 289], "s85": [0, 10, 140, 205, 247, 289], "porphyromona": [0, 10, 140, 205, 247, 289], "gingivali": [0, 10, 140, 205, 247, 289], "33277": [0, 10, 140, 205, 247, 289], "prevotella": [0, 10, 140, 205, 247, 289], "ruminicola": [0, 10, 140, 205, 247, 289], "loescheii": [0, 10, 140, 205, 247, 289], "19665": [0, 10, 140, 205, 247, 289], "12249": [0, 10, 140, 205, 247, 289], "15930": [0, 10, 140, 205, 247, 289], "wolinella": [0, 10, 140, 205, 247, 289], "1740": [0, 10, 140, 205, 247, 289], "oxalobact": [0, 10, 140, 205, 247, 289], "formigen": [0, 10, 140, 205, 247, 289], "hoxbl": [0, 10, 140, 205, 247, 289], "gonidiaforman": [0, 10, 140, 205, 247, 289], "25563": [0, 10, 140, 205, 247, 289], "mortiferum": [0, 10, 140, 205, 247, 289], "9817": [0, 10, 140, 205, 247, 289], "25586": [0, 10, 140, 205, 247, 289], "perfoeten": [0, 10, 140, 205, 247, 289], "29250": [0, 10, 140, 205, 247, 289], "faecalibacterium": [0, 10, 140, 205, 247, 289], "prausnitzii": [0, 10, 140, 205, 247, 289], "a2": [0, 10, 140, 205, 247, 289], "165": [0, 10, 140, 205, 247, 289], "russii": [0, 10, 140, 205, 247, 289], "25533": [0, 10, 140, 205, 247, 289], "varium": [0, 10, 140, 205, 247, 289], "27725": [0, 10, 140, 205, 247, 289], "necrophorum": [0, 10, 140, 205, 247, 289], "funduliform": [0, 10, 140, 205, 247, 289], "51357": [0, 10, 140, 205, 247, 289], "periodonticum": [0, 10, 140, 205, 247, 289], "33693": [0, 10, 140, 205, 247, 289], "ulceran": [0, 10, 140, 205, 247, 289], "49185": [0, 10, 140, 205, 247, 289], "syntrophomona": [0, 10, 140, 205, 247, 289], "wolfei": [0, 10, 140, 205, 247, 289], "goettingen": [0, 10, 140, 205, 247, 289], "g311": [0, 10, 140, 205, 247, 289], "dichelobact": [0, 10, 140, 205, 247, 289], "nodosu": [0, 10, 140, 205, 247, 289], "vcs1703a": [0, 10, 140, 205, 247, 289], "desulfocurvibact": [0, 10, 140, 205, 247, 289], "africanu": [0, 10, 140, 205, 247, 289], "walvi": [0, 10, 140, 205, 247, 289], "bai": [0, 10, 140, 205, 247, 289], "desulfovibrio": [0, 10, 140, 205, 247, 289], "desulfurican": [0, 10, 140, 205, 247, 289], "nd132": [0, 10, 140, 205, 247, 289], "fructosivoran": [0, 10, 140, 205, 247, 289], "jj": [0, 10, 140, 205, 247, 289], "giga": [0, 10, 140, 205, 247, 289], "1382": [0, 10, 140, 205, 247, 289], "19364": [0, 10, 140, 205, 247, 289], "salexigen": [0, 10, 140, 205, 247, 289], "2638": [0, 10, 140, 205, 247, 289], "hildenborough": [0, 10, 140, 205, 247, 289], "thermodesulfobacterium": [0, 10, 140, 205, 247, 289], "1276": [0, 10, 140, 205, 247, 289], "longu": [0, 10, 140, 205, 247, 289], "6739": [0, 10, 140, 205, 247, 289], "desulfobulbu": [0, 10, 140, 205, 247, 289], "propionicu": [0, 10, 140, 205, 247, 289], "2032": [0, 10, 140, 205, 247, 289], "desulfococcu": [0, 10, 140, 205, 247, 289], "multivoran": [0, 10, 140, 205, 247, 289], "2059": [0, 10, 140, 168, 205, 247, 289], "desulfomicrobium": [0, 10, 140, 205, 247, 289], "baculatum": [0, 10, 140, 205, 247, 289], "piger": [0, 10, 140, 205, 247, 289], "29098": [0, 10, 140, 205, 247, 289], "acidaminococcu": [0, 10, 140, 205, 247, 289], "fermentan": [0, 10, 140, 205, 247, 289], "20731": [0, 10, 140, 205, 247, 289], "megasphaera": [0, 10, 140, 205, 247, 289], "elsdenii": [0, 10, 140, 205, 247, 289], "20460": [0, 10, 140, 205, 247, 289], "nitrobact": [0, 10, 140, 205, 247, 289], "hamburgensi": [0, 10, 140, 205, 247, 289], "x14": [0, 10, 140, 205, 247, 289], "winogradskyi": [0, 10, 140, 205, 247, 289], "nb": [0, 10, 140, 205, 247, 289], "255": [0, 10, 140, 169, 205, 247, 289], "nitrosomona": [0, 10, 140, 205, 247, 289], "europaea": [0, 10, 140, 205, 247, 289], "19718": [0, 10, 140, 205, 247, 289], "eutropha": [0, 10, 140, 205, 247, 289], "c91": [0, 10, 140, 205, 247, 289], "acidithiobacillu": [0, 10, 140, 205, 247, 289], "23270": [0, 10, 140, 205, 247, 289], "starkeya": [0, 10, 140, 205, 247, 289], "novella": [0, 10, 140, 205, 247, 289], "506": [0, 10, 140, 205, 247, 289], "thiomona": [0, 10, 140, 205, 247, 289], "k12": [0, 10, 140, 205, 247, 289], "halothiobacillu": [0, 10, 140, 205, 247, 289], "neapolitanu": [0, 10, 140, 205, 247, 289], "thermithiobacillu": [0, 10, 140, 205, 247, 289], "tepidariu": [0, 10, 140, 205, 247, 289], "3134": [0, 10, 140, 205, 247, 289], "thiooxidan": [0, 10, 140, 205, 247, 289], "19377": [0, 10, 140, 205, 247, 289], "thiobacillu": [0, 10, 140, 205, 247, 289], "thioparu": [0, 10, 140, 205, 247, 289], "505": [0, 10, 140, 205, 247, 289], "thiomicrospira": [0, 10, 140, 205, 247, 289], "pelophila": [0, 10, 140, 205, 247, 289], "1534": [0, 10, 140, 205, 247, 289], "hydrogenobact": [0, 10, 140, 205, 247, 289], "tk": [0, 10, 140, 205, 247, 289], "jake": [0, 10, 140, 205, 247, 289], "chaffeensi": [0, 10, 140, 205, 247, 289], "arkansa": [0, 10, 140, 205, 247, 289], "phagocytophilum": [0, 10, 140, 205, 247, 289], "hz": [0, 10, 140, 205, 247, 289], "neorickettsia": [0, 10, 140, 205, 247, 289], "risticii": [0, 10, 140, 205, 247, 289], "illinoi": [0, 10, 140, 205, 247, 289], "sennetsu": [0, 10, 140, 205, 247, 289], "miyayama": [0, 10, 140, 205, 247, 289], "bdellovibrio": [0, 10, 140, 205, 247, 289], "bacteriovoru": [0, 10, 140, 205, 247, 289], "hd100": [0, 10, 140, 205, 247, 289], "herbaspirillum": [0, 10, 140, 205, 247, 289], "seropedica": [0, 10, 140, 205, 247, 289], "smr1": [0, 10, 140, 205, 247, 289], "selenomona": [0, 10, 140, 205, 247, 289], "ab3002": [0, 10, 140, 205, 247, 289], "cellulophaga": [0, 10, 140, 205, 247, 289], "lytica": [0, 10, 140, 205, 247, 289], "7489": [0, 10, 140, 205, 247, 289], "saccharicrini": [0, 10, 140, 205, 247, 289], "9555": [0, 10, 140, 205, 247, 289], "21142": [0, 10, 140, 205, 247, 289], "pedobact": [0, 10, 140, 205, 247, 289], "heparinu": [0, 10, 140, 205, 247, 289], "2366": [0, 10, 140, 205, 247, 289], "cytophaga": [0, 10, 140, 205, 247, 289], "hutchinsonii": [0, 10, 140, 205, 247, 289], "33406": [0, 10, 140, 205, 247, 289], "johnsonia": [0, 10, 140, 205, 247, 289], "uw101": [0, 10, 140, 205, 247, 289], "marinilabilia": [0, 10, 140, 205, 247, 289], "salmonicolor": [0, 10, 140, 205, 247, 289], "21150": [0, 10, 140, 205, 247, 289], "hydati": [0, 10, 140, 205, 247, 289], "solitalea": [0, 10, 140, 205, 247, 289], "3403": [0, 10, 140, 205, 247, 289], "columnar": [0, 10, 140, 205, 247, 289], "49512": [0, 10, 140, 205, 247, 289], "bernardetia": [0, 10, 140, 205, 247, 289], "litorali": [0, 10, 140, 205, 247, 289], "6794": [0, 10, 140, 205, 247, 289], "marivirga": [0, 10, 140, 205, 247, 289], "tractuosa": [0, 10, 140, 205, 247, 289], "4126": [0, 10, 140, 205, 247, 289], "saprospira": [0, 10, 140, 205, 247, 289], "lewin": [0, 10, 140, 205, 247, 289], "weeksella": [0, 10, 140, 205, 247, 289], "virosa": [0, 10, 140, 205, 247, 289], "16922": [0, 10, 140, 205, 247, 289], "bergeyella": [0, 10, 140, 205, 247, 289], "zoohelcum": [0, 10, 140, 205, 247, 289], "43767": [0, 10, 140, 205, 247, 289], "capnocytophaga": [0, 10, 140, 205, 247, 289], "33624": [0, 10, 140, 205, 247, 289], "ochracea": [0, 10, 140, 205, 247, 289], "f0287": [0, 10, 140, 205, 247, 289], "sputigena": [0, 10, 140, 205, 247, 289], "33612": [0, 10, 140, 205, 247, 289], "beggiatoa": [0, 10, 140, 205, 247, 289], "alba": [0, 10, 140, 205, 247, 289], "b18ld": [0, 10, 140, 205, 247, 289], "microscilla": [0, 10, 140, 205, 247, 289], "23134": [0, 10, 140, 205, 247, 289], "thiothrix": [0, 10, 140, 205, 247, 289], "nivea": [0, 10, 140, 205, 247, 289], "5205": [0, 10, 140, 205, 247, 289], "afipia": [0, 10, 140, 205, 247, 289], "clevelandensi": [0, 10, 140, 205, 247, 289], "49720": [0, 10, 140, 205, 247, 289], "53690": [0, 10, 140, 205, 247, 289], "erythrobact": [0, 10, 140, 205, 247, 289], "allochromatium": [0, 10, 140, 205, 247, 289], "vinosum": [0, 10, 140, 205, 247, 289], "halorhodospira": [0, 10, 140, 205, 247, 289], "halochlori": [0, 10, 140, 205, 247, 289], "halophila": [0, 10, 140, 205, 247, 289], "sl1": [0, 10, 140, 205, 247, 289], "rhodobact": [0, 10, 140, 205, 247, 289], "sb": [0, 10, 140, 205, 247, 289], "1003": [0, 10, 140, 205, 247, 289], "sphaeroid": [0, 10, 140, 205, 247, 289], "rhodomicrobium": [0, 10, 140, 205, 247, 289], "vannielii": [0, 10, 140, 205, 247, 289], "17100": [0, 10, 140, 205, 247, 289], "rhodopseudomona": [0, 10, 140, 205, 247, 289], "palustri": [0, 10, 140, 205, 247, 289], "cga009": [0, 10, 140, 205, 247, 289], "phaeospirillum": [0, 10, 140, 205, 247, 289], "fulvum": [0, 10, 140, 205, 247, 289], "mgu": [0, 10, 140, 205, 247, 289], "k5": [0, 10, 140, 205, 247, 289], "molischianum": [0, 10, 140, 205, 247, 289], "120": [0, 10, 140, 205, 247, 289], "pararhodospirillum": [0, 10, 140, 205, 247, 289], "photometricum": [0, 10, 140, 205, 247, 289], "122": [0, 10, 140, 165, 205, 247, 289], "rhodospirillum": [0, 10, 140, 205, 247, 289], "rubrum": [0, 10, 140, 205, 247, 289], "11170": [0, 10, 140, 205, 247, 289], "rhodovibrio": [0, 10, 140, 205, 247, 289], "9154": [0, 10, 140, 205, 247, 289], "chlorobium": [0, 10, 140, 205, 247, 289], "limicola": [0, 10, 140, 205, 247, 289], "245": [0, 10, 140, 205, 247, 289], "phaeovibrioid": [0, 10, 140, 205, 247, 289], "265": [0, 10, 140, 205, 247, 289], "phaeobacteroid": [0, 10, 140, 205, 247, 289], "266": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "chlorobaculum": [0, 10, 140, 205, 247, 289], "tepidum": [0, 10, 140, 205, 247, 289], "tl": [0, 10, 140, 205, 247, 289], "pelodictyon": [0, 10, 140, 205, 247, 289], "luteolum": [0, 10, 140, 205, 247, 289], "273": [0, 10, 140, 205, 247, 289], "prosthecochlori": [0, 10, 140, 205, 247, 289], "aestuarii": [0, 10, 140, 205, 247, 289], "271": [0, 10, 140, 205, 247, 289], "j": [0, 9, 10, 140, 205, 247, 289, 324, 325], "fl": [0, 10, 140, 205, 247, 289], "chlorogloeopsi": [0, 10, 140, 205, 247, 289], "fritschii": [0, 10, 140, 205, 247, 289], "pcc": [0, 10, 140, 205, 247, 289], "6912": [0, 10, 140, 205, 247, 289], "microcysti": [0, 10, 140, 205, 247, 289], "ni": [0, 10, 140, 205, 247, 289], "843": [0, 10, 140, 205, 247, 289], "6714": [0, 10, 140, 205, 247, 289], "6803": [0, 10, 140, 205, 247, 289], "substr": [0, 10, 140, 205, 247, 289], "kazusa": [0, 10, 140, 205, 247, 289], "planktothrix": [0, 10, 140, 205, 247, 289], "agardhii": [0, 10, 140, 205, 247, 289], "niva": [0, 10, 140, 205, 247, 289], "cya": [0, 10, 140, 205, 247, 289], "126": [0, 10, 140, 165, 166, 168, 205, 247, 289], "anabaena": [0, 10, 140, 205, 247, 289], "cylindrica": [0, 10, 140, 205, 247, 289], "7122": [0, 10, 140, 205, 247, 289], "leptolyngbya": [0, 10, 140, 205, 247, 289], "boryana": [0, 10, 140, 205, 247, 289], "6306": [0, 10, 140, 205, 247, 289], "tolypothrix": [0, 10, 140, 205, 247, 289], "7601": [0, 10, 140, 205, 247, 289], "trichodesmium": [0, 10, 140, 205, 247, 289], "erythraeum": [0, 10, 140, 205, 247, 289], "ims101": [0, 10, 140, 205, 247, 289], "prochlorococcu": [0, 10, 140, 205, 247, 289], "as9601": [0, 10, 140, 205, 247, 289], "prochlorothrix": [0, 10, 140, 205, 247, 289], "hollandica": [0, 10, 140, 205, 247, 289], "9006": [0, 10, 140, 205, 247, 289], "calu": [0, 10, 140, 205, 247, 289], "1027": [0, 10, 140, 205, 247, 289], "nitrosococcu": [0, 10, 140, 205, 247, 289], "oceani": [0, 10, 140, 205, 247, 289], "19707": [0, 10, 140, 205, 247, 289], "nitrosospira": [0, 10, 140, 205, 247, 289], "multiformi": [0, 10, 140, 205, 247, 289], "25196": [0, 10, 140, 205, 247, 289], "leuconostoc": [0, 10, 140, 205, 247, 289], "gelidum": [0, 10, 140, 205, 247, 289], "gasicomitatum": [0, 10, 140, 205, 247, 289], "18811": [0, 10, 140, 205, 247, 289], "mesenteroid": [0, 10, 140, 205, 247, 289], "8293": [0, 10, 140, 205, 247, 289], "lacti": [0, 10, 140, 205, 247, 289], "oenococcu": [0, 10, 140, 205, 247, 289], "oeni": [0, 10, 140, 205, 247, 289], "psu": [0, 10, 140, 205, 247, 289], "weissella": [0, 10, 140, 205, 247, 289], "paramesenteroid": [0, 10, 140, 205, 247, 289], "33313": [0, 10, 140, 205, 247, 289], "fallax": [0, 10, 140, 205, 247, 289], "3537": [0, 10, 140, 205, 247, 289], "carnosum": [0, 10, 140, 205, 247, 289], "jb16": [0, 10, 140, 205, 247, 289], "pediococcu": [0, 10, 140, 205, 247, 289], "acidilactici": [0, 10, 140, 205, 247, 289], "20284": [0, 10, 140, 205, 247, 289], "pentosaceu": [0, 10, 140, 205, 247, 289], "25745": [0, 10, 140, 205, 247, 289], "finegoldia": [0, 10, 140, 205, 247, 289], "magna": [0, 10, 140, 205, 247, 289], "53516": [0, 10, 140, 205, 247, 289], "peptostreptococcu": [0, 10, 140, 205, 247, 289], "anaerobiu": [0, 10, 140, 205, 247, 289], "4330": [0, 10, 140, 205, 247, 289], "2949": [0, 10, 140, 205, 247, 289], "ruminococcu": [0, 10, 140, 205, 247, 289], "flavefacien": [0, 10, 140, 205, 247, 289], "fd": [0, 10, 140, 205, 247, 289], "micrococcu": [0, 10, 140, 205, 247, 289], "luteu": [0, 10, 140, 205, 247, 289], "2665": [0, 10, 140, 205, 247, 289], "dermacoccu": [0, 10, 140, 205, 247, 289], "nishinomiyaensi": [0, 10, 140, 205, 247, 289], "kytococcu": [0, 10, 140, 205, 247, 289], "sedentariu": [0, 10, 140, 205, 247, 289], "20547": [0, 10, 140, 205, 247, 289], "mu50": [0, 10, 140, 205, 247, 289], "carnosu": [0, 10, 140, 205, 247, 289], "tm300": [0, 10, 140, 205, 247, 289], "epidermidi": [0, 10, 140, 205, 247, 289], "rp62a": [0, 10, 140, 205, 247, 289], "jcsc1435": [0, 10, 140, 205, 247, 289], "hyicu": [0, 10, 140, 205, 247, 289], "intermediu": [0, 10, 140, 205, 247, 289], "11048": [0, 10, 140, 205, 247, 289], "simulan": [0, 10, 140, 205, 247, 289], "umc": [0, 10, 140, 205, 247, 289], "990": [0, 10, 140, 205, 247, 289], "xylosu": [0, 10, 140, 205, 247, 289], "homini": [0, 10, 140, 205, 247, 289], "sk119": [0, 10, 140, 205, 247, 289], "warneri": [0, 10, 140, 205, 247, 289], "l37603": [0, 10, 140, 205, 247, 289], "sciuri": [0, 10, 140, 205, 247, 289], "z8": [0, 10, 140, 205, 247, 289], "gordonii": [0, 10, 140, 205, 247, 289], "challi": [0, 10, 140, 205, 247, 289], "ch1": [0, 10, 140, 205, 247, 289], "tigurinu": [0, 10, 140, 205, 247, 289], "az_3a": [0, 10, 140, 205, 247, 289], "salivariu": [0, 10, 140, 205, 247, 289], "sanguini": [0, 10, 140, 205, 247, 289], "sk1057": [0, 10, 140, 205, 247, 289], "r61": [0, 10, 140, 205, 247, 289], "18311": [0, 10, 140, 205, 247, 289], "mutan": [0, 10, 140, 205, 247, 289], "ua159": [0, 10, 140, 205, 247, 289], "sobrinu": [0, 10, 140, 205, 247, 289], "w1703": [0, 10, 140, 205, 247, 289], "agalactia": [0, 10, 140, 205, 247, 289], "14747": [0, 10, 140, 205, 247, 289], "r6": [0, 10, 140, 205, 247, 289], "pyogen": [0, 10, 140, 205, 247, 289], "downei": [0, 10, 140, 205, 247, 289], "f0415": [0, 10, 140, 205, 247, 289], "parasanguini": [0, 10, 140, 205, 247, 289], "903": [0, 10, 140, 205, 247, 289], "blautia": [0, 10, 140, 205, 247, 289], "20583": [0, 10, 140, 205, 247, 289], "faecalicoccu": [0, 10, 140, 205, 247, 289], "pleomorphu": [0, 10, 140, 205, 247, 289], "20574": [0, 10, 140, 205, 247, 289], "anginosu": [0, 10, 140, 205, 247, 289], "dora_7": [0, 10, 140, 205, 247, 289], "fsl": [0, 10, 140, 205, 247, 289], "z3": [0, 10, 140, 205, 247, 289], "227": [0, 10, 140, 205, 247, 289], "criceti": [0, 10, 140, 205, 247, 289], "dysgalactia": [0, 10, 140, 205, 247, 289], "equisimili": [0, 10, 140, 205, 247, 289], "2713": [0, 10, 140, 205, 247, 289], "equinu": [0, 10, 140, 205, 247, 289], "9812": [0, 10, 140, 205, 247, 289], "equi": [0, 10, 140, 205, 247, 289], "zooepidemicu": [0, 10, 140, 205, 247, 289], "b196": [0, 10, 140, 205, 247, 289], "11558": [0, 10, 140, 205, 247, 289], "porcinu": [0, 10, 140, 205, 247, 289], "jelinkova": [0, 10, 140, 205, 247, 289], "176": [0, 10, 140, 205, 247, 289], "ratti": [0, 10, 140, 205, 247, 289], "20564": [0, 10, 140, 205, 247, 289], "vestibulari": [0, 10, 140, 205, 247, 289], "f0396": [0, 10, 140, 205, 247, 289], "feru": [0, 10, 140, 205, 247, 289], "20646": [0, 10, 140, 205, 247, 289], "inia": [0, 10, 140, 205, 247, 289], "parauberi": [0, 10, 140, 205, 247, 289], "ncfd": [0, 10, 140, 205, 247, 289], "2020": [0, 6, 10, 140, 169, 205, 247, 289], "uberi": [0, 10, 140, 205, 247, 289], "0140j": [0, 10, 140, 205, 247, 289], "enterococcu": [0, 10, 140, 205, 247, 289], "v583": [0, 10, 140, 205, 247, 289], "faecium": [0, 10, 140, 205, 247, 289], "c68": [0, 10, 140, 205, 247, 289], "gallinarum": [0, 10, 140, 205, 247, 289], "eg2": [0, 10, 140, 205, 247, 289], "hira": [0, 10, 140, 205, 247, 289], "9790": [0, 10, 140, 205, 247, 289], "columba": [0, 10, 140, 205, 247, 289], "7374": [0, 10, 140, 205, 247, 289], "51263": [0, 10, 140, 205, 247, 289], "sulfureu": [0, 10, 140, 205, 247, 289], "49903": [0, 10, 140, 205, 247, 289], "lactococcu": [0, 10, 140, 205, 247, 289], "cremori": [0, 10, 140, 205, 247, 289], "sk11": [0, 10, 140, 205, 247, 289], "garviea": [0, 10, 140, 205, 247, 289], "dcc43": [0, 10, 140, 205, 247, 289], "piscium": [0, 10, 140, 205, 247, 289], "mkfs47": [0, 10, 140, 205, 247, 289], "raffinolacti": [0, 10, 140, 205, 247, 289], "4877": [0, 10, 140, 205, 247, 289], "aerococcu": [0, 10, 140, 205, 247, 289], "urina": [0, 10, 140, 205, 247, 289], "col10a": [0, 10, 140, 205, 247, 289], "viridan": [0, 10, 140, 205, 247, 289], "11563": [0, 10, 140, 205, 247, 289], "4311": [0, 10, 140, 205, 247, 289], "gemella": [0, 10, 140, 205, 247, 289], "haemolysan": [0, 10, 140, 205, 247, 289], "m341": [0, 10, 140, 205, 247, 289], "atopobium": [0, 10, 140, 205, 247, 289], "minutum": [0, 10, 140, 205, 247, 289], "10063974": [0, 10, 140, 205, 247, 289], "parvulum": [0, 10, 140, 205, 247, 289], "20469": [0, 10, 140, 205, 247, 289], "rima": [0, 10, 140, 205, 247, 289], "49626": [0, 10, 140, 205, 247, 289], "amyloliquefacien": [0, 10, 140, 205, 247, 289], "y2": [0, 10, 140, 205, 247, 289], "aneurinibacillu": [0, 10, 140, 205, 247, 289], "aneurinilyticu": [0, 10, 140, 205, 247, 289], "12856": [0, 10, 140, 205, 247, 289], "anthraci": [0, 10, 140, 205, 247, 289], "am": [0, 10, 140, 205, 247, 289], "brevibacillu": [0, 10, 140, 205, 247, 289], "x23": [0, 10, 140, 205, 247, 289], "coagulan": [0, 10, 140, 205, 247, 289], "36d1": [0, 10, 140, 205, 247, 289], "firmu": [0, 10, 140, 205, 247, 289], "ds1": [0, 10, 140, 205, 247, 289], "licheniformi": [0, 10, 140, 205, 247, 289], "14580": [0, 10, 140, 205, 247, 289], "megaterium": [0, 10, 140, 205, 247, 289], "qm": [0, 10, 140, 205, 247, 289], "b1551": [0, 10, 140, 205, 247, 289], "mycoid": [0, 10, 140, 205, 247, 289], "kbab4": [0, 10, 140, 205, 247, 289], "paenibacillu": [0, 10, 140, 205, 247, 289], "polymyxa": [0, 10, 140, 205, 247, 289], "sc2": [0, 10, 140, 205, 247, 289], "psychrosaccharolyticu": [0, 10, 140, 205, 247, 289], "23296": [0, 10, 140, 205, 247, 289], "pumilu": [0, 10, 140, 205, 247, 289], "safr": [0, 10, 140, 205, 247, 289], "032": [0, 10, 140, 205, 247, 289], "bacteria": [0, 10, 140, 205, 247, 289], "akibai": [0, 10, 140, 205, 247, 289], "9157": [0, 10, 140, 205, 247, 289], "cellulosilyticu": [0, 10, 140, 205, 247, 289], "2522": [0, 10, 140, 205, 247, 289], "lysinibacillu": [0, 10, 140, 205, 247, 289], "sphaericu": [0, 10, 140, 205, 247, 289], "ot4b": [0, 10, 140, 205, 247, 289], "168": [0, 10, 140, 205, 247, 289], "parageobacillu": [0, 10, 140, 205, 247, 289], "thermoglucosidasiu": [0, 10, 140, 205, 247, 289], "c56": [0, 10, 140, 205, 247, 289], "ys93": [0, 10, 140, 205, 247, 289], "thuringiensi": [0, 10, 140, 205, 247, 289], "kurstaki": [0, 10, 140, 205, 247, 289], "alcalophilu": [0, 10, 140, 205, 247, 289], "27647": [0, 10, 140, 205, 247, 289], "cgmcc": [0, 10, 140, 205, 247, 289], "3604": [0, 10, 140, 205, 247, 289], "amphibacillu": [0, 10, 140, 205, 247, 289], "xylanu": [0, 10, 140, 205, 247, 289], "15112": [0, 10, 140, 205, 247, 289], "alicyclobacillu": [0, 10, 140, 205, 247, 289], "acidoterrestri": [0, 10, 140, 205, 247, 289], "49025": [0, 10, 140, 205, 247, 289], "atrophaeu": [0, 10, 140, 205, 247, 289], "1942": [0, 10, 140, 205, 247, 289], "geobacillu": [0, 10, 140, 205, 247, 289], "kaustophilu": [0, 10, 140, 205, 247, 289], "hta426": [0, 10, 140, 205, 247, 289], "larva": [0, 10, 140, 205, 247, 289, 323], "25430": [0, 10, 140, 205, 247, 289], "laterosporu": [0, 10, 140, 205, 247, 289], "methanolicu": [0, 10, 140, 205, 247, 289], "pb1": [0, 10, 140, 205, 247, 289], "peribacillu": [0, 10, 140, 205, 247, 289], "simplex": [0, 10, 140, 205, 247, 289], "ba2h3": [0, 10, 140, 205, 247, 289], "smithii": [0, 10, 140, 205, 247, 289], "7_3_47faa": [0, 10, 140, 205, 247, 289], "virgibacillu": [0, 10, 140, 205, 247, 289], "halodenitrifican": [0, 10, 140, 205, 247, 289], "1806": [0, 10, 140, 205, 247, 289], "acetobutylicum": [0, 10, 140, 205, 247, 289], "824": [0, 10, 140, 205, 247, 289], "paraclostridium": [0, 10, 140, 205, 247, 289], "bifermentan": [0, 10, 140, 205, 247, 289], "wym": [0, 10, 140, 205, 247, 289], "kyoto": [0, 10, 30, 59, 66, 140, 205, 247, 289, 325], "butyricum": [0, 10, 140, 205, 247, 289], "e4": [0, 10, 140, 205, 247, 289], "bont": [0, 10, 140, 205, 247, 289], "bl5262": [0, 10, 140, 205, 247, 289], "cellulovoran": [0, 10, 140, 205, 247, 289], "743b": [0, 10, 140, 205, 247, 289], "clostridioid": [0, 10, 140, 205, 247, 289], "difficil": [0, 10, 140, 205, 247, 289], "ruminiclostridium": [0, 10, 140, 205, 247, 289], "josui": [0, 10, 140, 205, 247, 289], "17888": [0, 10, 140, 205, 247, 289], "pasteurianum": [0, 10, 140, 205, 247, 289], "bc1": [0, 10, 140, 205, 247, 289], "perfringen": [0, 10, 140, 205, 247, 289], "13124": [0, 10, 140, 205, 247, 289], "paeniclostridium": [0, 10, 140, 205, 247, 289], "sordellii": [0, 10, 140, 205, 247, 289], "9048": [0, 10, 140, 205, 247, 289], "29733": [0, 10, 140, 205, 247, 289], "sporogen": [0, 10, 140, 205, 247, 289], "pa": [0, 10, 140, 205, 247, 289], "3679": [0, 10, 140, 205, 247, 289], "thermoclostridium": [0, 10, 140, 205, 247, 289], "stercorarium": [0, 10, 140, 205, 247, 289], "8532": [0, 10, 140, 205, 247, 289], "acetoanaerobium": [0, 10, 140, 205, 247, 289], "sticklandii": [0, 10, 140, 205, 247, 289], "tetani": [0, 10, 140, 205, 247, 289], "12124569": [0, 10, 140, 205, 247, 289], "hungateiclostridium": [0, 10, 140, 205, 247, 289], "thermocellum": [0, 10, 140, 205, 247, 289], "27405": [0, 10, 140, 205, 247, 289], "thermoanaerobact": [0, 10, 140, 205, 247, 289], "thermohydrosulfuricu": [0, 10, 140, 205, 247, 289], "wc1": [0, 10, 140, 205, 247, 289], "thermoanaerobacterium": [0, 10, 140, 205, 247, 289], "thermosaccharolyticum": [0, 10, 140, 205, 247, 289], "tyrobutyricum": [0, 10, 140, 205, 247, 289], "25755": [0, 10, 140, 205, 247, 289], "11008": [0, 10, 140, 205, 247, 289], "beijerinckii": [0, 10, 140, 205, 247, 289], "8052": [0, 10, 140, 205, 247, 289], "cellulolyticum": [0, 10, 140, 205, 247, 289], "h10": [0, 10, 140, 205, 247, 289], "moorella": [0, 10, 140, 205, 247, 289], "thermoacetica": [0, 10, 140, 205, 247, 289], "39073": [0, 10, 140, 205, 247, 289], "cadaveri": [0, 10, 140, 205, 247, 289], "agr2141": [0, 10, 140, 205, 247, 289], "kluyveri": [0, 10, 140, 205, 247, 289], "555": [0, 10, 140, 205, 247, 289], "ljungdahlii": [0, 10, 140, 205, 247, 289], "13528": [0, 10, 140, 205, 247, 289], "mangenotii": [0, 10, 140, 205, 247, 289], "tr": [0, 10, 140, 205, 247, 289], "novyi": [0, 10, 140, 205, 247, 289], "9691": [0, 10, 140, 205, 247, 289], "erysipelatoclostridium": [0, 10, 140, 205, 247, 289], "ramosum": [0, 10, 140, 205, 247, 289], "1402": [0, 10, 140, 205, 247, 289], "scatologen": [0, 10, 140, 205, 247, 289], "tetanomorphum": [0, 10, 140, 205, 247, 289], "665": [0, 10, 140, 205, 247, 289], "gottschalkia": [0, 10, 140, 205, 247, 289], "acidurici": [0, 10, 140, 205, 247, 289], "9a": [0, 10, 140, 205, 247, 289], "peptoclostridium": [0, 10, 140, 205, 247, 289], "litoral": [0, 10, 140, 205, 247, 289], "5388": [0, 10, 140, 205, 247, 289], "baratii": [0, 10, 140, 205, 247, 289], "sullivan": [0, 10, 140, 205, 247, 289], "desulfosporosinu": [0, 10, 140, 205, 247, 289], "orienti": [0, 10, 140, 205, 247, 289], "765": [0, 10, 140, 205, 247, 289], "desulfotomaculum": [0, 10, 140, 205, 247, 289], "rumini": [0, 10, 140, 205, 247, 289], "2154": [0, 10, 140, 205, 247, 289], "nigrifican": [0, 10, 140, 205, 247, 289], "574": [0, 10, 140, 205, 247, 289], "halobacillu": [0, 10, 140, 205, 247, 289], "halophilu": [0, 10, 140, 205, 247, 289], "2266": [0, 10, 140, 205, 247, 289], "sporosarcina": [0, 10, 140, 205, 247, 289], "2281": [0, 10, 140, 205, 247, 289], "leifsonia": [0, 10, 140, 205, 247, 289], "xyli": [0, 10, 140, 205, 247, 289], "cynodonti": [0, 10, 140, 205, 247, 289], "46306": [0, 10, 140, 205, 247, 289], "lactobacillu": [0, 10, 140, 205, 247, 289], "acidophilu": [0, 10, 140, 205, 247, 289], "30sc": [0, 10, 140, 205, 247, 289], "367": [0, 10, 140, 205, 247, 289], "buchneri": [0, 10, 140, 205, 247, 289], "11577": [0, 10, 140, 205, 247, 289], "casei": [0, 10, 140, 205, 247, 289], "bl23": [0, 10, 140, 205, 247, 289], "confusa": [0, 10, 140, 205, 247, 289], "lbae": [0, 10, 140, 205, 247, 289], "c39": [0, 10, 140, 205, 247, 289], "delbrueckii": [0, 10, 140, 205, 247, 289], "bulgaricu": [0, 10, 140, 205, 247, 289], "2038": [0, 10, 140, 205, 247, 289], "helveticu": [0, 10, 140, 205, 247, 289], "cnrz32": [0, 10, 140, 205, 247, 289], "hilgardii": [0, 10, 140, 205, 247, 289], "20176": [0, 10, 140, 205, 247, 289], "8290": [0, 10, 140, 205, 247, 289], "pentosu": [0, 10, 140, 205, 247, 289], "kca1": [0, 10, 140, 205, 247, 289], "plantarum": [0, 10, 140, 205, 247, 289], "wcfs1": [0, 10, 140, 205, 247, 289], "gasseri": [0, 10, 140, 205, 247, 289], "33323": [0, 10, 140, 205, 247, 289], "paracasei": [0, 10, 140, 205, 247, 289], "25302": [0, 10, 140, 205, 247, 289], "reuteri": [0, 10, 140, 205, 247, 289], "sakei": [0, 10, 140, 205, 247, 289], "23k": [0, 10, 140, 205, 247, 289], "amylovoru": [0, 10, 140, 205, 247, 289], "grl": [0, 10, 140, 205, 247, 289], "1112": [0, 10, 140, 205, 247, 289], "animali": [0, 10, 140, 205, 247, 289], "coryniformi": [0, 10, 140, 205, 247, 289], "3167": [0, 10, 140, 205, 247, 289], "20001": [0, 10, 140, 205, 247, 289], "farcimini": [0, 10, 140, 205, 247, 289], "3681": [0, 10, 140, 205, 247, 289], "20184": [0, 10, 140, 205, 247, 289], "fermentum": [0, 10, 140, 205, 247, 289], "ifo": [0, 10, 140, 205, 247, 289], "3956": [0, 10, 140, 205, 247, 289], "fructivoran": [0, 10, 140, 205, 247, 289], "3543": [0, 10, 140, 205, 247, 289], "20203": [0, 10, 140, 205, 247, 289], "halotoleran": [0, 10, 140, 205, 247, 289], "20190": [0, 10, 140, 205, 247, 289], "asf361": [0, 10, 140, 205, 247, 289], "27782": [0, 10, 140, 205, 247, 289], "ucc118": [0, 10, 140, 205, 247, 289], "sanfranciscensi": [0, 10, 140, 205, 247, 289], "tmw": [0, 10, 140, 205, 247, 289], "1304": [0, 10, 140, 205, 247, 289], "kandleria": [0, 10, 140, 205, 247, 289], "vitulina": [0, 10, 140, 205, 247, 289], "mc3001": [0, 10, 140, 205, 247, 289], "fructobacillu": [0, 10, 140, 205, 247, 289], "fructosu": [0, 10, 140, 205, 247, 289], "3544": [0, 10, 140, 205, 247, 289], "ori": [0, 10, 140, 205, 247, 289], "f0423": [0, 10, 140, 205, 247, 289], "5837": [0, 10, 140, 205, 247, 289], "49540": [0, 10, 140, 205, 247, 289], "ivanovii": [0, 10, 140, 205, 247, 289], "londoniensi": [0, 10, 140, 205, 247, 289], "egd": [0, 10, 140, 205, 247, 289], "seeligeri": [0, 10, 140, 205, 247, 289], "2b": [0, 10, 140, 205, 247, 289], "slcc3954": [0, 10, 140, 205, 247, 289], "grayi": [0, 10, 140, 205, 247, 289], "20601": [0, 10, 140, 205, 247, 289], "innocua": [0, 10, 140, 205, 247, 289], "clip11262": [0, 10, 140, 205, 247, 289], "welshimeri": [0, 10, 140, 205, 247, 289], "6b": [0, 10, 140, 205, 247, 289], "slcc5334": [0, 10, 140, 205, 247, 289], "renibacterium": [0, 10, 140, 205, 247, 289], "salmoninarum": [0, 10, 140, 205, 247, 289], "33209": [0, 10, 140, 205, 247, 289], "erysipelothrix": [0, 10, 140, 205, 247, 289], "rhusiopathia": [0, 10, 140, 205, 247, 289], "fujisawa": [0, 10, 140, 205, 247, 289], "alloiococcu": [0, 10, 140, 205, 247, 289], "otiti": [0, 10, 140, 205, 247, 289], "51267": [0, 10, 140, 205, 247, 289], "actinomyc": [0, 10, 140, 205, 247, 289], "naeslundii": [0, 10, 140, 205, 247, 289], "howel": [0, 10, 140, 205, 247, 289], "279": [0, 10, 140, 205, 247, 289], "viscosu": [0, 10, 140, 205, 247, 289], "c505": [0, 10, 140, 205, 247, 289], "israelii": [0, 10, 140, 205, 247, 289], "43320": [0, 10, 140, 205, 247, 289], "schaalia": [0, 10, 140, 205, 247, 289], "odontolytica": [0, 10, 140, 205, 247, 289], "17982": [0, 10, 140, 205, 247, 289], "trueperella": [0, 10, 140, 205, 247, 289], "tp8": [0, 10, 140, 205, 247, 289], "arthrobact": [0, 10, 140, 205, 247, 289], "globiformi": [0, 10, 140, 205, 247, 289], "12137": [0, 10, 140, 205, 247, 289], "bifidobacterium": [0, 10, 140, 205, 247, 289], "adolescenti": [0, 10, 140, 205, 247, 289], "bifidum": [0, 10, 140, 205, 247, 289], "41171": [0, 10, 140, 205, 247, 289], "angulatum": [0, 10, 140, 205, 247, 289], "20098": [0, 10, 140, 205, 247, 289], "7096": [0, 10, 140, 205, 247, 289], "asteroid": [0, 10, 140, 205, 247, 289], "prl2011": [0, 10, 140, 205, 247, 289], "breve": [0, 10, 140, 205, 247, 289], "ucc2003": [0, 10, 140, 205, 247, 289], "catenulatum": [0, 10, 140, 205, 247, 289], "16992": [0, 10, 140, 205, 247, 289], "1194": [0, 10, 140, 205, 247, 289], "11043": [0, 10, 140, 205, 247, 289], "coryneform": [0, 10, 140, 205, 247, 289], "cuniculi": [0, 10, 140, 205, 247, 289], "dentium": [0, 10, 140, 205, 247, 289], "bd1": [0, 10, 140, 205, 247, 289], "indicum": [0, 10, 140, 205, 247, 289], "11587": [0, 10, 140, 205, 247, 289], "20214": [0, 10, 140, 205, 247, 289], "magnum": [0, 10, 140, 205, 247, 289], "pseudolongum": [0, 10, 140, 205, 247, 289], "globosum": [0, 10, 140, 205, 247, 289], "corynebacterium": [0, 10, 140, 205, 247, 289], "ammoniagen": [0, 10, 140, 205, 247, 289], "20306": [0, 10, 140, 205, 247, 289], "brevibacterium": [0, 10, 140, 205, 247, 289], "linen": [0, 10, 140, 205, 247, 289], "bl2": [0, 10, 140, 205, 247, 289], "fimi": [0, 10, 140, 205, 247, 289], "cellulosimicrobium": [0, 10, 140, 205, 247, 289], "cellulan": [0, 10, 140, 205, 247, 289], "j36": [0, 10, 140, 205, 247, 289], "flavigena": [0, 10, 140, 205, 247, 289], "20109": [0, 10, 140, 205, 247, 289], "oerskovia": [0, 10, 140, 205, 247, 289], "turbata": [0, 10, 140, 205, 247, 289], "diphtheria": [0, 10, 140, 205, 247, 289], "pw8": [0, 10, 140, 205, 247, 289], "glutamicum": [0, 10, 140, 205, 247, 289], "calluna": [0, 10, 140, 205, 247, 289], "20147": [0, 10, 140, 205, 247, 289], "variabil": [0, 10, 140, 205, 247, 289], "44702": [0, 10, 140, 205, 247, 289], "acidaminophilum": [0, 10, 140, 205, 247, 289], "3953": [0, 10, 140, 205, 247, 289], "holdemanella": [0, 10, 140, 205, 247, 289], "biformi": [0, 10, 140, 205, 247, 289], "3989": [0, 10, 140, 205, 247, 289], "eubacterium": [0, 10, 140, 205, 247, 289], "limosum": [0, 10, 140, 205, 247, 289], "kist612": [0, 10, 140, 205, 247, 289], "commun": [0, 5, 10, 140, 205, 247, 289, 325], "2178": [0, 10, 140, 205, 247, 289], "propionibacterium": [0, 10, 140, 205, 247, 289], "freudenreichii": [0, 10, 140, 205, 247, 289], "shermanii": [0, 10, 140, 205, 247, 289], "cirm": [0, 10, 140, 205, 247, 289], "bia1": [0, 10, 140, 205, 247, 289], "cutibacterium": [0, 10, 140, 205, 247, 289], "acn": [0, 10, 140, 205, 247, 289], "kpa171202": [0, 10, 140, 205, 247, 289], "acidipropionibacterium": [0, 10, 140, 205, 247, 289], "acidipropionici": [0, 10, 140, 205, 247, 289], "4875": [0, 10, 140, 205, 247, 289], "jensenii": [0, 10, 140, 205, 247, 289], "20535": [0, 10, 140, 205, 247, 289], "pseudopropionibacterium": [0, 10, 140, 205, 247, 289], "propionicum": [0, 10, 140, 205, 247, 289], "f0230a": [0, 10, 140, 205, 247, 289], "thoenii": [0, 10, 140, 205, 247, 289], "20276": [0, 10, 140, 205, 247, 289], "mycolicibacterium": [0, 10, 140, 205, 247, 289], "fortuitum": [0, 10, 140, 205, 247, 289], "46621": [0, 10, 140, 205, 247, 289], "6841": [0, 10, 140, 205, 247, 289], "intracellular": [0, 10, 140, 205, 247, 289], "13950": [0, 10, 140, 205, 247, 289], "kansasii": [0, 10, 140, 205, 247, 289], "732": [0, 10, 140, 205, 247, 289], "lepra": [0, 10, 140, 205, 247, 289], "tn": [0, 10, 140, 205, 247, 289], "phlei": [0, 10, 140, 205, 247, 289], "rivm601174": [0, 10, 140, 205, 247, 289], "smegmati": [0, 10, 140, 205, 247, 289], "mc2": [0, 10, 140, 205, 247, 289], "155": [0, 10, 140, 205, 247, 289], "h37rv": [0, 10, 140, 205, 247, 289], "mycobacteroid": [0, 10, 140, 205, 247, 289], "chelona": [0, 10, 140, 205, 247, 289], "asiaticum": [0, 10, 140, 205, 247, 289], "44297": [0, 10, 140, 205, 247, 289], "neoaurum": [0, 10, 140, 205, 247, 289], "vkm": [0, 10, 140, 205, 247, 289], "1815d": [0, 10, 140, 205, 247, 289], "thermoresistibil": [0, 10, 140, 205, 247, 289], "19527": [0, 10, 140, 205, 247, 289], "chubuens": [0, 10, 140, 205, 247, 289], "nbb4": [0, 10, 140, 205, 247, 289], "farcinogen": [0, 10, 140, 205, 247, 289], "gilvum": [0, 10, 140, 205, 247, 289], "pyr": [0, 10, 140, 205, 247, 289], "gck": [0, 10, 140, 205, 247, 289], "agy99": [0, 10, 140, 205, 247, 289], "vacca": [0, 10, 140, 205, 247, 289], "25954": [0, 10, 140, 205, 247, 289], "amycolatopsi": [0, 10, 140, 205, 247, 289], "methanolica": [0, 10, 140, 205, 247, 289], "239": [0, 10, 140, 205, 247, 289], "nocardia": [0, 10, 140, 205, 247, 289], "otitidiscaviarum": [0, 10, 140, 205, 247, 289], "14405": [0, 10, 140, 205, 247, 289], "15531": [0, 10, 140, 205, 247, 289], "rhodococcu": [0, 10, 140, 205, 247, 289], "fascian": [0, 10, 140, 205, 247, 289], "rhodochr": [0, 10, 140, 205, 247, 289], "21198": [0, 10, 140, 205, 247, 289], "chol": [0, 10, 140, 205, 247, 289], "erythropoli": [0, 10, 140, 205, 247, 289], "pr4": [0, 10, 140, 205, 247, 289], "saccharopolyspora": [0, 10, 140, 205, 247, 289], "erythraea": [0, 10, 140, 205, 247, 289], "nrrl": [0, 10, 140, 205, 247, 289], "2338": [0, 10, 140, 205, 247, 289], "actinopolyspora": [0, 10, 140, 205, 247, 289], "43834": [0, 10, 140, 205, 247, 289], "saccharomonospora": [0, 10, 140, 205, 247, 289], "viridi": [0, 10, 140, 205, 247, 289], "43017": [0, 10, 140, 205, 247, 289], "frankia": [0, 10, 140, 205, 247, 289], "alni": [0, 10, 140, 205, 247, 289], "acn14a": [0, 10, 140, 205, 247, 289], "geodermatophilu": [0, 10, 140, 205, 247, 289], "obscuru": [0, 10, 140, 205, 247, 289], "43160": [0, 10, 140, 205, 247, 289], "actinoplan": [0, 10, 140, 205, 247, 289], "missouriensi": [0, 10, 140, 205, 247, 289], "431": [0, 10, 140, 205, 247, 289], "utahensi": [0, 10, 140, 205, 247, 289], "kitasatospora": [0, 10, 140, 205, 247, 289], "aureofacien": [0, 10, 140, 205, 247, 289], "bikiniensi": [0, 10, 140, 205, 247, 289], "a3": [0, 10, 140, 205, 247, 289], "fradia": [0, 10, 140, 205, 247, 289], "glaucescen": [0, 10, 140, 205, 247, 289], "13350": [0, 10, 140, 205, 247, 289], "hygroscopicu": [0, 10, 140, 205, 247, 289], "jinggangensi": [0, 10, 140, 205, 247, 289], "5008": [0, 10, 140, 205, 247, 289], "lividan": [0, 10, 140, 205, 247, 289], "1326": [0, 10, 140, 205, 247, 289], "scabiei": [0, 10, 140, 205, 247, 289], "87": [0, 10, 140, 205, 247, 289, 324, 325], "viridochromogen": [0, 10, 140, 205, 247, 289], "40736": [0, 10, 140, 205, 247, 289], "halstedii": [0, 10, 140, 205, 247, 289], "purpureu": [0, 10, 140, 205, 247, 289], "ka281": [0, 10, 140, 205, 247, 289], "sclerotialu": [0, 10, 140, 205, 247, 289], "virginia": [0, 10, 140, 205, 247, 289], "cellulosa": [0, 10, 140, 205, 247, 289], "chartreusi": [0, 10, 140, 205, 247, 289], "12338": [0, 10, 140, 205, 247, 289], "actinomadura": [0, 10, 140, 205, 247, 289], "atramentaria": [0, 10, 140, 205, 247, 289], "43919": [0, 10, 140, 205, 247, 289], "madura": [0, 10, 140, 205, 247, 289], "liid": [0, 10, 140, 205, 247, 289], "aj290": [0, 10, 140, 205, 247, 289], "microtetraspora": [0, 10, 140, 205, 247, 289], "glauca": [0, 10, 140, 205, 247, 289], "streptosporangium": [0, 10, 140, 205, 247, 289], "43021": [0, 10, 140, 205, 247, 289], "amethystogen": [0, 10, 140, 205, 247, 289], "thermobispora": [0, 10, 140, 205, 247, 289], "bispora": [0, 10, 140, 205, 247, 289], "43833": [0, 10, 140, 205, 247, 289], "nocardiopsi": [0, 10, 140, 205, 247, 289], "dassonvillei": [0, 10, 140, 205, 247, 289], "43111": [0, 10, 140, 205, 247, 289], "prasina": [0, 10, 140, 205, 247, 289], "43845": [0, 10, 140, 205, 247, 289], "thermomonospora": [0, 10, 140, 205, 247, 289], "curvata": [0, 10, 140, 205, 247, 289], "43183": [0, 10, 140, 205, 247, 289], "thermobifida": [0, 10, 140, 205, 247, 289], "fusca": [0, 10, 140, 205, 247, 289], "yx": [0, 10, 140, 205, 247, 289], "microbacterium": [0, 10, 140, 205, 247, 289], "testaceum": [0, 10, 140, 205, 247, 289], "stlb037": [0, 10, 140, 205, 247, 289], "curtobacterium": [0, 10, 140, 205, 247, 289], "flaccumfacien": [0, 10, 140, 205, 247, 289], "ucd": [0, 10, 140, 205, 247, 289], "aku": [0, 10, 140, 205, 247, 289], "tropheryma": [0, 10, 140, 205, 247, 289], "whipplei": [0, 10, 140, 205, 247, 289], "twist": [0, 10, 140, 205, 247, 289], "pimelobact": [0, 10, 140, 205, 247, 289], "rothia": [0, 10, 140, 205, 247, 289], "dentocariosa": [0, 10, 140, 205, 247, 289], "17931": [0, 10, 140, 205, 247, 289], "mobiluncu": [0, 10, 140, 205, 247, 289], "curtisii": [0, 10, 140, 205, 247, 289], "43063": [0, 10, 140, 205, 247, 289], "mulieri": [0, 10, 140, 205, 247, 289], "gordonia": [0, 10, 140, 205, 247, 289], "bronchiali": [0, 10, 140, 205, 247, 289], "43247": [0, 10, 140, 205, 247, 289], "terra": [0, 10, 140, 205, 247, 289], "sphaerobact": [0, 10, 140, 205, 247, 289], "20745": [0, 10, 140, 205, 247, 289], "tsukamurella": [0, 10, 140, 205, 247, 289], "paurometabola": [0, 10, 140, 205, 247, 289], "20162": [0, 10, 140, 205, 247, 289], "seta": [0, 10, 140, 205, 247, 289], "km": [0, 10, 140, 205, 247, 289], "6054": [0, 10, 140, 205, 247, 289], "pseudonocardia": [0, 10, 140, 205, 247, 289], "autotrophica": [0, 10, 140, 205, 247, 289], "arginini": [0, 10, 140, 205, 247, 289], "7264": [0, 10, 140, 205, 247, 289], "capricolum": [0, 10, 140, 205, 247, 289], "27343": [0, 10, 140, 205, 247, 289], "gallisepticum": [0, 10, 140, 205, 247, 289], "g37": [0, 10, 140, 205, 247, 289], "hyopneumonia": [0, 10, 140, 205, 247, 289], "hyorhini": [0, 10, 140, 205, 247, 289], "sk76": [0, 10, 140, 205, 247, 289], "sc": [0, 10, 140, 205, 247, 289], "pg1": [0, 10, 140, 205, 247, 289], "leachii": [0, 10, 140, 205, 247, 289], "pg50": [0, 10, 140, 205, 247, 289], "pulmoni": [0, 10, 140, 205, 247, 289], "synovia": [0, 10, 140, 205, 247, 289], "53": [0, 10, 140, 205, 247, 289], "pg2": [0, 10, 140, 205, 247, 289], "arthritidi": [0, 10, 140, 205, 247, 289], "158l3": [0, 10, 140, 205, 247, 289], "bovigenitalium": [0, 10, 140, 205, 247, 289], "51080": [0, 10, 140, 205, 247, 289], "mycoplasmopsi": [0, 10, 140, 205, 247, 289], "californica": [0, 10, 140, 205, 247, 289], "pg18": [0, 10, 140, 205, 247, 289], "695": [0, 10, 140, 205, 247, 289], "mobil": [0, 10, 140, 205, 247, 289], "mput9231": [0, 10, 140, 205, 247, 289], "floccular": [0, 10, 140, 205, 247, 289], "27399": [0, 10, 140, 205, 247, 289], "ureaplasma": [0, 10, 140, 205, 247, 289], "urealyticum": [0, 10, 140, 205, 247, 289], "27819": [0, 10, 140, 205, 247, 289], "spiroplasma": [0, 10, 140, 205, 247, 289], "melliferum": [0, 10, 140, 205, 247, 289], "ipmb4a": [0, 10, 140, 205, 247, 289], "mirum": [0, 10, 140, 205, 247, 289], "29335": [0, 10, 140, 205, 247, 289], "taiwanens": [0, 10, 140, 205, 247, 289], "ct": [0, 10, 140, 172, 205, 217, 247, 258, 289, 302], "acholeplasma": [0, 10, 140, 205, 247, 289], "laidlawii": [0, 10, 140, 205, 247, 289], "pg": [0, 10, 140, 205, 247, 289], "8a": [0, 10, 140, 205, 247, 289], "modicum": [0, 10, 140, 205, 247, 289], "29102": [0, 10, 140, 205, 247, 289], "mesoplasma": [0, 10, 140, 205, 247, 289], "florum": [0, 10, 140, 205, 247, 289], "l1": [0, 10, 140, 166, 167, 169, 205, 247, 289, 323, 324, 325], "methanobrevibact": [0, 10, 140, 205, 247, 289], "35061": [0, 10, 140, 205, 247, 289], "methanohalophilu": [0, 10, 140, 205, 247, 289], "mahii": [0, 10, 140, 205, 247, 289], "5219": [0, 10, 140, 205, 247, 289], "methanothermu": [0, 10, 140, 205, 247, 289], "fervidu": [0, 10, 140, 205, 247, 289], "2088": [0, 10, 140, 205, 247, 289], "methanothermococcu": [0, 10, 140, 205, 247, 289], "thermolithotrophicu": [0, 10, 140, 205, 247, 289], "2095": [0, 10, 140, 205, 247, 289], "methanococcu": [0, 10, 140, 205, 247, 289], "volta": [0, 10, 140, 205, 247, 289], "methanotorri": [0, 10, 140, 205, 247, 289], "igneu": [0, 10, 140, 205, 247, 289], "kol": [0, 10, 140, 205, 247, 289], "2661": [0, 10, 140, 205, 247, 289], "methanoculleu": [0, 10, 140, 205, 247, 289], "marisnigri": [0, 10, 140, 205, 247, 289], "jr1": [0, 10, 140, 205, 247, 289], "methanofolli": [0, 10, 140, 205, 247, 289], "liminatan": [0, 10, 140, 205, 247, 289], "4140": [0, 10, 140, 205, 247, 289], "methanospirillum": [0, 10, 140, 205, 247, 289], "hungatei": [0, 10, 140, 205, 247, 289], "methanomicrobium": [0, 10, 140, 205, 247, 289], "bp": [0, 10, 140, 205, 247, 289], "barkeri": [0, 10, 140, 205, 247, 289], "fusaro": [0, 10, 140, 205, 247, 289], "mazei": [0, 10, 140, 205, 247, 289], "go1": [0, 10, 140, 205, 247, 289], "tm": [0, 10, 140, 205, 247, 289], "c2a": [0, 10, 140, 205, 247, 289], "vacuolata": [0, 10, 140, 205, 247, 289], "z": [0, 2, 6, 9, 10, 140, 205, 247, 289, 315, 316], "761": [0, 10, 140, 205, 247, 289], "methanothrix": [0, 10, 140, 205, 247, 289], "soehngenii": [0, 10, 140, 205, 247, 289], "gp6": [0, 10, 140, 205, 247, 289], "thermoacetophila": [0, 10, 140, 205, 247, 289], "pt": [0, 10, 140, 205, 247, 289], "methanococcoid": [0, 10, 140, 205, 247, 289], "methyluten": [0, 10, 140, 205, 247, 289], "mm1": [0, 10, 140, 205, 247, 289], "archaeoglobu": [0, 10, 140, 205, 247, 289], "fulgidu": [0, 10, 140, 205, 247, 289], "4304": [0, 10, 140, 205, 247, 289], "haloarcula": [0, 10, 140, 205, 247, 289], "marismortui": [0, 10, 140, 205, 247, 289], "43049": [0, 10, 140, 205, 247, 289], "nrc": [0, 10, 140, 205, 247, 289], "haloferax": [0, 10, 140, 205, 247, 289], "volcanii": [0, 10, 140, 205, 247, 289], "ds2": [0, 10, 140, 205, 247, 289], "halorubrum": [0, 10, 140, 205, 247, 289], "lacusprofundi": [0, 10, 140, 205, 247, 289], "49239": [0, 10, 140, 205, 247, 289], "saccharovorum": [0, 10, 140, 205, 247, 289], "1137": [0, 10, 140, 205, 247, 289], "halococcu": [0, 10, 140, 205, 247, 289], "morrhua": [0, 10, 140, 205, 247, 289], "1307": [0, 10, 140, 205, 247, 289], "mediterranei": [0, 10, 140, 205, 247, 289], "33500": [0, 10, 140, 205, 247, 289], "natronomona": [0, 10, 140, 205, 247, 289], "pharaoni": [0, 10, 140, 205, 247, 289], "2160": [0, 10, 140, 205, 247, 289], "pyrococcu": [0, 10, 140, 205, 247, 289], "furiosu": [0, 10, 140, 205, 247, 289], "3638": [0, 10, 140, 205, 247, 289], "5473": [0, 10, 140, 205, 247, 289], "thermofilum": [0, 10, 140, 205, 247, 289], "penden": [0, 10, 140, 205, 247, 289], "hrk": [0, 10, 140, 205, 247, 289], "thermoproteu": [0, 10, 140, 205, 247, 289], "tenax": [0, 10, 140, 205, 247, 289], "kra": [0, 10, 140, 205, 247, 289], "desulfurococcu": [0, 10, 140, 205, 247, 289], "mucosu": [0, 10, 140, 205, 247, 289], "2162": [0, 10, 140, 205, 247, 289], "islandicum": [0, 10, 140, 205, 247, 289], "4184": [0, 10, 140, 205, 247, 289], "staphylothermu": [0, 10, 140, 205, 247, 289], "f1": [0, 10, 140, 205, 247, 289], "acidocaldariu": [0, 10, 140, 205, 247, 289], "639": [0, 10, 140, 205, 247, 289], "saccharolobu": [0, 10, 140, 205, 247, 289], "p2": [0, 10, 140, 205, 247, 289], "desulfobact": [0, 10, 140, 205, 247, 289], "curvatu": [0, 10, 140, 205, 247, 289], "3379": [0, 10, 140, 205, 247, 289], "postgatei": [0, 10, 140, 205, 247, 289], "2ac9": [0, 10, 140, 205, 247, 289], "desulfobacterium": [0, 10, 140, 205, 247, 289], "autotrophicum": [0, 10, 140, 205, 247, 289], "hrm2": [0, 10, 140, 205, 247, 289], "thermoplasma": [0, 10, 140, 205, 247, 289], "acidophilum": [0, 10, 140, 205, 247, 289], "1728": [0, 10, 140, 205, 247, 289], "methanoplanu": [0, 10, 140, 205, 247, 289], "2279": [0, 10, 140, 165, 205, 247, 289], "methanosphaera": [0, 10, 140, 205, 247, 289], "stadtmana": [0, 10, 140, 205, 247, 289], "3091": [0, 10, 140, 205, 247, 289], "methanopyru": [0, 10, 140, 205, 247, 289], "kandleri": [0, 10, 140, 205, 247, 289], "av19": [0, 10, 140, 205, 247, 289], "methanohalobium": [0, 10, 140, 205, 247, 289], "evestigatum": [0, 10, 140, 205, 247, 289], "7303": [0, 10, 140, 205, 247, 289], "kivui": [0, 10, 140, 205, 247, 289], "halanaerobium": [0, 10, 140, 205, 247, 289], "praevalen": [0, 10, 140, 205, 247, 289], "2228": [0, 10, 140, 205, 247, 289], "msb8": [0, 10, 140, 205, 247, 289], "neapolitana": [0, 10, 140, 205, 247, 289], "4359": [0, 10, 140, 205, 247, 289], "solemya": [0, 10, 140, 205, 247, 289], "velum": [0, 10, 140, 205, 247, 289], "gill": [0, 10, 140, 205, 247, 289], "symbiont": [0, 10, 140, 205, 247, 289], "haliscomenobact": [0, 10, 140, 205, 247, 289], "hydrossi": [0, 10, 140, 205, 247, 289], "1100": [0, 10, 140, 205, 247, 289], "flexistip": [0, 10, 140, 205, 247, 289], "sinusarabici": [0, 10, 140, 205, 247, 289], "4947": [0, 10, 140, 205, 247, 289], "desulfomonil": [0, 10, 140, 205, 247, 289], "tiedjei": [0, 10, 140, 205, 247, 289], "6799": [0, 10, 140, 205, 247, 289], "xylella": [0, 10, 140, 205, 247, 289], "fastidiosa": [0, 10, 140, 205, 247, 289], "9a5c": [0, 10, 140, 205, 247, 289], "acetonema": [0, 10, 140, 205, 247, 289], "longum": [0, 10, 140, 205, 247, 289], "6540": [0, 10, 140, 205, 247, 289], "sporomusa": [0, 10, 140, 205, 247, 289], "ovata": [0, 10, 140, 205, 247, 289], "2662": [0, 10, 140, 205, 247, 289], "thermosipho": [0, 10, 140, 205, 247, 289], "tcf52b": [0, 10, 140, 205, 247, 289], "fervidobacterium": [0, 10, 140, 205, 247, 289], "nodosum": [0, 10, 140, 205, 247, 289], "rt17": [0, 10, 140, 205, 247, 289], "b1": [0, 10, 140, 205, 247, 289], "teredinibact": [0, 10, 140, 205, 247, 289], "turnera": [0, 10, 140, 205, 247, 289], "t7901": [0, 10, 140, 205, 247, 289], "roseobact": [0, 10, 140, 205, 247, 289], "och": [0, 10, 140, 205, 247, 289], "114": [0, 2, 10, 140, 205, 247, 289], "gardnerella": [0, 10, 140, 205, 247, 289], "6119v5": [0, 10, 140, 205, 247, 289], "cardiobacterium": [0, 10, 140, 205, 247, 289], "15826": [0, 10, 140, 205, 247, 289], "hirschia": [0, 10, 140, 205, 247, 289], "49814": [0, 10, 140, 205, 247, 289], "symbiobacterium": [0, 10, 140, 205, 247, 289], "iam": [0, 10, 140, 205, 247, 289], "14863": [0, 10, 140, 205, 247, 289], "verrucomicrobium": [0, 10, 140, 205, 247, 289], "spinosum": [0, 10, 140, 205, 247, 289], "4136": [0, 10, 140, 205, 247, 289], "18804": [0, 10, 140, 205, 247, 289], "marinobact": [0, 10, 140, 205, 247, 289], "hydrocarbonoclasticu": [0, 10, 140, 205, 247, 289], "vt8": [0, 10, 140, 205, 247, 289], "halomona": [0, 10, 140, 205, 247, 289], "2581": [0, 10, 140, 205, 247, 289], "carnobacterium": [0, 10, 140, 205, 247, 289], "divergen": [0, 10, 140, 205, 247, 289], "20623": [0, 10, 140, 205, 247, 289], "4847": [0, 10, 140, 205, 247, 289], "4848": [0, 10, 140, 205, 247, 289], "maltaromaticum": [0, 10, 140, 205, 247, 289], "lma28": [0, 10, 140, 205, 247, 289], "funditum": [0, 10, 140, 205, 247, 289], "5970": [0, 10, 140, 205, 247, 289], "synergist": [0, 10, 140, 205, 247, 289], "jonesii": [0, 10, 140, 205, 247, 289], "chondru": [0, 10, 140, 205, 247, 289], "crispu": [0, 10, 140, 205, 247, 289], "phaeodactylum": [0, 10, 140, 205, 247, 289], "tricornutum": [0, 10, 140, 205, 247, 289], "ectocarpu": [0, 10, 140, 205, 247, 289], "siliculosu": [0, 10, 140, 205, 247, 289], "cryptomona": [0, 10, 140, 205, 247, 289], "emiliania": [0, 10, 140, 205, 247, 289], "huxleyi": [0, 10, 140, 205, 247, 289], "symbiodinium": [0, 10, 140, 205, 247, 289], "microadriaticum": [0, 10, 140, 205, 247, 289], "volvox": [0, 10, 140, 205, 247, 289], "carteri": [0, 10, 140, 205, 247, 289], "auxenochlorella": [0, 10, 140, 205, 247, 289], "protothecoid": [0, 10, 140, 205, 247, 289], "physcomitrium": [0, 10, 140, 205, 247, 289], "cannabi": [0, 10, 140, 205, 247, 289], "actinidia": [0, 10, 140, 205, 247, 289], "chinensi": [0, 10, 140, 205, 247, 289], "var": [0, 10, 140, 205, 247, 289], "carica": [0, 10, 140, 205, 247, 289], "papaya": [0, 10, 140, 205, 247, 289], "citrullu": [0, 10, 140, 205, 247, 289], "lanatu": [0, 10, 140, 205, 247, 289], "melo": [0, 10, 140, 205, 247, 289], "malu": [0, 10, 140, 205, 247, 289], "dulci": [0, 10, 140, 205, 247, 289], "cajanu": [0, 10, 140, 205, 247, 289], "cajan": [0, 10, 140, 205, 247, 289], "cicer": [0, 10, 140, 205, 247, 289], "arietinum": [0, 10, 140, 205, 247, 289], "soja": [0, 10, 140, 205, 247, 289], "lupinu": [0, 10, 140, 205, 247, 289], "angustifoliu": [0, 10, 140, 205, 247, 289], "phaseolu": [0, 10, 140, 205, 247, 289], "vigna": [0, 10, 140, 205, 247, 289], "angulari": [0, 10, 140, 205, 247, 289], "linum": [0, 10, 140, 205, 247, 289], "usitatissimum": [0, 10, 140, 205, 247, 289], "daucu": [0, 10, 140, 205, 247, 289], "carota": [0, 10, 140, 205, 247, 289], "sylvestri": [0, 10, 140, 205, 247, 289], "tomentosiformi": [0, 10, 140, 205, 247, 289], "benthamiana": [0, 10, 140, 205, 247, 289], "commersonii": [0, 10, 140, 205, 247, 289], "olea": [0, 10, 140, 205, 247, 289], "sesamum": [0, 10, 140, 205, 247, 289], "cynara": [0, 10, 140, 205, 247, 289], "cardunculu": [0, 10, 140, 205, 247, 289], "scolymu": [0, 10, 140, 205, 247, 289], "longistaminata": [0, 10, 140, 205, 247, 289], "rufipogon": [0, 10, 140, 205, 247, 289], "brachyantha": [0, 10, 140, 205, 247, 289], "nivara": [0, 10, 140, 205, 247, 289], "punctata": [0, 10, 140, 205, 247, 289], "glaberrima": [0, 10, 140, 205, 247, 289], "durum": [0, 10, 140, 205, 247, 289], "urartu": [0, 10, 140, 205, 247, 289], "anana": [0, 10, 140, 205, 247, 289], "comosu": [0, 10, 140, 205, 247, 289], "pneumocysti": [0, 10, 140, 205, 247, 289], "carinii": [0, 10, 140, 205, 247, 289], "plasmopara": [0, 10, 140, 205, 247, 289], "infestan": [0, 10, 140, 205, 247, 289], "parasitica": [0, 10, 140, 205, 247, 289], "megakarya": [0, 10, 140, 205, 247, 289], "palmivora": [0, 10, 140, 205, 247, 289], "phycomyc": [0, 10, 140, 205, 247, 289], "blakesleeanu": [0, 10, 140, 205, 247, 289], "972h": [0, 10, 140, 205, 247, 289], "octosporu": [0, 10, 140, 205, 247, 289], "cyberlindnera": [0, 10, 140, 205, 247, 289], "jadinii": [0, 10, 140, 205, 247, 289], "pichia": [0, 10, 140, 205, 247, 289], "kudriavzevii": [0, 10, 140, 205, 247, 289], "kluyveromyc": [0, 10, 140, 205, 247, 289], "marxianu": [0, 10, 140, 205, 247, 289], "dmku3": [0, 10, 140, 205, 247, 289], "1042": [0, 10, 140, 205, 247, 289], "lachancea": [0, 10, 140, 205, 247, 289], "waltii": [0, 10, 140, 205, 247, 289], "pachysolen": [0, 10, 140, 205, 247, 289], "tannophilu": [0, 10, 140, 205, 247, 289], "2460": [0, 10, 140, 205, 247, 289], "millerozyma": [0, 10, 140, 205, 247, 289], "farinosa": [0, 10, 140, 205, 247, 289], "komagataella": [0, 10, 140, 205, 247, 289], "pastori": [0, 10, 140, 205, 247, 289], "scheffersomyc": [0, 10, 140, 205, 247, 289], "stipiti": [0, 10, 140, 205, 247, 289], "membranifacien": [0, 10, 140, 205, 247, 289], "2026": [0, 10, 140, 205, 247, 289], "wickerhamomyc": [0, 10, 140, 205, 247, 289], "anomalu": [0, 10, 140, 205, 247, 289], "meyerozyma": [0, 10, 140, 205, 247, 289], "guilliermondii": [0, 10, 140, 205, 247, 289], "bayanu": [0, 10, 140, 205, 247, 289], "s288c": [0, 10, 140, 205, 247, 289], "torulaspora": [0, 10, 140, 205, 247, 289], "cb": [0, 10, 140, 205, 247, 289], "1146": [0, 10, 140, 205, 247, 289], "clib122": [0, 10, 140, 205, 247, 289], "zygosaccharomyc": [0, 10, 140, 205, 247, 289], "bailii": [0, 10, 140, 205, 247, 289], "clib": [0, 10, 140, 205, 247, 289], "fermentati": [0, 10, 140, 205, 247, 289], "rouxii": [0, 10, 140, 205, 247, 289], "debaryomyc": [0, 10, 140, 205, 247, 289], "kockovaella": [0, 10, 140, 205, 247, 289], "imperata": [0, 10, 140, 205, 247, 289], "brettanomyc": [0, 10, 140, 205, 247, 289], "bruxellensi": [0, 10, 140, 205, 247, 289], "taphrina": [0, 10, 140, 205, 247, 289], "deforman": [0, 10, 140, 205, 247, 289], "pycc": [0, 10, 140, 205, 247, 289], "5710": [0, 10, 140, 205, 247, 289], "bipolari": [0, 10, 140, 205, 247, 289], "zeicola": [0, 10, 140, 205, 247, 289], "leptosphaeria": [0, 10, 140, 205, 247, 289], "maculan": [0, 10, 140, 205, 247, 289], "histoplasma": [0, 10, 140, 205, 247, 289], "capsulatum": [0, 10, 140, 205, 247, 289], "blastomyc": [0, 10, 140, 205, 247, 289], "dermatitidi": [0, 10, 140, 205, 247, 289], "acremonium": [0, 10, 140, 205, 247, 289], "chrysogenum": [0, 10, 140, 205, 247, 289], "11550": [0, 10, 140, 205, 247, 289], "aspergillu": [0, 10, 140, 205, 247, 289], "clavatu": [0, 10, 140, 205, 247, 289], "flavu": [0, 10, 140, 205, 247, 289], "niger": [0, 10, 140, 205, 247, 289], "penicillium": [0, 10, 140, 205, 247, 289], "camemberti": [0, 10, 140, 205, 247, 289], "roqueforti": [0, 10, 140, 205, 247, 289], "amorphotheca": [0, 10, 140, 205, 247, 289], "resina": [0, 10, 140, 205, 247, 289], "22711": [0, 10, 140, 205, 247, 289], "ascosphaera": [0, 10, 140, 205, 247, 289], "arsef": [0, 10, 140, 205, 247, 289], "7405": [0, 10, 140, 205, 247, 289], "clavicep": [0, 10, 140, 205, 247, 289], "purpurea": [0, 10, 140, 205, 247, 289], "epichlo": [0, 10, 140, 205, 247, 289], "typhina": [0, 10, 140, 205, 247, 289], "e8": [0, 10, 140, 205, 247, 289], "cryphonectria": [0, 10, 140, 205, 247, 289], "fusarium": [0, 10, 140, 205, 247, 289], "fujikuroi": [0, 10, 140, 205, 247, 289], "or74a": [0, 10, 140, 205, 247, 289], "sordaria": [0, 10, 140, 205, 247, 289], "macrospora": [0, 10, 140, 205, 247, 289], "hell": [0, 10, 140, 205, 247, 289], "ophiostoma": [0, 10, 140, 205, 247, 289], "ulmi": [0, 10, 140, 205, 247, 289], "1980": [0, 10, 140, 205, 247, 289], "uf": [0, 10, 140, 205, 247, 289], "jec21": [0, 10, 140, 205, 247, 289], "depauperatu": [0, 10, 140, 205, 247, 289], "7841": [0, 10, 140, 205, 247, 289], "tremella": [0, 10, 140, 205, 247, 289], "mesenterica": [0, 10, 140, 205, 247, 289], "exidia": [0, 10, 140, 205, 247, 289], "glandulosa": [0, 10, 140, 205, 247, 289], "hhb12029": [0, 10, 140, 205, 247, 289], "521": [0, 10, 140, 205, 247, 289], "microbotryum": [0, 10, 140, 205, 247, 289], "tilletiaria": [0, 10, 140, 205, 247, 289], "anomala": [0, 10, 140, 205, 247, 289], "ubc": [0, 10, 140, 205, 247, 289], "951": [0, 10, 140, 205, 247, 289], "rhodotorula": [0, 10, 140, 205, 247, 289], "toruloid": [0, 10, 140, 205, 247, 289], "tritici": [0, 10, 140, 205, 247, 289], "crl": [0, 10, 140, 205, 247, 289], "36": [0, 10, 140, 205, 247, 289], "700": [0, 10, 140, 205, 247, 289], "phanerochaet": [0, 10, 140, 205, 247, 289], "chrysosporium": [0, 10, 140, 205, 247, 289], "pleurotu": [0, 10, 140, 205, 247, 289], "ostreatu": [0, 10, 140, 205, 247, 289], "tramet": [0, 10, 140, 205, 247, 289], "versicolor": [0, 10, 140, 205, 247, 289], "fp": [0, 10, 140, 205, 247, 289], "101664": [0, 10, 140, 205, 247, 289], "ss1": [0, 10, 140, 205, 247, 289], "schizophyllum": [0, 10, 140, 205, 247, 289], "agaricu": [0, 10, 140, 205, 247, 289], "bisporu": [0, 10, 140, 205, 247, 289], "coprinopsi": [0, 10, 140, 205, 247, 289], "lentinula": [0, 10, 140, 205, 247, 289], "edod": [0, 10, 140, 205, 247, 289], "suillu": [0, 10, 140, 205, 247, 289], "uh": [0, 10, 140, 205, 247, 289], "slu": [0, 10, 140, 205, 247, 289], "lm8": [0, 10, 140, 205, 247, 289], "n1": [0, 10, 140, 205, 247, 289], "ascochyta": [0, 10, 140, 205, 247, 289], "rabiei": [0, 10, 140, 205, 247, 289], "colletotrichum": [0, 10, 140, 205, 247, 289], "orbicular": [0, 10, 140, 205, 247, 289], "sc5314": [0, 10, 140, 205, 247, 289], "maltosa": [0, 10, 140, 205, 247, 289], "parapsilosi": [0, 10, 140, 205, 247, 289], "diutina": [0, 10, 140, 205, 247, 289], "rugosa": [0, 10, 140, 205, 247, 289], "coccidioid": [0, 10, 140, 205, 247, 289], "immiti": [0, 10, 140, 205, 247, 289], "oxysporum": [0, 10, 140, 205, 247, 289], "culmorum": [0, 10, 140, 205, 247, 289], "cs7071": [0, 10, 140, 205, 247, 289], "graminearum": [0, 10, 140, 205, 247, 289], "metarhizium": [0, 10, 140, 205, 247, 289], "anisoplia": [0, 10, 140, 205, 247, 289], "549": [0, 10, 140, 205, 247, 289], "glutini": [0, 10, 140, 205, 247, 289], "trichoderma": [0, 10, 140, 205, 247, 289], "harzianum": [0, 10, 140, 205, 247, 289], "longibrachiatum": [0, 10, 140, 205, 247, 289], "18648": [0, 10, 140, 205, 247, 289], "trichophyton": [0, 10, 140, 205, 247, 289], "aureobasidium": [0, 10, 140, 205, 247, 289], "pullulan": [0, 10, 140, 205, 247, 289], "exf": [0, 10, 140, 205, 247, 289], "150": [0, 10, 140, 166, 205, 247, 289, 323], "alternaria": [0, 10, 140, 205, 247, 289], "alternata": [0, 10, 140, 205, 247, 289], "phialophora": [0, 10, 140, 205, 247, 289], "americana": [0, 10, 140, 205, 247, 289], "saitoella": [0, 10, 140, 205, 247, 289], "complicata": [0, 10, 140, 205, 247, 289], "17804": [0, 10, 140, 205, 247, 289], "wingfieldii": [0, 10, 140, 205, 247, 289], "7118": [0, 10, 140, 205, 247, 289], "grifola": [0, 10, 140, 205, 247, 289], "frondosa": [0, 10, 140, 205, 247, 289], "laetiporu": [0, 10, 140, 205, 247, 289], "sulphureu": [0, 10, 140, 205, 247, 289], "93": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "cinnabarina": [0, 10, 140, 205, 247, 289], "braziliensi": [0, 10, 140, 205, 247, 289], "mhom": [0, 10, 140, 205, 247, 289], "br": [0, 10, 140, 205, 247, 289], "m2904": [0, 10, 140, 205, 247, 289], "donovani": [0, 10, 140, 205, 247, 289], "bpk282a1": [0, 10, 140, 205, 247, 289], "gt": [0, 10, 140, 150, 205, 206, 247, 248, 289, 290, 324], "2001": [0, 10, 140, 205, 247, 289], "u1103": [0, 10, 140, 205, 247, 289], "infantum": [0, 10, 140, 205, 247, 289], "jpcm5": [0, 10, 140, 205, 247, 289], "panamensi": [0, 10, 140, 205, 247, 289], "leptomona": [0, 10, 140, 205, 247, 289], "seymouri": [0, 10, 140, 205, 247, 289], "tarentola": [0, 10, 140, 205, 247, 289], "cruzi": [0, 10, 140, 205, 247, 289], "equiperdum": [0, 10, 140, 205, 247, 289], "sc58": [0, 10, 140, 205, 247, 289], "lamblia": [0, 10, 140, 205, 247, 289], "50803": [0, 10, 140, 205, 247, 289], "acanthamoeba": [0, 10, 140, 205, 247, 289], "castellanii": [0, 10, 140, 205, 247, 289], "neff": [0, 10, 140, 205, 247, 289], "naegleria": [0, 10, 140, 205, 247, 289], "gruberi": [0, 10, 140, 205, 247, 289], "eimeria": [0, 10, 140, 205, 247, 289], "acervulina": [0, 10, 140, 205, 247, 289], "tenella": [0, 10, 140, 205, 247, 289], "maxima": [0, 10, 140, 205, 247, 289], "cryptosporidium": [0, 10, 140, 205, 247, 289], "parvum": [0, 10, 140, 205, 247, 289], "ii": [0, 10, 140, 205, 247, 289], "muri": [0, 10, 140, 205, 247, 289], "toxoplasma": [0, 10, 140, 205, 247, 289], "gondii": [0, 10, 140, 205, 247, 289], "me49": [0, 10, 140, 205, 247, 289], "berghei": [0, 10, 140, 205, 247, 289], "chabaudi": [0, 10, 140, 205, 247, 289], "cynomolgi": [0, 10, 140, 205, 247, 289], "3d7": [0, 10, 140, 205, 247, 289], "gallinaceum": [0, 10, 140, 205, 247, 289], "knowlesi": [0, 10, 140, 205, 247, 289], "reichenowi": [0, 10, 140, 205, 247, 289], "vivax": [0, 10, 140, 205, 247, 289], "sal": [0, 10, 140, 205, 247, 289], "fragil": [0, 10, 140, 205, 247, 289], "malaria": [0, 10, 140, 205, 247, 289], "vinckei": [0, 10, 140, 205, 247, 289], "yoelii": [0, 10, 140, 205, 247, 289], "babesia": [0, 10, 140, 205, 247, 289], "t2bo": [0, 10, 140, 205, 247, 289], "bigemina": [0, 10, 140, 205, 247, 289], "theileria": [0, 10, 140, 205, 247, 289], "annulata": [0, 10, 140, 205, 247, 289], "parva": [0, 10, 140, 205, 247, 289], "tetrahymena": [0, 10, 140, 205, 247, 289], "ichthyophthiriu": [0, 10, 140, 205, 247, 289], "multifilii": [0, 10, 140, 205, 247, 289], "stylonychia": [0, 10, 140, 205, 247, 289], "lemna": [0, 10, 140, 205, 247, 289], "stentor": [0, 10, 140, 205, 247, 289], "coeruleu": [0, 10, 140, 205, 247, 289], "exophiala": [0, 10, 140, 205, 247, 289], "encephalitozoon": [0, 10, 140, 205, 247, 289], "hydra": [0, 10, 140, 205, 247, 289], "schistosoma": [0, 10, 140, 205, 247, 289], "mansoni": [0, 10, 140, 205, 247, 289], "haematobium": [0, 10, 140, 205, 247, 289], "echinococcu": [0, 10, 140, 205, 247, 289], "multiloculari": [0, 10, 140, 205, 247, 289], "ascari": [0, 10, 140, 205, 247, 289], "suum": [0, 10, 140, 205, 247, 289], "brugia": [0, 10, 140, 205, 247, 289], "malayi": [0, 10, 140, 205, 247, 289], "onchocerca": [0, 10, 140, 205, 247, 289], "volvulu": [0, 10, 140, 205, 247, 289], "meloidogyn": [0, 10, 140, 205, 247, 289], "hapla": [0, 10, 140, 205, 247, 289], "bursaphelenchu": [0, 10, 140, 205, 247, 289], "xylophilu": [0, 10, 140, 205, 247, 289], "trichinella": [0, 10, 140, 205, 247, 289], "spirali": [0, 10, 140, 205, 247, 289], "aplysia": [0, 10, 140, 205, 247, 289], "biomphalaria": [0, 10, 140, 205, 247, 289], "glabrata": [0, 10, 140, 205, 247, 289], "crassostrea": [0, 10, 140, 205, 247, 289], "virginica": [0, 10, 140, 205, 247, 289], "mizuhopecten": [0, 10, 140, 205, 247, 289], "yessoensi": [0, 10, 140, 205, 247, 289], "tigriopu": [0, 10, 140, 205, 247, 289], "californicu": [0, 10, 140, 205, 247, 289], "blattella": [0, 10, 140, 205, 247, 289], "germanica": [0, 10, 140, 205, 247, 289], "acyrthosiphon": [0, 10, 140, 205, 247, 289], "pisum": [0, 10, 140, 205, 247, 289], "bemisia": [0, 10, 140, 205, 247, 289], "tabaci": [0, 10, 140, 205, 247, 289], "bombyx": [0, 10, 140, 205, 247, 289], "mori": [0, 10, 140, 205, 247, 289], "aed": [0, 10, 140, 205, 247, 289], "aegypti": [0, 10, 140, 205, 247, 289], "albopictu": [0, 10, 140, 205, 247, 289], "albimanu": [0, 10, 140, 205, 247, 289], "diru": [0, 10, 140, 205, 247, 289], "arabiensi": [0, 10, 140, 205, 247, 289], "culex": [0, 10, 140, 205, 247, 289], "pipien": [0, 10, 140, 205, 247, 289], "quinquefasciatu": [0, 10, 140, 205, 247, 289], "lutzomyia": [0, 10, 140, 205, 247, 289], "longipalpi": [0, 10, 140, 205, 247, 289], "loa": [0, 10, 140, 205, 247, 289], "cerat": [0, 10, 140, 205, 247, 289], "capitata": [0, 10, 140, 205, 247, 289], "ananassa": [0, 10, 140, 205, 247, 289], "erecta": [0, 10, 140, 205, 247, 289], "grimshawi": [0, 10, 140, 205, 247, 289], "mojavensi": [0, 10, 140, 205, 247, 289], "persimili": [0, 10, 140, 205, 247, 289], "pseudoobscura": [0, 10, 140, 205, 247, 289], "sechellia": [0, 10, 140, 205, 247, 289], "virili": [0, 10, 140, 205, 247, 289], "yakuba": [0, 10, 140, 205, 247, 289], "willistoni": [0, 10, 140, 205, 247, 289], "saltan": [0, 10, 140, 205, 247, 289], "musca": [0, 10, 140, 205, 247, 289], "lucilia": [0, 10, 140, 205, 247, 289], "cuprina": [0, 10, 140, 205, 247, 289], "glossina": [0, 10, 140, 205, 247, 289], "morsitan": [0, 10, 140, 205, 247, 289], "austeni": [0, 10, 140, 205, 247, 289], "fuscip": [0, 10, 140, 205, 247, 289], "palpali": [0, 10, 140, 205, 247, 289], "gambiensi": [0, 10, 140, 205, 247, 289], "pallidip": [0, 10, 140, 205, 247, 289], "nasonia": [0, 10, 140, 205, 247, 289], "vitripenni": [0, 10, 140, 205, 247, 289], "mellifera": [0, 10, 140, 205, 247, 289], "lingula": [0, 10, 140, 205, 247, 289], "anatina": [0, 10, 140, 205, 247, 289], "lanceolatum": [0, 10, 140, 205, 247, 289], "chelonia": [0, 10, 140, 205, 247, 289], "myda": [0, 10, 140, 205, 247, 289], "allig": [0, 10, 140, 205, 247, 289], "mississippiensi": [0, 10, 140, 205, 247, 289], "chaetura": [0, 10, 140, 205, 247, 289], "pelagica": [0, 10, 140, 205, 247, 289], "livia": [0, 10, 140, 205, 247, 289], "peregrinu": [0, 10, 140, 205, 247, 289], "haliaeetu": [0, 10, 140, 205, 247, 289], "albicilla": [0, 10, 140, 205, 247, 289], "phalacrocorax": [0, 10, 140, 205, 247, 289], "carbo": [0, 10, 140, 205, 247, 289], "phoenicopteru": [0, 10, 140, 205, 247, 289], "aptenodyt": [0, 10, 140, 205, 247, 289], "forsteri": [0, 10, 140, 205, 247, 289], "pygosc": [0, 10, 140, 205, 247, 289], "adelia": [0, 10, 140, 205, 247, 289], "calypt": [0, 10, 140, 205, 247, 289], "anna": [0, 10, 140, 205, 247, 289], "alecto": [0, 10, 140, 205, 247, 289], "onca": [0, 10, 140, 205, 247, 289], "odobenu": [0, 10, 140, 205, 247, 289], "rosmaru": [0, 10, 140, 205, 247, 289], "leptonychot": [0, 10, 140, 205, 247, 289], "weddellii": [0, 10, 140, 205, 247, 289], "orcinu": [0, 10, 140, 205, 247, 289], "orca": [0, 10, 140, 205, 247, 289], "acutorostrata": [0, 10, 140, 205, 247, 289], "trichechu": [0, 10, 140, 205, 247, 289], "manatu": [0, 10, 140, 205, 247, 289], "orycteropu": [0, 10, 140, 205, 247, 289], "afer": [0, 10, 140, 205, 247, 289], "saccoglossu": [0, 10, 140, 205, 247, 289], "kowalevskii": [0, 10, 140, 205, 247, 289], "sagitta": [0, 10, 140, 205, 247, 289], "atta": [0, 10, 140, 205, 247, 289], "cephalot": [0, 10, 140, 205, 247, 289], "blastocysti": [0, 10, 140, 205, 247, 289], "danau": [0, 10, 140, 205, 247, 289], "plexippu": [0, 10, 140, 205, 247, 289], "rhodniu": [0, 10, 140, 205, 247, 289], "prolixu": [0, 10, 140, 205, 247, 289], "tilletia": [0, 10, 140, 205, 247, 289], "cari": [0, 10, 140, 205, 247, 289], "controversa": [0, 10, 140, 205, 247, 289], "anaerobiospirillum": [0, 10, 140, 205, 247, 289], "succiniciproducen": [0, 10, 140, 205, 247, 289], "6400": [0, 10, 140, 205, 247, 289], "arthrobotri": [0, 10, 140, 205, 247, 289], "oligospora": [0, 10, 140, 205, 247, 289], "24927": [0, 10, 140, 205, 247, 289], "mallei": [0, 10, 140, 205, 247, 289], "23344": [0, 10, 140, 205, 247, 289], "parastagonospora": [0, 10, 140, 205, 247, 289], "sn15": [0, 10, 140, 205, 247, 289], "solenopsi": [0, 10, 140, 205, 247, 289], "invicta": [0, 10, 140, 205, 247, 289], "sphingomona": [0, 10, 140, 205, 247, 289], "paucimobili": [0, 10, 140, 205, 247, 289], "sphingobium": [0, 10, 140, 205, 247, 289], "yanoikuya": [0, 10, 140, 205, 247, 289], "syncephalastrum": [0, 10, 140, 205, 247, 289], "racemosum": [0, 10, 140, 205, 247, 289], "utricularia": [0, 10, 140, 205, 247, 289], "gibba": [0, 10, 140, 205, 247, 289], "natrialba": [0, 10, 140, 205, 247, 289], "magadii": [0, 10, 140, 205, 247, 289], "43099": [0, 10, 140, 205, 247, 289], "im2": [0, 10, 140, 205, 247, 289], "naumovozyma": [0, 10, 140, 205, 247, 289], "castellii": [0, 10, 140, 205, 247, 289], "dairenensi": [0, 10, 140, 205, 247, 289], "421": [0, 10, 140, 205, 247, 289], "paradoxu": [0, 10, 140, 205, 247, 289], "pastorianu": [0, 10, 140, 205, 247, 289], "weihenstephan": [0, 10, 140, 205, 247, 289], "34": [0, 9, 10, 140, 205, 247, 289], "metschnikowia": [0, 10, 140, 205, 247, 289], "bicuspidata": [0, 10, 140, 205, 247, 289], "yb": [0, 10, 140, 205, 247, 289], "4993": [0, 10, 140, 205, 247, 289], "expansum": [0, 10, 140, 205, 247, 289], "verticillium": [0, 10, 140, 205, 247, 289], "dahlia": [0, 10, 140, 205, 247, 289], "vdl": [0, 10, 140, 205, 247, 289], "17": [0, 2, 9, 10, 140, 172, 205, 217, 247, 258, 289, 302, 324, 325], "schizopora": [0, 10, 140, 205, 247, 289], "paradoxa": [0, 10, 140, 205, 247, 289], "avena": [0, 10, 140, 205, 247, 289], "sorghi": [0, 10, 140, 205, 247, 289], "striiformi": [0, 10, 140, 205, 247, 289], "mnemiopsi": [0, 10, 140, 205, 247, 289], "leidyi": [0, 10, 140, 205, 247, 289], "hellem": [0, 10, 140, 205, 247, 289], "50504": [0, 10, 140, 205, 247, 289], "nosema": [0, 10, 140, 205, 247, 289], "bombyci": [0, 10, 140, 205, 247, 289], "cq1": [0, 10, 140, 205, 247, 289], "strigomona": [0, 10, 140, 205, 247, 289], "culici": [0, 10, 140, 205, 247, 289], "bb": [0, 10, 140, 205, 247, 289], "pseudocatenulatum": [0, 10, 140, 205, 247, 289], "20438": [0, 10, 140, 205, 247, 289], "1200": [0, 10, 140, 205, 247, 289], "10505": [0, 10, 140, 205, 247, 289], "fusiformi": [0, 10, 140, 205, 247, 289], "zc1": [0, 10, 140, 205, 247, 289], "lugdunensi": [0, 10, 140, 205, 247, 289], "hku09": [0, 10, 140, 205, 247, 289], "miti": [0, 10, 140, 205, 247, 289], "b6": [0, 10, 140, 205, 247, 289], "705": [0, 10, 140, 205, 247, 289], "rectivirgula": [0, 10, 140, 205, 247, 289], "acidothermu": [0, 10, 140, 205, 247, 289], "cellulolyticu": [0, 10, 140, 205, 247, 289], "11b": [0, 10, 140, 205, 247, 289], "lachnospira": [0, 10, 140, 205, 247, 289], "multipara": [0, 10, 140, 205, 247, 289], "19207": [0, 10, 140, 205, 247, 289], "rubrivivax": [0, 10, 140, 205, 247, 289], "gelatinosu": [0, 10, 140, 205, 247, 289], "il144": [0, 10, 140, 205, 247, 289], "nostoc": [0, 10, 140, 205, 247, 289], "7524": [0, 10, 140, 205, 247, 289], "upsaliensi": [0, 10, 140, 205, 247, 289], "rm3195": [0, 10, 140, 205, 247, 289], "anisa": [0, 10, 140, 205, 247, 289], "linanisett": [0, 10, 140, 205, 247, 289], "sainthelensi": [0, 10, 140, 205, 247, 289], "35248": [0, 10, 140, 205, 247, 289], "19231": [0, 10, 140, 205, 247, 289], "lwoffii": [0, 10, 140, 205, 247, 289], "sh145": [0, 10, 140, 205, 247, 289], "weaveri": [0, 10, 140, 205, 247, 289], "5135": [0, 10, 140, 205, 247, 289], "gladioli": [0, 10, 140, 205, 247, 289], "bsr3": [0, 10, 140, 205, 247, 289], "huakuii": [0, 10, 140, 205, 247, 289], "7653r": [0, 10, 140, 205, 247, 289], "alteromona": [0, 10, 140, 205, 247, 289], "macleodii": [0, 10, 140, 205, 247, 289], "black": [0, 10, 76, 77, 140, 205, 247, 289], "sea": [0, 10, 140, 205, 247, 289], "11": [0, 6, 9, 10, 140, 205, 247, 289, 323, 325], "philomiragia": [0, 10, 140, 205, 247, 289], "25017": [0, 10, 140, 205, 247, 289], "eggerthii": [0, 10, 140, 205, 247, 289], "20697": [0, 10, 140, 205, 247, 289], "tannerella": [0, 10, 140, 205, 247, 289], "forsythia": [0, 10, 140, 205, 247, 289], "92a2": [0, 10, 140, 205, 247, 289], "levii": [0, 10, 140, 205, 247, 289], "23370": [0, 10, 140, 205, 247, 289], "ovatu": [0, 10, 140, 205, 247, 289], "8483": [0, 10, 140, 205, 247, 289], "alistip": [0, 10, 140, 205, 247, 289], "putredini": [0, 10, 140, 205, 247, 289], "17216": [0, 10, 140, 205, 247, 289], "odoribact": [0, 10, 140, 205, 247, 289], "splanchnicu": [0, 10, 140, 205, 247, 289], "20712": [0, 10, 140, 205, 247, 289], "asaccharolytica": [0, 10, 140, 205, 247, 289], "20707": [0, 10, 140, 205, 247, 289], "endodontali": [0, 10, 140, 205, 247, 289], "35406": [0, 10, 140, 205, 247, 289], "bivia": [0, 10, 140, 205, 247, 289], "dnf00188": [0, 10, 140, 205, 247, 289], "bucca": [0, 10, 140, 205, 247, 289], "33574": [0, 10, 140, 205, 247, 289], "buccali": [0, 10, 140, 205, 247, 289], "35310": [0, 10, 140, 205, 247, 289], "corpori": [0, 10, 140, 205, 247, 289], "18810": [0, 10, 140, 205, 247, 289], "8529": [0, 10, 140, 205, 247, 289], "f0289": [0, 10, 140, 205, 247, 289], "disien": [0, 10, 140, 205, 247, 289], "6334": [0, 10, 140, 205, 247, 289], "29426": [0, 10, 140, 205, 247, 289], "melaninogenica": [0, 10, 140, 205, 247, 289], "25845": [0, 10, 140, 205, 247, 289], "nigrescen": [0, 10, 140, 205, 247, 289], "33563": [0, 10, 140, 205, 247, 289], "33269": [0, 10, 140, 205, 247, 289], "c735": [0, 10, 140, 205, 247, 289], "oulorum": [0, 10, 140, 205, 247, 289], "14966": [0, 10, 140, 205, 247, 289], "verorali": [0, 10, 140, 205, 247, 289], "f0319": [0, 10, 140, 205, 247, 289], "rikenella": [0, 10, 140, 205, 247, 289], "microfusu": [0, 10, 140, 205, 247, 289], "15922": [0, 10, 140, 205, 247, 289], "cronobact": [0, 10, 140, 205, 247, 289], "sakazakii": [0, 10, 140, 205, 247, 289], "894": [0, 10, 140, 205, 247, 289], "proteamaculan": [0, 10, 140, 205, 247, 289], "568": [0, 10, 140, 205, 247, 289], "kristensenii": [0, 10, 140, 205, 247, 289], "metschnikovii": [0, 10, 140, 205, 247, 289], "69": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "nigripulchritudo": [0, 10, 140, 205, 247, 289], "son1": [0, 10, 140, 205, 247, 289], "102891": [0, 10, 140, 205, 247, 289], "33934": [0, 10, 140, 205, 247, 289], "candidatu": [0, 10, 140, 205, 247, 289], "photodesmu": [0, 10, 140, 205, 247, 289], "katoptron": [0, 10, 140, 205, 247, 289], "acetohalobium": [0, 10, 140, 205, 247, 289], "arabaticum": [0, 10, 140, 205, 247, 289], "5501": [0, 10, 140, 205, 247, 289], "canimorsu": [0, 10, 140, 205, 247, 289], "cc5": [0, 10, 140, 205, 247, 289], "cynodegmi": [0, 10, 140, 205, 247, 289], "19736": [0, 10, 140, 205, 247, 289], "arcobact": [0, 10, 140, 205, 247, 289], "butzleri": [0, 10, 140, 205, 247, 289], "rm4018": [0, 10, 140, 205, 247, 289], "nitrofigili": [0, 10, 140, 205, 247, 289], "7299": [0, 10, 140, 205, 247, 289], "parapaucimobili": [0, 10, 140, 205, 247, 289], "15100": [0, 10, 140, 205, 247, 289], "desulfobacula": [0, 10, 140, 205, 247, 289], "toluolica": [0, 10, 140, 205, 247, 289], "tol2": [0, 10, 140, 205, 247, 289], "penetran": [0, 10, 140, 205, 247, 289], "colwellia": [0, 10, 140, 205, 247, 289], "psychrerythraea": [0, 10, 140, 205, 247, 289], "alterfunditum": [0, 10, 140, 205, 247, 289], "5972": [0, 10, 140, 205, 247, 289], "metallireducen": [0, 10, 140, 205, 247, 289], "ornithobacterium": [0, 10, 140, 205, 247, 289], "rhinotracheal": [0, 10, 140, 205, 247, 289], "15997": [0, 10, 140, 205, 247, 289], "cobetia": [0, 10, 140, 205, 247, 289], "11347": [0, 10, 140, 205, 247, 289], "arcanobacterium": [0, 10, 140, 205, 247, 289], "haemolyticum": [0, 10, 140, 205, 247, 289], "20595": [0, 10, 140, 205, 247, 289], "herbidospora": [0, 10, 140, 205, 247, 289], "cretacea": [0, 10, 140, 205, 247, 289], "clavibact": [0, 10, 140, 205, 247, 289], "michiganensi": [0, 10, 140, 205, 247, 289], "sepedonicu": [0, 10, 140, 205, 247, 289], "xylinu": [0, 10, 140, 205, 247, 289], "e25": [0, 10, 140, 205, 247, 289], "subflava": [0, 10, 140, 205, 247, 289], "nj9703": [0, 10, 140, 205, 247, 289], "pseudomallei": [0, 10, 140, 205, 247, 289], "k96243": [0, 10, 140, 205, 247, 289], "tarenaya": [0, 10, 140, 205, 247, 289], "hassleriana": [0, 10, 140, 205, 247, 289], "talaromyc": [0, 10, 140, 205, 247, 289], "stipitatu": [0, 10, 140, 205, 247, 289], "10500": [0, 10, 140, 205, 247, 289], "islandicu": [0, 10, 140, 205, 247, 289], "allomyc": [0, 10, 140, 205, 247, 289], "macrogynu": [0, 10, 140, 205, 247, 289], "elephantulu": [0, 10, 140, 205, 247, 289], "edwardii": [0, 10, 140, 205, 247, 289], "saccharolyticum": [0, 10, 140, 205, 247, 289], "jw": [0, 10, 140, 205, 247, 289], "sl": [0, 10, 140, 205, 247, 289], "ys485": [0, 10, 140, 205, 247, 289], "enterica": [0, 10, 140, 205, 247, 289], "lt2": [0, 10, 140, 205, 247, 289], "pg45": [0, 10, 140, 205, 247, 289], "brassicicola": [0, 10, 140, 205, 247, 289], "eugracili": [0, 10, 140, 205, 247, 289], "takahashii": [0, 10, 140, 205, 247, 289], "phlebotomu": [0, 10, 140, 205, 247, 289], "papatasi": [0, 10, 140, 205, 247, 289], "uncia": [0, 10, 140, 205, 247, 289], "eptesicu": [0, 10, 140, 205, 247, 289], "mytilu": [0, 10, 140, 205, 247, 289], "galloprovinciali": [0, 10, 140, 205, 247, 289], "neospora": [0, 10, 140, 205, 247, 289], "caninum": [0, 10, 140, 205, 247, 289], "6131": [0, 10, 140, 205, 247, 289], "natronococcu": [0, 10, 140, 205, 247, 289], "occultu": [0, 10, 140, 205, 247, 289], "sp4": [0, 10, 140, 205, 247, 289], "burtonii": [0, 10, 140, 205, 247, 289], "6242": [0, 10, 140, 205, 247, 289], "abyssi": [0, 10, 140, 205, 247, 289], "ge5": [0, 10, 140, 205, 247, 289], "cattleya": [0, 10, 140, 205, 247, 289], "8057": [0, 10, 140, 205, 247, 289], "46488": [0, 10, 140, 205, 247, 289], "griseoluteu": [0, 10, 140, 205, 247, 289], "paenarthrobact": [0, 10, 140, 205, 247, 289], "nicotinovoran": [0, 10, 140, 205, 247, 289], "231sha2": [0, 10, 140, 205, 247, 289], "1m6": [0, 10, 140, 205, 247, 289], "otitidi": [0, 10, 140, 205, 247, 289], "51513": [0, 10, 140, 205, 247, 289], "brockii": [0, 10, 140, 205, 247, 289], "finnii": [0, 10, 140, 205, 247, 289], "ako": [0, 10, 140, 205, 247, 289], "xylanolyticum": [0, 10, 140, 205, 247, 289], "lx": [0, 10, 140, 205, 247, 289], "cellobioparum": [0, 10, 140, 205, 247, 289], "ct1112": [0, 10, 140, 205, 247, 289], "cellulosilyticum": [0, 10, 140, 205, 247, 289], "lentocellum": [0, 10, 140, 205, 247, 289], "5427": [0, 10, 140, 205, 247, 289], "tyzzerella": [0, 10, 140, 205, 247, 289], "nexili": [0, 10, 140, 205, 247, 289], "1787": [0, 10, 140, 205, 247, 289], "papyrosolven": [0, 10, 140, 205, 247, 289], "2782": [0, 10, 140, 205, 247, 289], "paraputrificum": [0, 10, 140, 205, 247, 289], "agr2156": [0, 10, 140, 205, 247, 289], "m23864": [0, 10, 140, 205, 247, 289], "w1": [0, 10, 140, 205, 247, 289], "saprophyticu": [0, 10, 140, 205, 247, 289], "15305": [0, 10, 140, 205, 247, 289], "7292": [0, 10, 140, 205, 247, 289], "capiti": [0, 10, 140, 205, 247, 289], "c87": [0, 10, 140, 205, 247, 289], "morbillorum": [0, 10, 140, 205, 247, 289], "m424": [0, 10, 140, 205, 247, 289], "dolosigranulum": [0, 10, 140, 205, 247, 289], "pigrum": [0, 10, 140, 205, 247, 289], "51524": [0, 10, 140, 205, 247, 289], "microlunatu": [0, 10, 140, 205, 247, 289], "phosphovoru": [0, 10, 140, 205, 247, 289], "nm": [0, 10, 140, 205, 247, 289], "12740": [0, 10, 140, 205, 247, 289], "oakridgensi": [0, 10, 140, 205, 247, 289], "33761": [0, 10, 140, 205, 247, 289], "21215": [0, 10, 140, 205, 247, 289], "mtcc": [0, 10, 140, 205, 247, 289], "9819": [0, 10, 140, 205, 247, 289], "psychrobact": [0, 10, 140, 205, 247, 289], "phenylpyruvicu": [0, 10, 140, 205, 247, 289], "7000": [0, 10, 140, 205, 247, 289], "102152": [0, 10, 140, 205, 247, 289], "savastanoi": [0, 10, 140, 205, 247, 289], "phaseolicola": [0, 10, 140, 205, 247, 289], "1448a": [0, 10, 140, 205, 247, 289], "albilinean": [0, 10, 140, 205, 247, 289], "gpe": [0, 10, 140, 205, 247, 289], "pc73": [0, 10, 140, 205, 247, 289], "elkanii": [0, 10, 140, 205, 247, 289], "wsm2783": [0, 10, 140, 205, 247, 289], "etli": [0, 10, 140, 205, 247, 289], "652": [0, 10, 140, 205, 247, 289], "leucaena": [0, 10, 140, 205, 247, 289], "melitensi": [0, 10, 140, 205, 247, 289], "16m": [0, 10, 140, 205, 247, 289], "neotoma": [0, 10, 140, 205, 247, 289], "5k33": [0, 10, 140, 205, 247, 289], "1330": [0, 10, 140, 205, 247, 289], "veillonella": [0, 10, 140, 205, 247, 289], "parvula": [0, 10, 140, 205, 247, 289], "2008": [0, 10, 140, 205, 247, 289], "atrosepticum": [0, 10, 140, 205, 247, 289], "scri1043": [0, 10, 140, 205, 247, 289], "aldova": [0, 10, 140, 205, 247, 289], "35236": [0, 10, 140, 205, 247, 289], "frederiksenii": [0, 10, 140, 205, 247, 289], "33641": [0, 10, 140, 205, 247, 289], "rohdei": [0, 10, 140, 205, 247, 289], "ruckeri": [0, 10, 140, 205, 247, 289], "furnissii": [0, 10, 140, 205, 247, 289], "11218": [0, 10, 140, 205, 247, 289], "navarrensi": [0, 10, 140, 205, 247, 289], "splendidu": [0, 10, 140, 205, 247, 289], "139": [0, 10, 140, 205, 247, 289], "tubiashii": [0, 10, 140, 205, 247, 289], "19109": [0, 10, 140, 205, 247, 289], "haemof": [0, 10, 140, 205, 247, 289], "ohio2": [0, 10, 140, 205, 247, 289], "turneriella": [0, 10, 140, 205, 247, 289], "21527": [0, 10, 140, 205, 247, 289], "afzelii": [0, 10, 140, 205, 247, 289], "pko": [0, 10, 140, 205, 247, 289], "garinii": [0, 10, 140, 205, 247, 289], "bgvir": [0, 10, 140, 205, 247, 289], "crocidura": [0, 10, 140, 205, 247, 289], "dou": [0, 10, 140, 205, 247, 289], "3654": [0, 10, 140, 205, 247, 289], "succinican": [0, 10, 140, 205, 247, 289], "10402": [0, 10, 140, 205, 247, 289], "2379": [0, 10, 140, 205, 247, 289], "lawsonia": [0, 10, 140, 205, 247, 289], "intracellulari": [0, 10, 140, 205, 247, 289], "phe": [0, 10, 140, 205, 247, 289], "mn1": [0, 10, 140, 205, 247, 289], "rhodothermu": [0, 10, 140, 205, 247, 289], "4252": [0, 10, 140, 205, 247, 289], "axanthum": [0, 10, 140, 205, 247, 289], "25176": [0, 10, 140, 205, 247, 289], "canadens": [0, 10, 140, 205, 247, 289], "meleagridi": [0, 10, 140, 205, 247, 289], "ovipneumonia": [0, 10, 140, 205, 247, 289], "14811": [0, 10, 140, 205, 247, 289], "taylorella": [0, 10, 140, 205, 247, 289], "equigenitali": [0, 10, 140, 205, 247, 289], "mce9": [0, 10, 140, 205, 247, 289], "janthinobacterium": [0, 10, 140, 205, 247, 289], "lividum": [0, 10, 140, 205, 247, 289], "dioscorea": [0, 10, 140, 205, 247, 289], "cayenensi": [0, 10, 140, 205, 247, 289], "rotundata": [0, 10, 140, 205, 247, 289], "raimondii": [0, 10, 140, 205, 247, 289], "lipomyc": [0, 10, 140, 205, 247, 289], "starkeyi": [0, 10, 140, 205, 247, 289], "11557": [0, 10, 140, 205, 247, 289], "cidri": [0, 10, 140, 205, 247, 289], "hanseniaspora": [0, 10, 140, 205, 247, 289], "uvarum": [0, 10, 140, 205, 247, 289], "2768": [0, 10, 140, 205, 247, 289], "vulpinum": [0, 10, 140, 205, 247, 289], "gaeumannomyc": [0, 10, 140, 205, 247, 289], "viren": [0, 10, 140, 205, 247, 289], "discreta": [0, 10, 140, 205, 247, 289], "fgsc": [0, 10, 140, 205, 247, 289], "8579": [0, 10, 140, 205, 247, 289], "laccaria": [0, 10, 140, 205, 247, 289], "calocera": [0, 10, 140, 205, 247, 289], "cornea": [0, 10, 140, 205, 247, 289], "hhb12733": [0, 10, 140, 205, 247, 289], "wp1": [0, 10, 140, 205, 247, 289], "sporothrix": [0, 10, 140, 205, 247, 289], "schenckii": [0, 10, 140, 205, 247, 289], "tolypocladium": [0, 10, 140, 205, 247, 289], "inflatum": [0, 10, 140, 205, 247, 289], "cactorum": [0, 10, 140, 205, 247, 289], "emarginata": [0, 10, 140, 205, 247, 289], "ficusphila": [0, 10, 140, 205, 247, 289], "kikkawai": [0, 10, 140, 205, 247, 289], "neocordata": [0, 10, 140, 205, 247, 289], "prosaltan": [0, 10, 140, 205, 247, 289], "sturtevanti": [0, 10, 140, 205, 247, 289], "meru": [0, 10, 140, 205, 247, 289], "stephensi": [0, 10, 140, 205, 247, 289], "bombu": [0, 10, 140, 205, 247, 289], "terrestri": [0, 10, 140, 205, 247, 289], "opisthocomu": [0, 10, 140, 205, 247, 289], "hoazin": [0, 10, 140, 205, 247, 289], "fulmaru": [0, 10, 140, 205, 247, 289], "glaciali": [0, 10, 140, 205, 247, 289], "tinamu": [0, 10, 140, 205, 247, 289], "remanei": [0, 10, 140, 205, 247, 289], "perkinsu": [0, 10, 140, 205, 247, 289], "50983": [0, 10, 140, 205, 247, 289], "enterocytozoon": [0, 10, 140, 205, 247, 289], "bieneusi": [0, 10, 140, 205, 247, 289], "h348": [0, 10, 140, 205, 247, 289], "graminicola": [0, 10, 140, 205, 247, 289], "m1": [0, 10, 140, 205, 247, 289], "001": [0, 10, 140, 205, 247, 289], "caldicellulosiruptor": [0, 10, 140, 205, 247, 289], "bescii": [0, 10, 140, 205, 247, 289], "6725": [0, 10, 140, 205, 247, 289], "halothermothrix": [0, 10, 140, 205, 247, 289], "orenii": [0, 10, 140, 205, 247, 289], "40040": [0, 10, 140, 205, 247, 289], "9412": [0, 10, 140, 205, 247, 289], "lurida": [0, 10, 140, 205, 247, 289], "2430": [0, 10, 140, 205, 247, 289], "absiella": [0, 10, 140, 205, 247, 289], "dolichum": [0, 10, 140, 205, 247, 289], "3991": [0, 10, 140, 205, 247, 289], "eggerthia": [0, 10, 140, 205, 247, 289], "catenaformi": [0, 10, 140, 205, 247, 289], "ot": [0, 2, 10, 140, 205, 247, 289], "569": [0, 10, 140, 205, 247, 289], "20559": [0, 10, 140, 205, 247, 289], "methylobacterium": [0, 10, 140, 205, 247, 289], "radiotoleran": [0, 10, 140, 205, 247, 289], "2831": [0, 10, 140, 205, 247, 289], "hepaticu": [0, 10, 140, 205, 247, 289], "51449": [0, 10, 140, 205, 247, 289], "synechococcu": [0, 10, 140, 205, 247, 289], "elongatu": [0, 10, 140, 205, 247, 289], "7002": [0, 10, 140, 205, 247, 289], "wh": [0, 10, 140, 205, 247, 289], "7803": [0, 10, 140, 205, 247, 289], "calothrix": [0, 10, 140, 205, 247, 289], "6303": [0, 10, 140, 205, 247, 289], "7103": [0, 10, 140, 205, 247, 289], "tetranychu": [0, 10, 140, 205, 247, 289], "urtica": [0, 10, 140, 205, 247, 289], "desulfurella": [0, 10, 140, 205, 247, 289], "a63": [0, 10, 140, 205, 247, 289], "winkia": [0, 10, 140, 205, 247, 289], "neuii": [0, 10, 140, 205, 247, 289], "8576": [0, 10, 140, 205, 247, 289], "avidum": [0, 10, 140, 205, 247, 289], "44067": [0, 10, 140, 205, 247, 289], "granulosum": [0, 10, 140, 205, 247, 289], "tm11": [0, 10, 140, 205, 247, 289], "propionimicrobium": [0, 10, 140, 205, 247, 289], "lymphophilum": [0, 10, 140, 205, 247, 289], "093": [0, 10, 140, 205, 247, 289], "sch5": [0, 10, 140, 205, 247, 289], "sporolactobacillu": [0, 10, 140, 205, 247, 289], "laevolacticu": [0, 10, 140, 205, 247, 289], "442": [0, 10, 140, 205, 247, 289], "anaerococcu": [0, 10, 140, 205, 247, 289], "hydrogenali": [0, 10, 140, 205, 247, 289], "7454": [0, 10, 140, 205, 247, 289], "peptoniphilu": [0, 10, 140, 205, 247, 289], "indolicu": [0, 10, 140, 205, 247, 289], "29427": [0, 10, 140, 205, 247, 289], "lacrimali": [0, 10, 140, 205, 247, 289], "315": [0, 10, 140, 205, 247, 289], "lactolyticu": [0, 10, 140, 205, 247, 289], "51172": [0, 10, 140, 205, 247, 289], "parvimona": [0, 10, 140, 205, 247, 289], "micra": [0, 10, 140, 205, 247, 289], "33270": [0, 10, 140, 205, 247, 289], "prevotii": [0, 10, 140, 205, 247, 289], "20548": [0, 10, 140, 205, 247, 289], "producta": [0, 10, 140, 205, 247, 289], "tetradiu": [0, 10, 140, 205, 247, 289], "35098": [0, 10, 140, 205, 247, 289], "51170": [0, 10, 140, 205, 247, 289], "coprococcu": [0, 10, 140, 205, 247, 289], "eutactu": [0, 10, 140, 205, 247, 289], "27759": [0, 10, 140, 205, 247, 289], "doshia": [0, 10, 140, 205, 247, 289], "12862": [0, 10, 140, 205, 247, 289], "700133": [0, 10, 140, 205, 247, 289], "grahamii": [0, 10, 140, 205, 247, 289], "as4aup": [0, 10, 140, 205, 247, 289], "taylorii": [0, 10, 140, 205, 247, 289], "8tbb": [0, 10, 140, 205, 247, 289], "vinsonii": [0, 10, 140, 205, 247, 289], "arupensi": [0, 10, 140, 205, 247, 289], "pm136co": [0, 10, 140, 205, 247, 289], "kinetoplastibacterium": [0, 10, 140, 205, 247, 289], "crithidii": [0, 10, 140, 205, 247, 289], "tcc036e": [0, 10, 140, 205, 247, 289], "caldu": [0, 10, 140, 205, 247, 289], "51756": [0, 10, 140, 205, 247, 289], "7421": [0, 10, 140, 205, 247, 289], "acidobacterium": [0, 10, 140, 205, 247, 289], "51196": [0, 10, 140, 205, 247, 289], "invaden": [0, 10, 140, 205, 247, 289], "ip1": [0, 10, 140, 205, 247, 289], "eremothecium": [0, 10, 140, 205, 247, 289], "10895": [0, 10, 140, 205, 247, 289], "terreu": [0, 10, 140, 205, 247, 289], "uncinocarpu": [0, 10, 140, 205, 247, 289], "reesii": [0, 10, 140, 205, 247, 289], "1704": [0, 10, 140, 205, 247, 289], "purpureocillium": [0, 10, 140, 205, 247, 289], "lilacinum": [0, 10, 140, 205, 247, 289], "coriobacterium": [0, 10, 140, 205, 247, 289], "glomeran": [0, 10, 140, 205, 247, 289], "pw2": [0, 10, 140, 205, 247, 289], "catenuloplan": [0, 10, 140, 205, 247, 289], "s18": [0, 10, 140, 205, 247, 289], "galbu": [0, 10, 140, 205, 247, 289], "avermitili": [0, 10, 140, 205, 247, 289], "4680": [0, 10, 140, 205, 247, 289], "14893": [0, 10, 140, 205, 247, 289], "mortiv": [0, 10, 140, 205, 247, 289], "44261": [0, 10, 140, 205, 247, 289], "u32": [0, 10, 140, 205, 247, 289], "anoxybacillu": [0, 10, 140, 205, 247, 289], "flavithermu": [0, 10, 140, 205, 247, 289], "yunnanensi": [0, 10, 140, 205, 247, 289], "e13": [0, 10, 140, 205, 247, 289], "thermodenitrifican": [0, 10, 140, 205, 247, 289], "ng80": [0, 10, 140, 205, 247, 289], "thermoleovoran": [0, 10, 140, 205, 247, 289], "ccb_us3_uf5": [0, 10, 140, 205, 247, 289], "kyrpidia": [0, 10, 140, 205, 247, 289], "tuscia": [0, 10, 140, 205, 247, 289], "2912": [0, 10, 140, 205, 247, 289], "14025": [0, 10, 140, 205, 247, 289], "acetobacterium": [0, 10, 140, 205, 247, 289], "woodii": [0, 10, 140, 205, 247, 289], "1030": [0, 10, 140, 205, 247, 289], "johnsonii": [0, 10, 140, 205, 247, 289], "ncc": [0, 10, 140, 205, 247, 289], "533": [0, 10, 140, 205, 247, 289], "citreum": [0, 10, 140, 205, 247, 289], "km20": [0, 10, 140, 205, 247, 289], "pseudomesenteroid": [0, 10, 140, 205, 247, 289], "4882": [0, 10, 140, 205, 247, 289], "melissococcu": [0, 10, 140, 205, 247, 289], "plutoniu": [0, 10, 140, 205, 247, 289], "35311": [0, 10, 140, 205, 247, 289], "amblyommati": [0, 10, 140, 205, 247, 289], "gat": [0, 10, 140, 205, 247, 289], "30v": [0, 10, 140, 205, 247, 289], "osu": [0, 10, 140, 205, 247, 289], "85": [0, 10, 140, 165, 166, 168, 205, 247, 289], "389": [0, 10, 140, 205, 247, 289], "montanensi": [0, 10, 140, 205, 247, 289], "930": [0, 10, 140, 205, 247, 289], "rhipicephali": [0, 10, 140, 205, 247, 289], "female6": [0, 10, 140, 205, 247, 289], "cwpp": [0, 10, 140, 205, 247, 289], "helminthoeca": [0, 10, 140, 205, 247, 289], "oregon": [0, 10, 140, 205, 247, 289], "gluconacetobact": [0, 10, 140, 205, 247, 289], "pa1": [0, 10, 140, 205, 247, 289], "aminophilu": [0, 10, 140, 205, 247, 289], "7686": [0, 10, 140, 205, 247, 289], "versutu": [0, 10, 140, 205, 247, 289], "halopraeferen": [0, 10, 140, 205, 247, 289], "3675": [0, 10, 140, 205, 247, 289], "centenum": [0, 10, 140, 205, 247, 289], "sw": [0, 10, 140, 172, 205, 217, 247, 258, 289, 302], "liberibact": [0, 10, 140, 205, 247, 289], "asiaticu": [0, 10, 140, 205, 247, 289], "gxpsy": [0, 10, 140, 205, 247, 289], "leptothrix": [0, 10, 140, 205, 247, 289], "cholodnii": [0, 10, 140, 205, 247, 289], "rahnella": [0, 10, 140, 205, 247, 289], "aquatili": [0, 10, 140, 205, 247, 289], "78": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "65": [0, 10, 140, 158, 205, 221, 247, 289], "33071": [0, 10, 140, 205, 247, 289], "variovorax": [0, 10, 140, 205, 247, 289], "110b": [0, 10, 140, 205, 247, 289], "riemerella": [0, 10, 140, 205, 247, 289], "anatipestif": [0, 10, 140, 205, 247, 289], "ra": [0, 10, 140, 205, 247, 289], "gd": [0, 10, 140, 205, 247, 289], "antarcticu": [0, 10, 140, 205, 247, 289], "4by": [0, 10, 140, 205, 247, 289], "phaeoclathratiform": [0, 10, 140, 205, 247, 289], "bu": [0, 10, 140, 205, 247, 289], "sphaerotilu": [0, 10, 140, 205, 247, 289], "natan": [0, 10, 140, 205, 247, 289], "6575": [0, 10, 140, 205, 247, 289], "streptobacillu": [0, 10, 140, 205, 247, 289], "moniliformi": [0, 10, 140, 205, 247, 289], "12112": [0, 10, 140, 205, 247, 289], "lotu": [0, 10, 140, 205, 247, 289], "mixia": [0, 10, 140, 205, 247, 289], "osmunda": [0, 10, 140, 205, 247, 289], "blumeria": [0, 10, 140, 205, 247, 289], "tonsuran": [0, 10, 140, 205, 247, 289], "conidiobolu": [0, 10, 140, 205, 247, 289], "coronatu": [0, 10, 140, 205, 247, 289], "28638": [0, 10, 140, 205, 247, 289], "strongyloid": [0, 10, 140, 205, 247, 289], "mela": [0, 10, 140, 205, 247, 289], "quadriannulatu": [0, 10, 140, 205, 247, 289], "heliconiu": [0, 10, 140, 205, 247, 289], "melpomen": [0, 10, 140, 205, 247, 289], "plesseni": [0, 10, 140, 205, 247, 289], "brl": [0, 10, 140, 205, 247, 289], "brachi": [0, 10, 140, 205, 247, 289], "33089": [0, 10, 140, 205, 247, 289], "nodatum": [0, 10, 140, 205, 247, 289], "33099": [0, 10, 140, 205, 247, 289], "stomoxi": [0, 10, 140, 205, 247, 289], "calcitran": [0, 10, 140, 205, 247, 289], "griseoflavu": [0, 10, 140, 205, 247, 289], "tu4000": [0, 10, 140, 205, 247, 289], "mobaraensi": [0, 10, 140, 205, 247, 289], "13819": [0, 10, 140, 205, 247, 289], "40847": [0, 10, 140, 205, 247, 289], "oculi": [0, 10, 140, 205, 247, 289], "heliobacterium": [0, 10, 140, 205, 247, 289], "modesticaldum": [0, 10, 140, 205, 247, 289], "ice1": [0, 10, 140, 205, 247, 289], "amalonaticu": [0, 10, 140, 205, 247, 289], "festuca": [0, 10, 140, 205, 247, 289], "macrophomina": [0, 10, 140, 205, 247, 289], "phaseolina": [0, 10, 140, 205, 247, 289], "ms6": [0, 10, 140, 205, 247, 289], "sporichthya": [0, 10, 140, 205, 247, 289], "43042": [0, 10, 140, 205, 247, 289], "dactylosporangium": [0, 10, 140, 205, 247, 289], "aurantiacum": [0, 10, 140, 205, 247, 289], "kutscheri": [0, 10, 140, 205, 247, 289], "pilosum": [0, 10, 140, 205, 247, 289], "20521": [0, 10, 140, 205, 247, 289], "choerinum": [0, 10, 140, 205, 247, 289], "peanut": [0, 10, 140, 205, 247, 289], "witch": [0, 10, 140, 205, 247, 289], "broom": [0, 10, 140, 205, 247, 289], "phytoplasma": [0, 10, 140, 205, 247, 289], "ntu2011": [0, 10, 140, 205, 247, 289], "coprothermobact": [0, 10, 140, 205, 247, 289], "5265": [0, 10, 140, 205, 247, 289], "africa": [0, 10, 140, 205, 247, 289], "esf": [0, 10, 140, 205, 247, 289], "helvetica": [0, 10, 140, 205, 247, 289], "c9p9": [0, 10, 140, 205, 247, 289], "yh": [0, 10, 140, 205, 247, 289], "massilia": [0, 10, 140, 205, 247, 289], "azt80": [0, 10, 140, 205, 247, 289], "portsmouth": [0, 10, 140, 205, 247, 289], "sibirica": [0, 10, 140, 205, 247, 289], "246": [0, 10, 140, 205, 247, 289], "slovaca": [0, 10, 140, 205, 247, 289], "as145": [0, 10, 140, 205, 247, 289], "nitrococcu": [0, 10, 140, 205, 247, 289], "231": [0, 10, 140, 205, 247, 289], "briensi": [0, 10, 140, 205, 247, 289], "128": [0, 10, 140, 205, 247, 289], "nitrospina": [0, 10, 140, 205, 247, 289], "211": [0, 10, 140, 165, 205, 247, 289], "rhodovulum": [0, 10, 140, 205, 247, 289], "sulfidophilum": [0, 10, 140, 205, 247, 289], "1374": [0, 10, 140, 205, 247, 289], "holmesii": [0, 10, 140, 205, 247, 289], "51541": [0, 10, 140, 205, 247, 289], "heilmannii": [0, 10, 140, 205, 247, 289], "asb1": [0, 10, 140, 205, 247, 289], "pullorum": [0, 10, 140, 205, 247, 289], "mit": [0, 10, 140, 205, 247, 289], "98": [0, 10, 140, 205, 247, 289], "5489": [0, 10, 140, 205, 247, 289], "pseudobacteroid": [0, 10, 140, 205, 247, 289], "cellulosolven": [0, 10, 140, 205, 247, 289], "35603": [0, 10, 140, 205, 247, 289], "2933": [0, 10, 140, 205, 247, 289], "cd2": [0, 10, 140, 205, 247, 289], "bilophila": [0, 10, 140, 205, 247, 289], "wadsworthia": [0, 10, 140, 205, 247, 289], "49260": [0, 10, 140, 205, 247, 289], "holophaga": [0, 10, 140, 205, 247, 289], "foetida": [0, 10, 140, 205, 247, 289], "6591": [0, 10, 140, 205, 247, 289], "thermoamylovoran": [0, 10, 140, 205, 247, 289], "ipomoea": [0, 10, 140, 205, 247, 289], "triloba": [0, 10, 140, 205, 247, 289], "fabianii": [0, 10, 140, 205, 247, 289], "vanderwaltozyma": [0, 10, 140, 205, 247, 289], "polyspora": [0, 10, 140, 205, 247, 289], "70294": [0, 10, 140, 205, 247, 289], "poae": [0, 10, 140, 205, 247, 289], "cantharellu": [0, 10, 140, 205, 247, 289], "cibariu": [0, 10, 140, 205, 247, 289], "ganoderma": [0, 10, 140, 205, 247, 289], "sinens": [0, 10, 140, 205, 247, 289], "zz0214": [0, 10, 140, 205, 247, 289], "mucor": [0, 10, 140, 205, 247, 289], "circinelloid": [0, 10, 140, 205, 247, 289], "megaselia": [0, 10, 140, 205, 247, 289], "scalari": [0, 10, 140, 205, 247, 289], "pelecanu": [0, 10, 140, 205, 247, 289], "oval": [0, 10, 140, 205, 247, 289], "curtisi": [0, 10, 140, 205, 247, 289], "globisporangium": [0, 10, 140, 205, 247, 289], "irregular": [0, 10, 140, 205, 247, 289], "181": [0, 10, 140, 169, 205, 247, 289], "coprophilum": [0, 10, 140, 205, 247, 289], "digitatum": [0, 10, 140, 205, 247, 289], "dermabact": [0, 10, 140, 205, 247, 289], "1368": [0, 10, 140, 205, 247, 289], "saccharoperbutylacetonicum": [0, 10, 140, 205, 247, 289], "hmt": [0, 10, 140, 205, 247, 289], "cichorii": [0, 10, 140, 205, 247, 289], "jbc1": [0, 10, 140, 205, 247, 289], "abscessu": [0, 10, 140, 205, 247, 289], "genavens": [0, 10, 140, 205, 247, 289], "51234": [0, 10, 140, 205, 247, 289], "rhodesia": [0, 10, 140, 205, 247, 289], "js60": [0, 10, 140, 205, 247, 289], "aichiensi": [0, 10, 140, 205, 247, 289], "108223": [0, 10, 140, 205, 247, 289], "amara": [0, 10, 140, 205, 247, 289], "15530": [0, 10, 140, 205, 247, 289], "sputi": [0, 10, 140, 205, 247, 289], "100414": [0, 10, 140, 205, 247, 289], "celatum": [0, 10, 140, 205, 247, 289], "1785": [0, 10, 140, 205, 247, 289], "intestinal": [0, 10, 140, 205, 247, 289], "urnw": [0, 10, 140, 205, 247, 289], "desulfitobacterium": [0, 10, 140, 205, 247, 289], "dehalogenan": [0, 10, 140, 205, 247, 289], "51507": [0, 10, 140, 205, 247, 289], "23365": [0, 10, 140, 205, 247, 289], "12475": [0, 10, 140, 205, 247, 289], "paraburkholderia": [0, 10, 140, 205, 247, 289], "xenovoran": [0, 10, 140, 205, 247, 289], "lb400": [0, 10, 140, 205, 247, 289], "cangingivali": [0, 10, 140, 205, 247, 289], "canori": [0, 10, 140, 205, 247, 289], "clavispora": [0, 10, 140, 205, 247, 289], "lusitania": [0, 10, 140, 205, 247, 289], "lodderomyc": [0, 10, 140, 205, 247, 289], "elongisporu": [0, 10, 140, 205, 247, 289], "brevipalpi": [0, 10, 140, 205, 247, 289], "gavia": [0, 10, 140, 205, 247, 289], "stellata": [0, 10, 140, 205, 247, 289], "700358": [0, 10, 140, 205, 247, 289], "brevicatena": [0, 10, 140, 205, 247, 289], "12119": [0, 10, 140, 205, 247, 289], "carnea": [0, 10, 140, 205, 247, 289], "14403": [0, 10, 140, 205, 247, 289], "farcinica": [0, 10, 140, 205, 247, 289], "ifm": [0, 10, 140, 205, 247, 289], "10152": [0, 10, 140, 205, 247, 289], "nova": [0, 10, 140, 205, 247, 289], "sh22a": [0, 10, 140, 205, 247, 289], "transvalensi": [0, 10, 140, 205, 247, 289], "15921": [0, 10, 140, 205, 247, 289], "plasmodiophora": [0, 10, 140, 205, 247, 289], "bili": [0, 10, 140, 205, 247, 289], "43879": [0, 10, 140, 205, 247, 289], "pisolithu": [0, 10, 140, 205, 247, 289], "tinctoriu": [0, 10, 140, 205, 247, 289], "marx": [0, 10, 140, 205, 247, 289], "270": [0, 10, 140, 205, 247, 289], "laceyella": [0, 10, 140, 205, 247, 289], "sacchari": [0, 10, 140, 205, 247, 289], "marichromatium": [0, 10, 140, 205, 247, 289], "purpuratum": [0, 10, 140, 205, 247, 289], "984": [0, 10, 140, 205, 247, 289], "scotoductu": [0, 10, 140, 205, 247, 289], "sa": [0, 10, 140, 205, 247, 289], "octopu": [0, 10, 140, 205, 247, 289], "bimaculoid": [0, 10, 140, 205, 247, 289], "algidicarni": [0, 10, 140, 205, 247, 289], "aegilop": [0, 10, 140, 205, 247, 289], "tauschii": [0, 10, 140, 205, 247, 289], "mali": [0, 10, 140, 205, 247, 289], "AT": [0, 10, 140, 205, 247, 289], "marneffei": [0, 10, 140, 205, 247, 289], "18224": [0, 10, 140, 205, 247, 289], "casseliflavu": [0, 10, 140, 205, 247, 289], "ec20": [0, 10, 140, 205, 247, 289], "gattii": [0, 10, 140, 205, 247, 289], "ejb2": [0, 10, 140, 205, 247, 289], "heterorhabd": [0, 10, 140, 205, 247, 289], "bacteriophora": [0, 10, 140, 205, 247, 289], "rhytidhysteron": [0, 10, 140, 205, 247, 289], "rufulum": [0, 10, 140, 205, 247, 289], "opacu": [0, 10, 140, 205, 247, 289], "sicilia": [0, 10, 140, 205, 247, 289], "c2j": [0, 10, 140, 205, 247, 289], "chaetomium": [0, 10, 140, 205, 247, 289], "rhynchosporium": [0, 10, 140, 205, 247, 289], "secali": [0, 10, 140, 205, 247, 289], "accolen": [0, 10, 140, 205, 247, 289], "49725": [0, 10, 140, 205, 247, 289], "33030": [0, 10, 140, 205, 247, 289], "jeikeium": [0, 10, 140, 205, 247, 289], "k411": [0, 10, 140, 205, 247, 289], "damsela": [0, 10, 140, 205, 247, 289], "102761": [0, 10, 140, 205, 247, 289], "pristinaespirali": [0, 10, 140, 205, 247, 289], "25486": [0, 10, 140, 205, 247, 289], "pseudogenitalium": [0, 10, 140, 205, 247, 289], "33035": [0, 10, 140, 205, 247, 289], "vitaerumini": [0, 10, 140, 205, 247, 289], "20294": [0, 10, 140, 205, 247, 289], "frateurii": [0, 10, 140, 205, 247, 289], "103465": [0, 10, 140, 205, 247, 289], "rhodnii": [0, 10, 140, 205, 247, 289], "5362": [0, 10, 140, 205, 247, 289], "alga": [0, 10, 140, 205, 247, 289], "14758": [0, 10, 140, 205, 247, 289], "hensela": [0, 10, 140, 205, 247, 289], "houston": [0, 10, 140, 205, 247, 289], "tonsillarum": [0, 10, 140, 205, 247, 289], "14972": [0, 10, 140, 205, 247, 289], "eragrosti": [0, 10, 140, 205, 247, 289], "curvula": [0, 10, 140, 205, 247, 289], "panicum": [0, 10, 140, 205, 247, 289], "virgatum": [0, 10, 140, 205, 247, 289], "neolentinu": [0, 10, 140, 205, 247, 289], "lepideu": [0, 10, 140, 205, 247, 289], "hhb14362": [0, 10, 140, 205, 247, 289], "ss": [0, 10, 140, 205, 247, 289], "micromona": [0, 10, 140, 205, 247, 289], "pusilla": [0, 10, 140, 205, 247, 289], "fraxinu": [0, 10, 140, 205, 247, 289], "excelsior": [0, 10, 140, 205, 247, 289], "palma": [0, 10, 140, 205, 247, 289], "j233": [0, 10, 140, 205, 247, 289], "maripaludi": [0, 10, 140, 205, 247, 289], "c6": [0, 10, 140, 205, 247, 289], "tuber": [0, 10, 140, 205, 247, 289], "melanosporum": [0, 10, 140, 205, 247, 289], "mel28": [0, 10, 140, 205, 247, 289], "faecalitalea": [0, 10, 140, 205, 247, 289], "cylindroid": [0, 10, 140, 205, 247, 289], "27803": [0, 10, 140, 205, 247, 289], "agathobaculum": [0, 10, 140, 205, 247, 289], "desmolan": [0, 10, 140, 205, 247, 289], "43058": [0, 10, 140, 205, 247, 289], "dorea": [0, 10, 140, 205, 247, 289], "formicigeneran": [0, 10, 140, 205, 247, 289], "4_6_53afaa": [0, 10, 140, 205, 247, 289], "anaerobutyricum": [0, 10, 140, 205, 247, 289], "hallii": [0, 10, 140, 205, 247, 289], "3353": [0, 10, 140, 205, 247, 289], "ramulu": [0, 10, 140, 205, 247, 289], "29099": [0, 10, 140, 205, 247, 289], "ventriosum": [0, 10, 140, 205, 247, 289], "27560": [0, 10, 140, 205, 247, 289], "xylanophilum": [0, 10, 140, 205, 247, 289], "35991": [0, 10, 140, 205, 247, 289], "ciceri": [0, 10, 140, 205, 247, 289], "biserrula": [0, 10, 140, 205, 247, 289], "wsm1271": [0, 10, 140, 205, 247, 289], "cellvibrio": [0, 10, 140, 205, 247, 289], "mixtu": [0, 10, 140, 205, 247, 289], "j3": [0, 10, 140, 205, 247, 289], "methanosalsum": [0, 10, 140, 205, 247, 289], "zhilina": [0, 10, 140, 205, 247, 289], "4017": [0, 10, 140, 205, 247, 289], "mayetiola": [0, 10, 140, 205, 247, 289], "destructor": [0, 10, 140, 205, 247, 289], "hydrogenovibrio": [0, 10, 140, 205, 247, 289], "crunogenu": [0, 10, 140, 205, 247, 289], "xcl": [0, 10, 140, 205, 247, 289], "sulfurimona": [0, 10, 140, 205, 247, 289], "1251": [0, 10, 140, 205, 247, 289], "blattabacterium": [0, 10, 140, 205, 247, 289], "mastoterm": [0, 10, 140, 205, 247, 289], "darwiniensi": [0, 10, 140, 205, 247, 289], "madar": [0, 10, 140, 205, 247, 289], "methylomicrobium": [0, 10, 140, 205, 247, 289], "album": [0, 10, 140, 205, 247, 289], "bg8": [0, 10, 140, 205, 247, 289], "atypica": [0, 10, 140, 205, 247, 289], "kon": [0, 10, 140, 205, 247, 289], "dispar": [0, 10, 140, 205, 247, 289], "17748": [0, 10, 140, 205, 247, 289], "glucuronolyticum": [0, 10, 140, 205, 247, 289], "51867": [0, 10, 140, 205, 247, 289], "htcc2594": [0, 10, 140, 205, 247, 289], "moravica": [0, 10, 140, 205, 247, 289], "19234": [0, 10, 140, 205, 247, 289], "hypsizygu": [0, 10, 140, 205, 247, 289], "marmoreu": [0, 10, 140, 205, 247, 289], "helcococcu": [0, 10, 140, 205, 247, 289], "kunzii": [0, 10, 140, 205, 247, 289], "51366": [0, 10, 140, 205, 247, 289], "victoria": [0, 10, 140, 205, 247, 289], "fi3": [0, 10, 140, 205, 247, 289], "tetrasperma": [0, 10, 140, 205, 247, 289], "oligotropha": [0, 10, 140, 205, 247, 289], "carboxidovoran": [0, 10, 140, 205, 247, 289], "om5": [0, 10, 140, 205, 247, 289], "glumipatula": [0, 10, 140, 205, 247, 289], "meridionali": [0, 10, 140, 205, 247, 289], "avenaceum": [0, 10, 140, 205, 247, 289], "sh046": [0, 10, 140, 205, 247, 289], "junii": [0, 10, 140, 205, 247, 289], "radioresisten": [0, 10, 140, 205, 247, 289], "sh164": [0, 10, 140, 205, 247, 289], "lfi1238": [0, 10, 140, 205, 247, 289], "italicum": [0, 10, 140, 205, 247, 289], "cerana": [0, 10, 140, 205, 247, 289], "brl01": [0, 10, 140, 205, 247, 289], "stenotrophomona": [0, 10, 140, 205, 247, 289], "maltophilia": [0, 10, 140, 205, 247, 289], "k279a": [0, 10, 140, 205, 247, 289], "fonsecaea": [0, 10, 140, 205, 247, 289], "pedrosoi": [0, 10, 140, 205, 247, 289], "37": [0, 10, 140, 205, 247, 289, 324, 325], "a165": [0, 10, 140, 205, 247, 289], "daedalea": [0, 10, 140, 205, 247, 289], "quercina": [0, 10, 140, 205, 247, 289], "l": [0, 5, 9, 10, 65, 66, 140, 205, 247, 289], "15889": [0, 10, 140, 205, 247, 289], "fistulina": [0, 10, 140, 205, 247, 289], "hepatica": [0, 10, 140, 205, 247, 289], "64428": [0, 10, 140, 205, 247, 289], "fomitopsi": [0, 10, 140, 205, 247, 289], "pinicola": [0, 10, 140, 205, 247, 289], "stereum": [0, 10, 140, 205, 247, 289], "bromii": [0, 10, 140, 205, 247, 289], "l2": [0, 10, 140, 166, 167, 169, 205, 247, 289, 324, 325], "63": [0, 10, 140, 165, 205, 247, 289], "callidu": [0, 10, 140, 205, 247, 289], "27760": [0, 10, 140, 205, 247, 289], "obeum": [0, 10, 140, 205, 247, 289], "29174": [0, 10, 140, 205, 247, 289], "leptotrichia": [0, 10, 140, 205, 247, 289], "1013": [0, 10, 140, 205, 247, 289], "sutterella": [0, 10, 140, 205, 247, 289], "wadsworthensi": [0, 10, 140, 205, 247, 289], "hga0223": [0, 10, 140, 205, 247, 289], "botryti": [0, 10, 140, 205, 247, 289], "sporobolomyc": [0, 10, 140, 205, 247, 289], "roseu": [0, 10, 140, 205, 247, 289], "13481": [0, 10, 140, 205, 247, 289], "actinosynnema": [0, 10, 140, 205, 247, 289], "43827": [0, 10, 140, 205, 247, 289], "lentzea": [0, 10, 140, 205, 247, 289], "albidocapillata": [0, 10, 140, 205, 247, 289], "bovienii": [0, 10, 140, 205, 247, 289], "2004": [0, 10, 140, 205, 247, 289], "poinarii": [0, 10, 140, 205, 247, 289], "g6": [0, 10, 140, 205, 247, 289], "paspali": [0, 10, 140, 205, 247, 289], "balansia": [0, 10, 140, 205, 247, 289], "obtecta": [0, 10, 140, 205, 247, 289], "thioploca": [0, 10, 140, 205, 247, 289], "ingrica": [0, 10, 140, 205, 247, 289], "duttonii": [0, 10, 140, 205, 247, 289], "ly": [0, 10, 140, 205, 247, 289], "rhopalosiphum": [0, 10, 140, 205, 247, 289], "padi": [0, 10, 140, 205, 247, 289], "azurea": [0, 10, 140, 205, 247, 289], "szmc": [0, 10, 140, 205, 247, 289], "14600": [0, 10, 140, 205, 247, 289], "cyanea": [0, 10, 140, 205, 247, 289], "na": [0, 10, 140, 205, 247, 289], "134": [0, 10, 140, 166, 169, 205, 247, 289], "k62": [0, 10, 140, 205, 247, 289], "carbonariu": [0, 10, 140, 205, 247, 289], "item": [0, 2, 10, 140, 205, 247, 289, 325], "5010": [0, 10, 140, 205, 247, 289], "elsino": [0, 10, 140, 205, 247, 289], "penicilliopsi": [0, 10, 140, 205, 247, 289], "zonata": [0, 10, 140, 205, 247, 289], "ewingella": [0, 10, 140, 205, 247, 289], "33852": [0, 10, 140, 205, 247, 289], "atroparvu": [0, 10, 140, 205, 247, 289], "lomentospora": [0, 10, 140, 205, 247, 289], "prolifican": [0, 10, 140, 205, 247, 289], "bathycoccu": [0, 10, 140, 205, 247, 289], "prasino": [0, 10, 140, 205, 247, 289], "microthrix": [0, 10, 140, 205, 247, 289], "parvicella": [0, 10, 140, 205, 247, 289], "rn1": [0, 10, 140, 205, 247, 289], "amanita": [0, 10, 140, 205, 247, 289], "muscaria": [0, 10, 140, 205, 247, 289], "koid": [0, 10, 140, 205, 247, 289], "bx008": [0, 10, 140, 205, 247, 289], "catonia": [0, 10, 140, 205, 247, 289], "f0037": [0, 10, 140, 205, 247, 289], "saccharolyticu": [0, 10, 140, 205, 247, 289], "43076": [0, 10, 140, 205, 247, 289], "bipectinata": [0, 10, 140, 205, 247, 289], "jirovecii": [0, 10, 140, 205, 247, 289], "se8": [0, 10, 140, 205, 247, 289], "diversum": [0, 10, 140, 205, 247, 289], "acidiscabi": [0, 10, 140, 205, 247, 289], "84": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "104": [0, 10, 140, 205, 247, 289], "magnatum": [0, 10, 140, 205, 247, 289], "borchii": [0, 10, 140, 205, 247, 289], "hi1": [0, 10, 140, 205, 247, 289], "rubrobact": [0, 10, 140, 205, 247, 289], "phoenix": [0, 10, 140, 205, 247, 289], "dactylifera": [0, 10, 140, 205, 247, 289], "aciculosporium": [0, 10, 140, 205, 247, 289], "maff": [0, 10, 140, 205, 247, 289], "241224": [0, 10, 140, 205, 247, 289], "dubliniensi": [0, 10, 140, 205, 247, 289], "vittaforma": [0, 10, 140, 205, 247, 289], "50505": [0, 10, 140, 205, 247, 289], "halobacteroid": [0, 10, 140, 205, 247, 289], "halobiu": [0, 10, 140, 205, 247, 289], "5150": [0, 10, 140, 205, 247, 289], "149": [0, 10, 140, 205, 247, 289], "lichtheimia": [0, 10, 140, 205, 247, 289], "corymbifera": [0, 10, 140, 205, 247, 289], "desulfofundulu": [0, 10, 140, 205, 247, 289], "thermocisternu": [0, 10, 140, 205, 247, 289], "10259": [0, 10, 140, 205, 247, 289], "salina": [0, 10, 140, 205, 247, 289], "collinu": [0, 10, 140, 205, 247, 289], "tu": [0, 10, 140, 205, 247, 289], "365": [0, 10, 140, 159, 171, 205, 211, 216, 247, 253, 257, 289, 296, 301, 324, 325], "gelatoporia": [0, 10, 140, 205, 247, 289], "subvermispora": [0, 10, 140, 205, 247, 289], "amarillan": [0, 10, 140, 205, 247, 289], "e57": [0, 10, 140, 205, 247, 289], "argentoratens": [0, 10, 140, 205, 247, 289], "44202": [0, 10, 140, 205, 247, 289], "ammonifex": [0, 10, 140, 205, 247, 289], "degensii": [0, 10, 140, 205, 247, 289], "kc4": [0, 10, 140, 205, 247, 289], "lentu": [0, 10, 140, 205, 247, 289], "f1142": [0, 10, 140, 205, 247, 289], "urrwxcal2": [0, 10, 140, 205, 247, 289], "nankai": [0, 10, 140, 205, 247, 289], "christyi": [0, 10, 140, 205, 247, 289], "rey15a": [0, 10, 140, 205, 247, 289], "maidi": [0, 10, 140, 205, 247, 289], "darlingi": [0, 10, 140, 205, 247, 289], "capronia": [0, 10, 140, 205, 247, 289], "epimyc": [0, 10, 140, 205, 247, 289], "14159": [0, 10, 140, 205, 247, 289], "proteoclasticu": [0, 10, 140, 205, 247, 289], "p6b7": [0, 10, 140, 205, 247, 289], "prauserella": [0, 10, 140, 205, 247, 289], "kutzneria": [0, 10, 140, 205, 247, 289], "albida": [0, 10, 140, 205, 247, 289], "43870": [0, 10, 140, 205, 247, 289], "cathart": [0, 10, 140, 205, 247, 289], "aura": [0, 10, 140, 205, 247, 289], "6643": [0, 10, 140, 205, 247, 289], "citrea": [0, 10, 140, 205, 247, 289], "8771": [0, 10, 140, 205, 247, 289], "luteoviolacea": [0, 10, 140, 205, 247, 289], "29581": [0, 10, 140, 205, 247, 289], "rubra": [0, 10, 140, 205, 247, 289], "6842": [0, 10, 140, 205, 247, 289], "aurescen": [0, 10, 140, 205, 247, 289], "tc1": [0, 10, 140, 205, 247, 289], "brachybacterium": [0, 10, 140, 205, 247, 289], "4810": [0, 10, 140, 205, 247, 289], "jonesia": [0, 10, 140, 205, 247, 289], "20603": [0, 10, 140, 205, 247, 289], "mucilaginosa": [0, 10, 140, 205, 247, 289], "dy": [0, 10, 140, 205, 247, 289], "metallosphaera": [0, 10, 140, 205, 247, 289], "sedula": [0, 10, 140, 205, 247, 289], "5348": [0, 10, 140, 205, 247, 289], "wedmorensi": [0, 10, 140, 205, 247, 289], "amycolatum": [0, 10, 140, 205, 247, 289], "sk46": [0, 10, 140, 205, 247, 289], "hoagii": [0, 10, 140, 205, 247, 289], "matruchotii": [0, 10, 140, 205, 247, 289], "14266": [0, 10, 140, 205, 247, 289], "propinquum": [0, 10, 140, 205, 247, 289], "44285": [0, 10, 140, 205, 247, 289], "striatum": [0, 10, 140, 205, 247, 289], "6940": [0, 10, 140, 205, 247, 289], "7109": [0, 10, 140, 205, 247, 289], "tolumona": [0, 10, 140, 205, 247, 289], "auensi": [0, 10, 140, 205, 247, 289], "9187": [0, 10, 140, 205, 247, 289], "johnsonella": [0, 10, 140, 205, 247, 289], "ignava": [0, 10, 140, 205, 247, 289], "51276": [0, 10, 140, 205, 247, 289], "catonella": [0, 10, 140, 205, 247, 289], "morbi": [0, 10, 140, 205, 247, 289], "51271": [0, 10, 140, 205, 247, 289], "8903": [0, 10, 140, 205, 247, 289], "cecorum": [0, 10, 140, 205, 247, 289], "20682": [0, 10, 140, 205, 247, 289], "43198": [0, 10, 140, 205, 247, 289], "51266": [0, 10, 140, 205, 247, 289], "ferrimona": [0, 10, 140, 205, 247, 289], "balearica": [0, 10, 140, 205, 247, 289], "9799": [0, 10, 140, 205, 247, 289], "aureococcu": [0, 10, 140, 205, 247, 289], "anophagefferen": [0, 10, 140, 205, 247, 289], "megasporu": [0, 10, 140, 205, 247, 289], "trichomonascu": [0, 10, 140, 205, 247, 289], "ciferrii": [0, 10, 140, 205, 247, 289], "duru": [0, 10, 140, 205, 247, 289], "maceran": [0, 10, 140, 205, 247, 289], "oligotrophicum": [0, 10, 140, 205, 247, 289], "s58": [0, 10, 140, 205, 247, 289], "caldanaerobiu": [0, 10, 140, 205, 247, 289], "polysaccharolyticu": [0, 10, 140, 205, 247, 289], "13641": [0, 10, 140, 205, 247, 289], "no12": [0, 10, 140, 205, 247, 289], "recurrenti": [0, 10, 140, 205, 247, 289], "a1": [0, 10, 140, 205, 247, 289], "amylolyticu": [0, 10, 140, 205, 247, 289], "10524": [0, 10, 140, 205, 247, 289], "cryotoleran": [0, 10, 140, 205, 247, 289], "49181": [0, 10, 140, 205, 247, 289], "sulfurospirillum": [0, 10, 140, 205, 247, 289], "barnesii": [0, 10, 140, 205, 247, 289], "se": [0, 10, 140, 205, 247, 289], "geothrix": [0, 10, 140, 205, 247, 289], "14018": [0, 10, 140, 205, 247, 289], "natronobacterium": [0, 10, 140, 205, 247, 289], "gregoryi": [0, 10, 140, 205, 247, 289], "sp2": [0, 10, 140, 205, 247, 289], "fairfieldensi": [0, 10, 140, 205, 247, 289], "49588": [0, 10, 140, 205, 247, 289], "lansingensi": [0, 10, 140, 205, 247, 289], "19556": [0, 10, 140, 205, 247, 289], "49751": [0, 10, 140, 205, 247, 289], "shakespearei": [0, 10, 140, 205, 247, 289], "23087": [0, 10, 140, 205, 247, 289], "sorokiniana": [0, 10, 140, 205, 247, 289], "pyrenophora": [0, 10, 140, 205, 247, 289], "repenti": [0, 10, 140, 205, 247, 289], "1c": [0, 10, 140, 205, 247, 289], "bfp": [0, 10, 140, 205, 247, 289], "cyanidioschyzon": [0, 10, 140, 205, 247, 289], "merola": [0, 10, 140, 205, 247, 289], "capitatum": [0, 10, 140, 205, 247, 289], "granulosa": [0, 10, 140, 205, 247, 289], "51502": [0, 10, 140, 205, 247, 289], "leucothrix": [0, 10, 140, 205, 247, 289], "2157": [0, 10, 140, 169, 205, 247, 289], "cymbalaria": [0, 10, 140, 205, 247, 289], "sinecaudum": [0, 10, 140, 205, 247, 289], "conjunctiva": [0, 10, 140, 205, 247, 289], "hrc": [0, 10, 140, 205, 247, 289], "581": [0, 10, 140, 205, 247, 289], "bovoculi": [0, 10, 140, 205, 247, 289], "m165": [0, 10, 140, 205, 247, 289], "alkalescen": [0, 10, 140, 205, 247, 289], "14918": [0, 10, 140, 205, 247, 289], "borstelensi": [0, 10, 140, 205, 247, 289], "3096": [0, 10, 140, 205, 247, 289], "wickerhamiella": [0, 10, 140, 205, 247, 289], "sorbophila": [0, 10, 140, 205, 247, 289], "babjeviella": [0, 10, 140, 205, 247, 289], "inositovora": [0, 10, 140, 205, 247, 289], "12698": [0, 10, 140, 205, 247, 289], "AS": [0, 10, 140, 205, 247, 289], "3089": [0, 10, 140, 205, 247, 289], "scophthalmi": [0, 10, 140, 205, 247, 289], "19158": [0, 10, 140, 205, 247, 289], "desulfohalobium": [0, 10, 140, 205, 247, 289], "retbaens": [0, 10, 140, 205, 247, 289], "5692": [0, 10, 140, 205, 247, 289], "nadsonia": [0, 10, 140, 205, 247, 289], "fulvescen": [0, 10, 140, 205, 247, 289], "crossotu": [0, 10, 140, 205, 247, 289], "2876": [0, 10, 140, 205, 247, 289], "pasteuri": [0, 10, 140, 205, 247, 289], "sp1": [0, 10, 140, 205, 247, 289], "granulicatella": [0, 10, 140, 205, 247, 289], "adiacen": [0, 10, 140, 205, 247, 289], "49175": [0, 10, 140, 205, 247, 289], "abiotrophia": [0, 10, 140, 205, 247, 289], "defectiva": [0, 10, 140, 205, 247, 289], "49176": [0, 10, 140, 205, 247, 289], "chromogen": [0, 10, 140, 205, 247, 289], "970": [0, 10, 140, 205, 247, 289], "pseudobutyrivibrio": [0, 10, 140, 205, 247, 289], "cf1b": [0, 10, 140, 205, 247, 289], "hellenica": [0, 10, 140, 205, 247, 289], "avellana": [0, 10, 140, 205, 247, 289], "bpic": [0, 10, 140, 205, 247, 289], "631": [0, 10, 140, 205, 247, 289], "hassiacum": [0, 10, 140, 205, 247, 289], "44199": [0, 10, 140, 205, 247, 289], "wiegelii": [0, 10, 140, 205, 247, 289], "rt8": [0, 10, 140, 205, 247, 289], "8902": [0, 10, 140, 205, 247, 289], "chlorophenolicum": [0, 10, 140, 205, 247, 289], "reticulomyxa": [0, 10, 140, 205, 247, 289], "filosa": [0, 10, 140, 205, 247, 289], "orenia": [0, 10, 140, 205, 247, 289], "5156": [0, 10, 140, 205, 247, 289], "merda": [0, 10, 140, 205, 247, 289], "43184": [0, 10, 140, 205, 247, 289], "stercori": [0, 10, 140, 205, 247, 289], "melanesiensi": [0, 10, 140, 205, 247, 289], "bi429": [0, 10, 140, 205, 247, 289], "suhomyc": [0, 10, 140, 205, 247, 289], "tanzawaensi": [0, 10, 140, 205, 247, 289], "melanogenum": [0, 10, 140, 205, 247, 289], "nitroreducen": [0, 10, 140, 205, 247, 289], "hbp1": [0, 10, 140, 205, 247, 289], "cenarchaeum": [0, 10, 140, 205, 247, 289], "symbiosum": [0, 10, 140, 205, 247, 289], "dethiosulfovibrio": [0, 10, 140, 205, 247, 289], "peptidovoran": [0, 10, 140, 205, 247, 289], "11002": [0, 10, 140, 205, 247, 289], "bastinii": [0, 10, 140, 205, 247, 289], "16055": [0, 10, 140, 205, 247, 289], "timona": [0, 10, 140, 205, 247, 289], "45783": [0, 10, 140, 205, 247, 289], "armillaria": [0, 10, 140, 205, 247, 289], "gallica": [0, 10, 140, 205, 247, 289], "ostoya": [0, 10, 140, 205, 247, 289], "miyamotoi": [0, 10, 140, 205, 247, 289], "lb": [0, 10, 140, 205, 247, 289], "peacockii": [0, 10, 140, 205, 247, 289], "rustic": [0, 10, 140, 205, 247, 289], "lautropia": [0, 10, 140, 205, 247, 289], "51599": [0, 10, 140, 205, 247, 289], "cacca": [0, 10, 140, 205, 247, 289], "43185": [0, 10, 140, 205, 247, 289], "alligatori": [0, 10, 140, 205, 247, 289], "a21jp2": [0, 10, 140, 205, 247, 289], "rhamnosu": [0, 10, 140, 205, 247, 289], "gg": [0, 10, 140, 205, 247, 289], "olivaceu": [0, 10, 140, 205, 247, 289], "bibersteinia": [0, 10, 140, 205, 247, 289], "trehalosi": [0, 10, 140, 205, 247, 289], "189": [0, 10, 140, 205, 247, 289], "atkinsonella": [0, 10, 140, 205, 247, 289], "hypoxylon": [0, 10, 140, 205, 247, 289], "40104": [0, 10, 140, 205, 247, 289], "lydicu": [0, 10, 140, 205, 247, 289], "crispatu": [0, 10, 140, 205, 247, 289], "st1": [0, 10, 140, 205, 247, 289], "baconii": [0, 10, 140, 205, 247, 289], "200745": [0, 10, 140, 205, 247, 289], "triplex": [0, 10, 140, 205, 247, 289], "micromonospora": [0, 10, 140, 205, 247, 289], "27029": [0, 10, 140, 205, 247, 289], "amygdali": [0, 10, 140, 205, 247, 289], "301020": [0, 10, 140, 205, 247, 289], "corrugata": [0, 10, 140, 205, 247, 289], "cfbp": [0, 10, 140, 205, 247, 289], "5454": [0, 10, 140, 205, 247, 289], "fulva": [0, 10, 140, 205, 247, 289], "synxantha": [0, 10, 140, 205, 247, 289], "bg33r": [0, 10, 140, 205, 247, 289], "luteola": [0, 10, 140, 205, 247, 289], "xldn4": [0, 10, 140, 205, 247, 289], "fonticola": [0, 10, 140, 205, 247, 289], "au": [0, 10, 140, 205, 247, 289], "ap2c": [0, 10, 140, 205, 247, 289], "cyclitrophicu": [0, 10, 140, 205, 247, 289], "ff75": [0, 10, 140, 205, 247, 289], "hyphomicrobium": [0, 10, 140, 205, 247, 289], "zavarzinii": [0, 10, 140, 205, 247, 289], "27496": [0, 10, 140, 205, 247, 289], "pittii": [0, 10, 140, 205, 247, 289], "phea": [0, 10, 140, 205, 247, 289], "fragaria": [0, 10, 140, 205, 247, 289], "25863": [0, 10, 140, 205, 247, 289], "neolecta": [0, 10, 140, 205, 247, 289], "irregulari": [0, 10, 140, 205, 247, 289], "freii": [0, 10, 140, 205, 247, 289], "orchesella": [0, 10, 140, 205, 247, 289], "cincta": [0, 10, 140, 205, 247, 289], "novosphingobium": [0, 10, 140, 205, 247, 289], "aromaticivoran": [0, 10, 140, 205, 247, 289], "12444": [0, 10, 140, 205, 247, 289], "sporisorium": [0, 10, 140, 205, 247, 289], "scitamineum": [0, 10, 140, 205, 247, 289], "arthromitu": [0, 10, 140, 205, 247, 289], "sfb": [0, 10, 140, 205, 247, 289], "mous": [0, 10, 140, 205, 247, 289], "japan": [0, 10, 140, 205, 247, 289], "kineosporia": [0, 10, 140, 205, 247, 289], "3230": [0, 10, 140, 205, 247, 289], "marinobacterium": [0, 10, 140, 205, 247, 289], "stanieri": [0, 10, 140, 205, 247, 289], "s30": [0, 10, 140, 205, 247, 289], "psychroserpen": [0, 10, 140, 205, 247, 289], "burtonensi": [0, 10, 140, 205, 247, 289], "12212": [0, 10, 140, 205, 247, 289], "xylanophilu": [0, 10, 140, 205, 247, 289], "9941": [0, 10, 140, 205, 247, 289], "hafniens": [0, 10, 140, 205, 247, 289], "y51": [0, 10, 140, 205, 247, 289], "coffea": [0, 10, 140, 205, 247, 289], "canephora": [0, 10, 140, 205, 247, 289], "attenuata": [0, 10, 140, 205, 247, 289], "holospora": [0, 10, 140, 205, 247, 289], "obtusa": [0, 10, 140, 205, 247, 289], "crocodyli": [0, 10, 140, 205, 247, 289], "mp145": [0, 10, 140, 205, 247, 289], "sulla": [0, 10, 140, 205, 247, 289], "wsm1592": [0, 10, 140, 205, 247, 289], "volcanium": [0, 10, 140, 205, 247, 289], "gss1": [0, 10, 140, 205, 247, 289], "charadriu": [0, 10, 140, 205, 247, 289], "vociferu": [0, 10, 140, 205, 247, 289], "pinctada": [0, 10, 140, 205, 247, 289], "fucata": [0, 10, 140, 205, 247, 289], "arabi": [0, 10, 140, 205, 247, 289], "alpina": [0, 10, 140, 205, 247, 289], "trogontum": [0, 10, 140, 205, 247, 289], "minor": [0, 1, 5, 10, 140, 205, 247, 289], "nm305": [0, 10, 140, 205, 247, 289], "saphenum": [0, 10, 140, 205, 247, 289], "49989": [0, 10, 140, 205, 247, 289], "maltophilum": [0, 10, 140, 205, 247, 289], "51939": [0, 10, 140, 205, 247, 289], "ureibacillu": [0, 10, 140, 205, 247, 289], "thermosphaericu": [0, 10, 140, 205, 247, 289], "thermo": [0, 10, 140, 205, 247, 289], "bf": [0, 10, 140, 205, 247, 289], "syntrophobotulu": [0, 10, 140, 205, 247, 289], "glycolicu": [0, 10, 140, 205, 247, 289], "8271": [0, 10, 140, 205, 247, 289], "wigglesworthia": [0, 10, 140, 205, 247, 289], "glossinidia": [0, 10, 140, 205, 247, 289], "endosymbiont": [0, 10, 140, 205, 247, 289], "yale": [0, 10, 140, 205, 247, 289], "coloni": [0, 10, 140, 205, 247, 289], "kluyvera": [0, 10, 140, 205, 247, 289], "ascorbata": [0, 10, 140, 205, 247, 289], "33433": [0, 10, 140, 205, 247, 289], "brunetti": [0, 10, 140, 205, 247, 289], "praecox": [0, 10, 140, 205, 247, 289], "auri": [0, 10, 140, 205, 247, 289], "15026": [0, 10, 140, 205, 247, 289], "yeatsii": [0, 10, 140, 205, 247, 289], "13926": [0, 10, 140, 205, 247, 289], "reesei": [0, 10, 140, 205, 247, 289], "spraguea": [0, 10, 140, 205, 247, 289], "lophii": [0, 10, 140, 205, 247, 289], "42_110": [0, 10, 140, 205, 247, 289], "hispanica": [0, 10, 140, 205, 247, 289], "33960": [0, 10, 140, 205, 247, 289], "dobzhanskii": [0, 10, 140, 205, 247, 289], "2104": [0, 10, 140, 205, 247, 289], "nakaseomyc": [0, 10, 140, 205, 247, 289], "delphensi": [0, 10, 140, 205, 247, 289], "bacillisporu": [0, 10, 140, 205, 247, 289], "tetragenococcu": [0, 10, 140, 205, 247, 289], "12172": [0, 10, 140, 205, 247, 289], "tortispora": [0, 10, 140, 205, 247, 289], "caseinolytica": [0, 10, 140, 205, 247, 289], "silvanu": [0, 10, 140, 205, 247, 289], "9946": [0, 10, 140, 205, 247, 289], "calidithermu": [0, 10, 140, 205, 247, 289], "chliarophilu": [0, 10, 140, 205, 247, 289], "9957": [0, 10, 140, 205, 247, 289], "venetianu": [0, 10, 140, 205, 247, 289], "rag": [0, 10, 140, 205, 247, 289], "110063": [0, 10, 140, 205, 247, 289], "mitsuokella": [0, 10, 140, 205, 247, 289], "multacida": [0, 10, 140, 205, 247, 289], "20544": [0, 10, 140, 205, 247, 289], "dentali": [0, 10, 140, 205, 247, 289], "3688": [0, 10, 140, 205, 247, 289], "10532": [0, 10, 140, 205, 247, 289], "2011": [0, 9, 10, 140, 205, 247, 289, 323, 324, 325], "sarcopt": [0, 10, 140, 205, 247, 289], "inui": [0, 10, 140, 205, 247, 289], "san": [0, 10, 140, 205, 247, 289], "antonio": [0, 10, 140, 205, 247, 289], "pilosicoli": [0, 10, 140, 205, 247, 289], "95": [0, 10, 140, 165, 205, 247, 289], "1000": [0, 10, 140, 145, 148, 205, 247, 289], "erysiph": [0, 10, 140, 205, 247, 289], "necat": [0, 10, 140, 205, 247, 289], "sulfitobact": [0, 10, 140, 205, 247, 289], "ee": [0, 10, 140, 205, 247, 289], "sagittula": [0, 10, 140, 205, 247, 289], "leucocephalu": [0, 10, 140, 205, 247, 289], "alsatica": [0, 10, 140, 205, 247, 289], "ib": [0, 10, 140, 205, 247, 289], "382": [0, 10, 140, 205, 247, 289], "kristjanssonii": [0, 10, 140, 205, 247, 289], "i77r1b": [0, 10, 140, 205, 247, 289], "lactoaceticu": [0, 10, 140, 205, 247, 289], "6a": [0, 10, 140, 205, 247, 289], "georgia": [0, 10, 140, 205, 247, 289], "6843": [0, 10, 140, 205, 247, 289], "desulfonatronovibrio": [0, 10, 140, 205, 247, 289], "hydrogenovoran": [0, 10, 140, 205, 247, 289], "9292": [0, 10, 140, 205, 247, 289], "desulfospira": [0, 10, 140, 205, 247, 289], "joergensenii": [0, 10, 140, 205, 247, 289], "10085": [0, 10, 140, 205, 247, 289], "duran": [0, 10, 140, 205, 247, 289], "6056": [0, 10, 140, 205, 247, 289], "mundtii": [0, 10, 140, 205, 247, 289], "qu": [0, 10, 140, 205, 247, 289], "intrasporangium": [0, 10, 140, 205, 247, 289], "calvum": [0, 10, 140, 205, 247, 289], "43043": [0, 10, 140, 205, 247, 289], "mcbrellneri": [0, 10, 140, 205, 247, 289], "49030": [0, 10, 140, 205, 247, 289], "hamadaea": [0, 10, 140, 205, 247, 289], "tsunoensi": [0, 10, 140, 205, 247, 289], "44101": [0, 10, 140, 205, 247, 289], "1nes1": [0, 10, 140, 205, 247, 289], "coronafacien": [0, 10, 140, 205, 247, 289], "1_6": [0, 10, 140, 205, 247, 289], "resinovoran": [0, 10, 140, 205, 247, 289], "106553": [0, 10, 140, 205, 247, 289], "axonopodi": [0, 10, 140, 205, 247, 289], "vasculorum": [0, 10, 140, 205, 247, 289], "lecithinolyticum": [0, 10, 140, 205, 247, 289], "700332": [0, 10, 140, 205, 247, 289], "socranskii": [0, 10, 140, 205, 247, 289], "dr56br1116": [0, 10, 140, 205, 247, 289], "35536": [0, 10, 140, 205, 247, 289], "thermobrachium": [0, 10, 140, 205, 247, 289], "celer": [0, 10, 140, 205, 247, 289], "8682": [0, 10, 140, 205, 247, 289], "hveragerdens": [0, 10, 140, 205, 247, 289], "12571": [0, 10, 140, 205, 247, 289], "hirsuta": [0, 10, 140, 205, 247, 289], "44140": [0, 10, 140, 205, 247, 289], "16056": [0, 10, 140, 205, 247, 289], "paraluiscuniculi": [0, 10, 140, 205, 247, 289], "2165": [0, 10, 140, 205, 247, 289], "hydrogenotrophica": [0, 10, 140, 205, 247, 289], "10507": [0, 10, 140, 205, 247, 289], "nakamurella": [0, 10, 140, 205, 247, 289], "multipartita": [0, 10, 140, 205, 247, 289], "44233": [0, 10, 140, 205, 247, 289], "mageritens": [0, 10, 140, 205, 247, 289], "44476": [0, 10, 140, 205, 247, 289], "104973": [0, 10, 140, 205, 247, 289], "tere": [0, 10, 140, 205, 247, 289], "sulfobacillu": [0, 10, 140, 205, 247, 289], "tpy": [0, 10, 140, 205, 247, 289], "acidimicrobium": [0, 10, 140, 205, 247, 289], "10331": [0, 10, 140, 205, 247, 289], "valbyensi": [0, 10, 140, 205, 247, 289], "1626": [0, 10, 140, 205, 247, 289], "octadecabact": [0, 10, 140, 205, 247, 289], "arcticu": [0, 10, 140, 205, 247, 289], "238": [0, 10, 140, 205, 247, 289], "horikoshii": [0, 10, 140, 205, 247, 289], "ot3": [0, 10, 140, 205, 247, 289], "harei": [0, 10, 140, 205, 247, 289], "146": [0, 10, 140, 205, 247, 289], "sch2b": [0, 10, 140, 205, 247, 289], "44247": [0, 10, 140, 205, 247, 289], "16224": [0, 10, 140, 205, 247, 289], "zilligii": [0, 10, 140, 205, 247, 289], "an1": [0, 10, 140, 205, 247, 289], "methanolacinia": [0, 10, 140, 205, 247, 289], "petrolearia": [0, 10, 140, 205, 247, 289], "11571": [0, 10, 140, 205, 247, 289], "ascoidea": [0, 10, 140, 205, 247, 289], "rubescen": [0, 10, 140, 205, 247, 289], "1968": [0, 10, 140, 205, 247, 289], "hyperthermu": [0, 10, 140, 205, 247, 289], "butylicu": [0, 10, 140, 205, 247, 289], "5456": [0, 10, 140, 205, 247, 289], "pyrolobu": [0, 10, 140, 205, 247, 289], "fumarii": [0, 10, 140, 205, 247, 289], "1a": [0, 10, 140, 205, 247, 289], "thermosphaera": [0, 10, 140, 205, 247, 289], "aggregan": [0, 10, 140, 205, 247, 289], "11486": [0, 10, 140, 205, 247, 289], "ferroglobu": [0, 10, 140, 205, 247, 289], "placidu": [0, 10, 140, 205, 247, 289], "10642": [0, 10, 140, 205, 247, 289], "raoultella": [0, 10, 140, 205, 247, 289], "ornithinolytica": [0, 10, 140, 205, 247, 289], "chroococcidiopsi": [0, 10, 140, 205, 247, 289], "thermali": [0, 10, 140, 205, 247, 289], "7203": [0, 10, 140, 205, 247, 289], "pleurocapsa": [0, 10, 140, 205, 247, 289], "7327": [0, 10, 140, 205, 247, 289], "spirulina": [0, 10, 140, 205, 247, 289], "subsalsa": [0, 10, 140, 205, 247, 289], "9445": [0, 10, 140, 205, 247, 289], "mesitorni": [0, 10, 140, 205, 247, 289], "unicolor": [0, 10, 140, 205, 247, 289], "cariama": [0, 10, 140, 205, 247, 289], "cristata": [0, 10, 140, 205, 247, 289], "eurypyga": [0, 10, 140, 205, 247, 289], "helia": [0, 10, 140, 205, 247, 289], "venezuela": [0, 10, 140, 205, 247, 289], "10712": [0, 10, 140, 205, 247, 289], "bongori": [0, 10, 140, 205, 247, 289], "n268": [0, 10, 140, 205, 247, 289], "08": [0, 6, 10, 140, 205, 247, 289, 324, 325], "thoraltensi": [0, 10, 140, 205, 247, 289], "12221": [0, 10, 140, 205, 247, 289], "mrp": [0, 10, 140, 205, 247, 289], "branchiophilum": [0, 10, 140, 205, 247, 289], "elymi": [0, 10, 140, 205, 247, 289], "e56": [0, 10, 140, 205, 247, 289], "owensensi": [0, 10, 140, 205, 247, 289], "ol": [0, 10, 140, 205, 247, 289], "smaragdina": [0, 10, 140, 205, 247, 289], "11293": [0, 10, 140, 205, 247, 289], "betavasculorum": [0, 10, 140, 205, 247, 289], "ruegeria": [0, 10, 140, 205, 247, 289], "lacuscaerulensi": [0, 10, 140, 205, 247, 289], "iti": [0, 10, 140, 205, 247, 289], "1157": [0, 10, 140, 205, 247, 289], "thermonema": [0, 10, 140, 205, 247, 289], "rossianum": [0, 10, 140, 205, 247, 289], "10300": [0, 10, 140, 205, 247, 289], "agaricidamnosum": [0, 10, 140, 205, 247, 289], "102515": [0, 10, 140, 205, 247, 289], "9628": [0, 10, 140, 205, 247, 289], "pistacia": [0, 10, 140, 205, 247, 289], "vera": [0, 10, 140, 205, 247, 289], "magnetospirillum": [0, 10, 140, 205, 247, 289], "gryphiswaldens": [0, 10, 140, 205, 247, 289], "msr": [0, 10, 140, 205, 247, 289], "v2": [0, 10, 140, 205, 247, 289], "guillardia": [0, 10, 140, 205, 247, 289], "theta": [0, 10, 140, 205, 247, 289], "graevenitzii": [0, 10, 140, 205, 247, 289], "c83": [0, 10, 140, 205, 247, 289], "dehalobact": [0, 10, 140, 205, 247, 289], "restrictu": [0, 10, 140, 205, 247, 289], "9455": [0, 10, 140, 205, 247, 289], "anguillarum": [0, 10, 140, 205, 247, 289], "cuculu": [0, 10, 140, 205, 247, 289], "canoru": [0, 10, 140, 205, 247, 289], "barophilu": [0, 10, 140, 205, 247, 289], "mp": [0, 10, 140, 205, 247, 289], "toyocaensi": [0, 10, 140, 205, 247, 289], "tyto": [0, 10, 140, 205, 247, 289], "osmophila": [0, 10, 140, 205, 247, 289], "clarridgeia": [0, 10, 140, 205, 247, 289], "arboricola": [0, 10, 140, 205, 247, 289], "celebensi": [0, 10, 140, 205, 247, 289], "cassava": [0, 10, 140, 205, 247, 289], "4642": [0, 10, 140, 205, 247, 289], "hortorum": [0, 10, 140, 205, 247, 289], "m081": [0, 10, 140, 205, 247, 289], "musacearum": [0, 10, 140, 205, 247, 289], "ncppb": [0, 10, 140, 205, 247, 289], "4379": [0, 10, 140, 205, 247, 289], "vesicatoria": [0, 10, 140, 205, 247, 289], "35937": [0, 10, 140, 205, 247, 289], "protomyc": [0, 10, 140, 205, 247, 289], "lactucaedebili": [0, 10, 140, 205, 247, 289], "aeropyrum": [0, 10, 140, 205, 247, 289], "pernix": [0, 10, 140, 205, 247, 289], "k1": [0, 10, 140, 205, 247, 289], "gallicum": [0, 10, 140, 205, 247, 289], "r602sp": [0, 10, 140, 205, 247, 289], "giardinii": [0, 10, 140, 205, 247, 289], "h152": [0, 10, 140, 205, 247, 289], "infirmum": [0, 10, 140, 205, 247, 289], "f0142": [0, 10, 140, 205, 247, 289], "glaciecola": [0, 10, 140, 205, 247, 289], "punicea": [0, 10, 140, 205, 247, 289], "611": [0, 10, 140, 205, 247, 289], "frigidimarina": [0, 10, 140, 205, 247, 289], "400": [0, 10, 140, 205, 247, 289], "bizzozeronii": [0, 10, 140, 205, 247, 289], "ciii": [0, 10, 140, 205, 247, 289], "broomea": [0, 10, 140, 205, 247, 289], "49717": [0, 10, 140, 205, 247, 289], "oshimai": [0, 10, 140, 205, 247, 289], "jl": [0, 10, 140, 205, 247, 289], "torqui": [0, 10, 140, 205, 247, 289], "700755": [0, 10, 140, 205, 247, 289], "zeae": [0, 10, 140, 205, 247, 289], "20178": [0, 10, 140, 205, 247, 289], "3804": [0, 10, 140, 205, 247, 289], "acanthisitta": [0, 10, 140, 205, 247, 289], "chlori": [0, 10, 140, 205, 247, 289], "apaloderma": [0, 10, 140, 205, 247, 289], "vittatum": [0, 10, 140, 205, 247, 289], "coliu": [0, 10, 140, 205, 247, 289], "striatu": [0, 10, 140, 205, 247, 289], "merop": [0, 10, 140, 205, 247, 289], "nubicu": [0, 10, 140, 205, 247, 289], "trifolium": [0, 10, 140, 205, 247, 289], "pratens": [0, 10, 140, 205, 247, 289], "arcachonens": [0, 10, 140, 205, 247, 289], "9755": [0, 10, 140, 205, 247, 289], "mongolens": [0, 10, 140, 205, 247, 289], "1844": [0, 10, 140, 205, 247, 289], "halomicrobium": [0, 10, 140, 205, 247, 289], "mukohataei": [0, 10, 140, 205, 247, 289], "12286": [0, 10, 140, 205, 247, 289], "asini": [0, 10, 140, 205, 247, 289], "700915": [0, 10, 140, 205, 247, 289], "vesca": [0, 10, 140, 205, 247, 289], "thailandensi": [0, 10, 140, 205, 247, 289], "msmb43": [0, 10, 140, 205, 247, 289], "daktulosphaira": [0, 10, 140, 205, 247, 289], "vitifolia": [0, 10, 140, 205, 247, 289], "spirillospora": [0, 10, 140, 205, 247, 289], "kuznetsovii": [0, 10, 140, 205, 247, 289], "6115": [0, 10, 140, 205, 247, 289], "desulfofarcimen": [0, 10, 140, 205, 247, 289], "acetoxidan": [0, 10, 140, 205, 247, 289], "771": [0, 10, 140, 205, 247, 289], "alaskensi": [0, 10, 140, 205, 247, 289], "g20": [0, 10, 140, 205, 247, 289], "medium": [0, 10, 140, 205, 247, 289], "700293": [0, 10, 140, 205, 247, 289], "veneficu": [0, 10, 140, 205, 247, 289], "snp6": [0, 10, 140, 205, 247, 289], "rhizopu": [0, 10, 140, 205, 247, 289], "microsporu": [0, 10, 140, 205, 247, 289], "celluloflavu": [0, 10, 140, 205, 247, 289], "azatica": [0, 10, 140, 205, 247, 289], "9699": [0, 10, 140, 205, 247, 289], "mediocidica": [0, 10, 140, 205, 247, 289], "9733": [0, 10, 140, 205, 247, 289], "fabryi": [0, 10, 140, 205, 247, 289], "50506": [0, 10, 140, 205, 247, 289], "citrinovirid": [0, 10, 140, 205, 247, 289], "tilletiopsi": [0, 10, 140, 205, 247, 289], "washingtonensi": [0, 10, 140, 205, 247, 289], "rickettsiella": [0, 10, 140, 205, 247, 289], "grylli": [0, 10, 140, 205, 247, 289], "macedonicu": [0, 10, 140, 205, 247, 289], "aca": [0, 10, 140, 205, 247, 289], "dc": [0, 10, 140, 205, 247, 289], "198": [0, 10, 140, 165, 205, 247, 289], "actinotignum": [0, 10, 140, 205, 247, 289], "schaalii": [0, 10, 140, 205, 247, 289], "fb123": [0, 10, 140, 205, 247, 289], "cna": [0, 10, 140, 205, 247, 289], "pantholop": [0, 10, 140, 205, 247, 289], "hodgsonii": [0, 10, 140, 205, 247, 289], "corynespora": [0, 10, 140, 205, 247, 289], "cassiicola": [0, 10, 140, 205, 247, 289], "philippin": [0, 10, 140, 205, 247, 289], "algicola": [0, 10, 140, 205, 247, 289], "14237": [0, 10, 140, 205, 247, 289], "reducen": [0, 10, 140, 205, 247, 289], "mi": [0, 9, 10, 140, 205, 247, 289], "rodentium": [0, 10, 140, 205, 247, 289], "700285": [0, 10, 140, 205, 247, 289], "lyrata": [0, 10, 140, 205, 247, 289], "australiens": [0, 10, 140, 205, 247, 289], "alcanivorax": [0, 10, 140, 205, 247, 289], "borkumensi": [0, 10, 140, 205, 247, 289], "sk2": [0, 10, 140, 205, 247, 289], "angomona": [0, 10, 140, 205, 247, 289], "deanei": [0, 10, 140, 205, 247, 289], "echinoid": [0, 10, 140, 205, 247, 289], "14820": [0, 10, 140, 205, 247, 289], "5050": [0, 10, 140, 205, 247, 289], "15375": [0, 10, 140, 205, 247, 289], "curdlanolyticu": [0, 10, 140, 205, 247, 289], "yk9": [0, 10, 140, 205, 247, 289], "peoria": [0, 10, 140, 205, 247, 289], "3763": [0, 10, 140, 205, 247, 289], "cyanobium": [0, 10, 140, 205, 247, 289], "gracil": [0, 10, 140, 205, 247, 289], "6307": [0, 10, 140, 205, 247, 289], "7805": [0, 10, 140, 205, 247, 289], "pallen": [0, 10, 140, 205, 247, 289], "700821": [0, 10, 140, 205, 247, 289], "polonicum": [0, 10, 140, 205, 247, 289], "solitum": [0, 10, 140, 205, 247, 289], "nalgiovens": [0, 10, 140, 205, 247, 289], "violacea": [0, 10, 140, 205, 247, 289], "dss12": [0, 10, 140, 205, 247, 289], "amazonensi": [0, 10, 140, 205, 247, 289], "sb2b": [0, 10, 140, 205, 247, 289], "mr": [0, 9, 10, 140, 205, 247, 289], "paraplantarum": [0, 10, 140, 205, 247, 289], "vietnamiensi": [0, 10, 140, 205, 247, 289], "g4": [0, 10, 140, 205, 247, 289], "halogeometricum": [0, 10, 140, 205, 247, 289], "borinquens": [0, 10, 140, 205, 247, 289], "11551": [0, 10, 140, 205, 247, 289], "phaeobact": [0, 10, 140, 205, 247, 289], "gallaeciensi": [0, 10, 140, 205, 247, 289], "26640": [0, 10, 140, 205, 247, 289], "desulfobacca": [0, 10, 140, 205, 247, 289], "11109": [0, 10, 140, 205, 247, 289], "spinosa": [0, 10, 140, 205, 247, 289], "18395": [0, 10, 140, 205, 247, 289], "sanguibact": [0, 10, 140, 205, 247, 289], "keddieii": [0, 10, 140, 205, 247, 289], "10542": [0, 10, 140, 205, 247, 289], "woodyi": [0, 10, 140, 205, 247, 289], "51908": [0, 10, 140, 205, 247, 289], "holdemania": [0, 10, 140, 205, 247, 289], "filiformi": [0, 10, 140, 205, 247, 289], "12042": [0, 10, 140, 205, 247, 289], "monilinia": [0, 10, 140, 205, 247, 289], "laxa": [0, 10, 140, 205, 247, 289], "picea": [0, 10, 140, 205, 247, 289], "dehalococcoid": [0, 10, 140, 205, 247, 289], "mccartyi": [0, 10, 140, 205, 247, 289], "195": [0, 10, 140, 169, 205, 247, 289], "coniosporium": [0, 10, 140, 205, 247, 289], "apollini": [0, 10, 140, 205, 247, 289], "f0235": [0, 10, 140, 205, 247, 289], "mucilaginosu": [0, 10, 140, 205, 247, 289], "knp414": [0, 10, 140, 205, 247, 289], "asburia": [0, 10, 140, 205, 247, 289], "lf7a": [0, 10, 140, 205, 247, 289], "lelliottia": [0, 10, 140, 205, 247, 289], "amnigena": [0, 10, 140, 205, 247, 289], "ch": [0, 10, 140, 205, 247, 289], "pluralibact": [0, 10, 140, 205, 247, 289], "gergovia": [0, 10, 140, 205, 247, 289], "natronorubrum": [0, 10, 140, 205, 247, 289], "bangens": [0, 10, 140, 205, 247, 289], "10635": [0, 10, 140, 205, 247, 289], "valaisiana": [0, 10, 140, 205, 247, 289], "tom4006": [0, 10, 140, 205, 247, 289], "multivorum": [0, 10, 140, 205, 247, 289], "aiu301": [0, 10, 140, 205, 247, 289], "haloterrigena": [0, 10, 140, 205, 247, 289], "turkmenica": [0, 10, 140, 205, 247, 289], "5511": [0, 10, 140, 205, 247, 289], "os117": [0, 10, 140, 205, 247, 289], "funestu": [0, 10, 140, 205, 247, 289], "saccharum": [0, 10, 140, 205, 247, 289], "spontaneum": [0, 10, 140, 205, 247, 289], "tibetens": [0, 10, 140, 205, 247, 289], "ga33": [0, 10, 140, 205, 247, 289], "viscosa": [0, 10, 140, 205, 247, 289], "tufc12733": [0, 10, 140, 205, 247, 289], "zobellia": [0, 10, 140, 205, 247, 289], "galactanivoran": [0, 10, 140, 205, 247, 289], "vf5": [0, 10, 140, 205, 247, 289], "melanopsichium": [0, 10, 140, 205, 247, 289], "pennsylvanicum": [0, 10, 140, 205, 247, 289], "benhamia": [0, 10, 140, 205, 247, 289], "nannizzia": [0, 10, 140, 205, 247, 289], "gypsea": [0, 10, 140, 205, 247, 289], "118893": [0, 10, 140, 205, 247, 289], "microsporum": [0, 10, 140, 205, 247, 289], "113480": [0, 10, 140, 205, 247, 289], "verrucosum": [0, 10, 140, 205, 247, 289], "equinum": [0, 10, 140, 205, 247, 289], "oxyclina": [0, 10, 140, 205, 247, 289], "11498": [0, 10, 140, 205, 247, 289], "atrovirid": [0, 10, 140, 205, 247, 289], "sodali": [0, 10, 140, 205, 247, 289], "glossinidiu": [0, 10, 140, 205, 247, 289], "kuenenii": [0, 10, 140, 205, 247, 289], "12350": [0, 10, 140, 205, 247, 289], "sideroxydan": [0, 10, 140, 205, 247, 289], "lithotrophicu": [0, 10, 140, 205, 247, 289], "demetria": [0, 10, 140, 205, 247, 289], "terragena": [0, 10, 140, 205, 247, 289], "11295": [0, 10, 140, 205, 247, 289], "nevskia": [0, 10, 140, 205, 247, 289], "ramosa": [0, 10, 140, 205, 247, 289], "11499": [0, 10, 140, 205, 247, 289], "pseudomycoid": [0, 10, 140, 205, 247, 289], "12442": [0, 10, 140, 205, 247, 289], "desulfurobacterium": [0, 10, 140, 205, 247, 289], "thermolithotrophum": [0, 10, 140, 205, 247, 289], "11699": [0, 10, 140, 205, 247, 289], "coleofasciculu": [0, 10, 140, 205, 247, 289], "chthonoplast": [0, 10, 140, 205, 247, 289], "7420": [0, 10, 140, 205, 247, 289], "carnimona": [0, 10, 140, 205, 247, 289], "dothistroma": [0, 10, 140, 205, 247, 289], "septosporum": [0, 10, 140, 205, 247, 289], "cc9311": [0, 10, 140, 205, 247, 289], "mortierella": [0, 10, 140, 205, 247, 289], "32222": [0, 10, 140, 205, 247, 289], "lobosporangium": [0, 10, 140, 205, 247, 289], "transversal": [0, 10, 140, 205, 247, 289], "asiatica": [0, 10, 140, 205, 247, 289], "12278": [0, 10, 140, 205, 247, 289], "muriaticu": [0, 10, 140, 205, 247, 289], "15685": [0, 10, 140, 205, 247, 289], "bissettii": [0, 10, 140, 205, 247, 289], "dn127": [0, 10, 140, 205, 247, 289], "terasakiella": [0, 10, 140, 205, 247, 289], "6293": [0, 10, 140, 205, 247, 289], "marinospirillum": [0, 10, 140, 205, 247, 289], "minutulum": [0, 10, 140, 205, 247, 289], "6287": [0, 10, 140, 205, 247, 289], "jadensi": [0, 10, 140, 205, 247, 289], "t9": [0, 10, 140, 205, 247, 289], "ad22": [0, 10, 140, 205, 247, 289], "pythium": [0, 10, 140, 205, 247, 289], "aphanidermatum": [0, 10, 140, 205, 247, 289], "daom": [0, 10, 140, 205, 247, 289], "br444": [0, 10, 140, 205, 247, 289], "halothec": [0, 10, 140, 205, 247, 289], "7418": [0, 10, 140, 205, 247, 289], "wenyonii": [0, 10, 140, 205, 247, 289], "massachusett": [0, 10, 140, 205, 247, 289], "barthii": [0, 10, 140, 205, 247, 289], "actinoalloteichu": [0, 10, 140, 205, 247, 289], "cyanogriseu": [0, 10, 140, 205, 247, 289], "cerbereu": [0, 10, 140, 205, 247, 289], "11376": [0, 10, 140, 205, 247, 289], "deleyianum": [0, 10, 140, 205, 247, 289], "6946": [0, 10, 140, 205, 247, 289], "desulfocapsa": [0, 10, 140, 205, 247, 289], "sulfexigen": [0, 10, 140, 205, 247, 289], "10523": [0, 10, 140, 205, 247, 289], "serendipita": [0, 10, 140, 205, 247, 289], "tracheiphila": [0, 10, 140, 205, 247, 289], "knackmussii": [0, 10, 140, 205, 247, 289], "b13": [0, 10, 140, 205, 247, 289], "wolbachia": [0, 10, 140, 205, 247, 289], "wri": [0, 10, 140, 205, 247, 289], "lachnoclostridium": [0, 10, 140, 205, 247, 289], "phytofermentan": [0, 10, 140, 205, 247, 289], "isdg": [0, 10, 140, 205, 247, 289], "gleimia": [0, 10, 140, 205, 247, 289], "col10b": [0, 10, 140, 205, 247, 289], "af2": [0, 10, 140, 205, 247, 289], "stewartii": [0, 10, 140, 205, 247, 289], "violen": [0, 10, 140, 205, 247, 289], "papilio": [0, 10, 140, 205, 247, 289], "xuthu": [0, 10, 140, 205, 247, 289], "roseoverticillatu": [0, 10, 140, 205, 247, 289], "12446": [0, 10, 140, 205, 247, 289], "afghaniensi": [0, 10, 140, 205, 247, 289], "772": [0, 10, 140, 205, 247, 289], "atroolivaceu": [0, 10, 140, 205, 247, 289], "catenula": [0, 10, 140, 205, 247, 289], "griseoruben": [0, 10, 140, 205, 247, 289], "theileri": [0, 10, 140, 205, 247, 289], "alboflavu": [0, 10, 140, 205, 247, 289], "aureocirculatu": [0, 10, 140, 205, 247, 289], "filamentosu": [0, 10, 140, 205, 247, 289], "15998": [0, 10, 140, 205, 247, 289], "flavidoviren": [0, 10, 140, 205, 247, 289], "40150": [0, 10, 140, 205, 247, 289], "lavenduligriseu": [0, 10, 140, 205, 247, 289], "mutabili": [0, 10, 140, 205, 247, 289], "purpeofusca": [0, 10, 140, 205, 247, 289], "resistomycificu": [0, 10, 140, 205, 247, 289], "varsoviensi": [0, 10, 140, 205, 247, 289], "rheinheimera": [0, 10, 140, 205, 247, 289], "14885": [0, 10, 140, 205, 247, 289], "viridosporu": [0, 10, 140, 205, 247, 289], "14672": [0, 10, 140, 205, 247, 289], "infernu": [0, 10, 140, 205, 247, 289], "me": [0, 2, 10, 140, 205, 247, 289], "ictaluri": [0, 10, 140, 205, 247, 289], "farmeri": [0, 10, 140, 205, 247, 289], "gtc": [0, 10, 140, 205, 247, 289], "1319": [0, 10, 140, 205, 247, 289], "icc168": [0, 10, 140, 205, 247, 289], "sedlakii": [0, 10, 140, 205, 247, 289], "105722": [0, 10, 140, 205, 247, 289], "130z": [0, 10, 140, 205, 247, 289], "aerocolonigen": [0, 10, 140, 205, 247, 289], "cyaneogriseu": [0, 10, 140, 205, 247, 289], "noncyanogenu": [0, 10, 140, 205, 247, 289], "durhamensi": [0, 10, 140, 205, 247, 289], "flavochromogen": [0, 10, 140, 205, 247, 289], "fulvissimu": [0, 10, 140, 205, 247, 289], "40593": [0, 10, 140, 205, 247, 289], "griseoaurantiacu": [0, 10, 140, 205, 247, 289], "m045": [0, 10, 140, 205, 247, 289], "iakyru": [0, 10, 140, 205, 247, 289], "katra": [0, 10, 140, 205, 247, 289], "pyridomyceticu": [0, 10, 140, 205, 247, 289], "violaceusnig": [0, 10, 140, 205, 247, 289], "4113": [0, 10, 140, 205, 247, 289], "albulu": [0, 10, 140, 205, 247, 289], "sphaerobolu": [0, 10, 140, 205, 247, 289], "stellatu": [0, 10, 140, 205, 247, 289], "ss14": [0, 10, 140, 205, 247, 289], "scleroderma": [0, 10, 140, 205, 247, 289], "citrinum": [0, 10, 140, 205, 247, 289], "foug": [0, 10, 140, 205, 247, 289], "rasamsonia": [0, 10, 140, 205, 247, 289], "emersonii": [0, 10, 140, 205, 247, 289], "393": [0, 10, 140, 205, 247, 289], "64": [0, 10, 140, 205, 247, 289], "perori": [0, 10, 140, 205, 247, 289], "700780": [0, 10, 140, 205, 247, 289], "infanti": [0, 10, 140, 205, 247, 289], "sk970": [0, 10, 140, 205, 247, 289], "geothermali": [0, 10, 140, 205, 247, 289], "11300": [0, 10, 140, 205, 247, 289], "farauti": [0, 10, 140, 205, 247, 289], "5701": [0, 10, 140, 205, 247, 289], "cancerogenu": [0, 10, 140, 205, 247, 289], "35316": [0, 10, 140, 205, 247, 289], "paradisiaca": [0, 10, 140, 205, 247, 289], "ech703": [0, 10, 140, 205, 247, 289], "aquamicrobium": [0, 10, 140, 205, 247, 289], "defluvii": [0, 10, 140, 205, 247, 289], "micropl": [0, 10, 140, 205, 247, 289], "demolitor": [0, 10, 140, 205, 247, 289], "vlb120": [0, 10, 140, 205, 247, 289], "chara": [0, 10, 140, 205, 247, 289], "braunii": [0, 10, 140, 205, 247, 289], "caulobact": [0, 10, 140, 205, 247, 289], "henricii": [0, 10, 140, 205, 247, 289], "petrotoga": [0, 10, 140, 205, 247, 289], "sj95": [0, 10, 140, 205, 247, 289], "natrinema": [0, 10, 140, 205, 247, 289], "pellirubrum": [0, 10, 140, 205, 247, 289], "15624": [0, 10, 140, 205, 247, 289], "3751": [0, 10, 140, 205, 247, 289], "vincentii": [0, 10, 140, 205, 247, 289], "35580": [0, 10, 140, 205, 247, 289], "oxalicum": [0, 10, 140, 205, 247, 289], "35185": [0, 10, 140, 205, 247, 289], "soudanens": [0, 10, 140, 205, 247, 289], "452": [0, 10, 140, 205, 247, 289], "61": [0, 10, 140, 205, 247, 289], "macrococcu": [0, 10, 140, 205, 247, 289], "caseolyticu": [0, 10, 140, 205, 247, 289], "jcsc5402": [0, 10, 140, 205, 247, 289], "ostreococcu": [0, 10, 140, 205, 247, 289], "tauri": [0, 10, 140, 205, 247, 289], "edhazardia": [0, 10, 140, 205, 247, 289], "aedi": [0, 10, 140, 205, 247, 289], "usnm": [0, 10, 140, 205, 247, 289], "41457": [0, 10, 140, 205, 247, 289], "neutrophilum": [0, 10, 140, 205, 247, 289], "v24sta": [0, 10, 140, 205, 247, 289], "plecoglossicida": [0, 10, 140, 205, 247, 289], "nb2011": [0, 10, 140, 205, 247, 289], "nodularia": [0, 10, 140, 205, 247, 289], "spumigena": [0, 10, 140, 205, 247, 289], "ccy9414": [0, 10, 140, 205, 247, 289], "pealeana": [0, 10, 140, 205, 247, 289], "700345": [0, 10, 140, 205, 247, 289], "flexithrix": [0, 10, 140, 205, 247, 289], "dorothea": [0, 10, 140, 205, 247, 289], "6795": [0, 10, 140, 205, 247, 289], "lewinella": [0, 10, 140, 205, 247, 289], "cohaeren": [0, 10, 140, 205, 247, 289], "23179": [0, 10, 140, 205, 247, 289], "23188": [0, 10, 140, 205, 247, 289], "paxillu": [0, 10, 140, 205, 247, 289], "involutu": [0, 10, 140, 205, 247, 289], "200175": [0, 10, 140, 205, 247, 289], "vitulinu": [0, 10, 140, 205, 247, 289], "f1028": [0, 10, 140, 205, 247, 289], "halioticoli": [0, 10, 140, 205, 247, 289], "102217": [0, 10, 140, 205, 247, 289], "amorpha": [0, 10, 140, 205, 247, 289], "ccnwgs0123": [0, 10, 140, 205, 247, 289], "malodoratu": [0, 10, 140, 205, 247, 289], "43197": [0, 10, 140, 205, 247, 289], "raffinosu": [0, 10, 140, 205, 247, 289], "49464": [0, 10, 140, 205, 247, 289], "ophioglossoid": [0, 10, 140, 205, 247, 289], "100239": [0, 10, 140, 205, 247, 289], "lonsdalea": [0, 10, 140, 205, 247, 289], "waddlia": [0, 10, 140, 205, 247, 289], "chondrophila": [0, 10, 140, 205, 247, 289], "wsu": [0, 10, 140, 205, 247, 289], "86": [0, 10, 140, 205, 247, 289], "1044": [0, 10, 140, 205, 247, 289], "naematelia": [0, 10, 140, 205, 247, 289], "encephala": [0, 10, 140, 205, 247, 289], "hypholoma": [0, 10, 140, 205, 247, 289], "sublateritium": [0, 10, 140, 205, 247, 289], "334": [0, 10, 140, 205, 247, 289], "kocuria": [0, 10, 140, 205, 247, 289], "rhizophila": [0, 10, 140, 205, 247, 289], "p7": [0, 10, 140, 205, 247, 289], "sphaeroforma": [0, 10, 140, 205, 247, 289], "arctica": [0, 10, 140, 205, 247, 289], "jp610": [0, 10, 140, 205, 247, 289], "thielaviopsi": [0, 10, 140, 205, 247, 289], "punctulata": [0, 10, 140, 205, 247, 289], "lepeophtheiru": [0, 10, 140, 205, 247, 289], "salmoni": [0, 10, 140, 205, 247, 289], "citromicrobium": [0, 10, 140, 205, 247, 289], "bathyomarinum": [0, 10, 140, 205, 247, 289], "jl354": [0, 10, 140, 205, 247, 289], "ophiocordycep": [0, 10, 140, 205, 247, 289], "trachipleistophora": [0, 10, 140, 205, 247, 289], "ro": [0, 10, 140, 205, 247, 289], "3706": [0, 10, 140, 205, 247, 289], "austrosaltan": [0, 10, 140, 205, 247, 289], "lusaltan": [0, 10, 140, 205, 247, 289], "milleri": [0, 10, 140, 205, 247, 289], "nannochloropsi": [0, 10, 140, 205, 247, 289], "gaditana": [0, 10, 140, 205, 247, 289], "ccmp526": [0, 10, 140, 205, 247, 289], "achromobact": [0, 10, 140, 205, 247, 289], "piechaudii": [0, 10, 140, 205, 247, 289], "hle": [0, 10, 140, 205, 247, 289], "reilianum": [0, 10, 140, 205, 247, 289], "boechera": [0, 10, 140, 205, 247, 289], "stricta": [0, 10, 140, 205, 247, 289], "eutrema": [0, 10, 140, 205, 247, 289], "salsugineum": [0, 10, 140, 205, 247, 289], "dechloromona": [0, 10, 140, 205, 247, 289], "agitata": [0, 10, 140, 205, 247, 289], "is5": [0, 10, 140, 205, 247, 289], "seoulensi": [0, 10, 140, 205, 247, 289], "thiocysti": [0, 10, 140, 205, 247, 289], "violascen": [0, 10, 140, 205, 247, 289], "emmonsia": [0, 10, 140, 205, 247, 289], "crescen": [0, 10, 140, 205, 247, 289], "uamh": [0, 10, 140, 205, 247, 289], "3008": [0, 10, 140, 205, 247, 289], "cordycep": [0, 10, 140, 205, 247, 289], "militari": [0, 10, 140, 205, 247, 289], "piromyc": [0, 10, 140, 205, 247, 289], "e2": [0, 10, 140, 205, 247, 289], "vulcaniu": [0, 10, 140, 205, 247, 289], "m7": [0, 10, 140, 205, 247, 289], "thermaerobact": [0, 10, 140, 205, 247, 289], "marianensi": [0, 10, 140, 205, 247, 289], "12885": [0, 10, 140, 205, 247, 289], "profundum": [0, 10, 140, 205, 247, 289], "ss9": [0, 10, 140, 205, 247, 289], "4726": [0, 10, 140, 205, 247, 289], "subvibrioid": [0, 10, 140, 205, 247, 289], "15264": [0, 10, 140, 205, 247, 289], "maricauli": [0, 10, 140, 205, 247, 289], "mcs10": [0, 10, 140, 205, 247, 289], "ps728": [0, 10, 140, 205, 247, 289], "guttiformi": [0, 10, 140, 205, 247, 289], "32187": [0, 10, 140, 205, 247, 289], "thraustotheca": [0, 10, 140, 205, 247, 289], "clavata": [0, 10, 140, 205, 247, 289], "rosa": [0, 10, 140, 205, 247, 289], "stachybotri": [0, 10, 140, 205, 247, 289], "chartarum": [0, 10, 140, 205, 247, 289], "ibt": [0, 10, 140, 205, 247, 289], "7711": [0, 10, 140, 205, 247, 289], "6083": [0, 10, 140, 205, 247, 289], "caribensi": [0, 10, 140, 205, 247, 289], "mba4": [0, 10, 140, 205, 247, 289], "xinjiangensi": [0, 10, 140, 205, 247, 289], "xj": [0, 10, 140, 205, 247, 289], "54": [0, 10, 140, 205, 247, 289], "mandelii": [0, 10, 140, 205, 247, 289], "pd30": [0, 10, 140, 205, 247, 289], "castellaniella": [0, 10, 140, 205, 247, 289], "defragran": [0, 10, 140, 205, 247, 289], "65phen": [0, 10, 140, 205, 247, 289], "thermocrini": [0, 10, 140, 205, 247, 289], "12173": [0, 10, 140, 205, 247, 289], "js617": [0, 10, 140, 205, 247, 289], "mannheimia": [0, 10, 140, 205, 247, 289], "haemolytica": [0, 10, 140, 205, 247, 289], "m42548": [0, 10, 140, 205, 247, 289], "thauera": [0, 10, 140, 205, 247, 289], "linaloolenti": [0, 10, 140, 205, 247, 289], "47lol": [0, 10, 140, 205, 247, 289], "12138": [0, 10, 140, 205, 247, 289], "terpenica": [0, 10, 140, 205, 247, 289], "58eu": [0, 10, 140, 205, 247, 289], "alloprevotella": [0, 10, 140, 205, 247, 289], "tannera": [0, 10, 140, 205, 247, 289], "51259": [0, 10, 140, 205, 247, 289], "enoeca": [0, 10, 140, 205, 247, 289], "12259": [0, 10, 140, 205, 247, 289], "rumoiensi": [0, 10, 140, 205, 247, 289], "45": [0, 10, 140, 205, 247, 289], "381": [0, 10, 140, 205, 247, 289], "mycetocola": [0, 10, 140, 205, 247, 289], "saprophilu": [0, 10, 140, 205, 247, 289], "vitaminophilu": [0, 10, 140, 205, 247, 289], "41686": [0, 10, 140, 205, 247, 289], "arbori": [0, 10, 140, 205, 247, 289], "14919": [0, 10, 140, 205, 247, 289], "monteilii": [0, 10, 140, 205, 247, 289], "sb3078": [0, 10, 140, 205, 247, 289], "malassezia": [0, 10, 140, 205, 247, 289], "globosa": [0, 10, 140, 205, 247, 289], "sympodiali": [0, 10, 140, 205, 247, 289], "42132": [0, 10, 140, 205, 247, 289], "odoratimimu": [0, 10, 140, 205, 247, 289], "h1bi": [0, 10, 140, 205, 247, 289], "solibacillu": [0, 10, 140, 205, 247, 289], "silvestri": [0, 10, 140, 205, 247, 289], "stlb046": [0, 10, 140, 205, 247, 289], "constellatu": [0, 10, 140, 205, 247, 289], "pharyngi": [0, 10, 140, 205, 247, 289], "sk1060": [0, 10, 140, 205, 247, 289], "46377": [0, 10, 140, 205, 247, 289], "hebeloma": [0, 10, 140, 205, 247, 289], "cylindrosporum": [0, 10, 140, 205, 247, 289], "h7": [0, 10, 140, 205, 247, 289], "caldivirga": [0, 10, 140, 205, 247, 289], "maquilingensi": [0, 10, 140, 205, 247, 289], "ic": [0, 10, 140, 205, 247, 289], "167": [0, 10, 140, 169, 205, 247, 289], "asticcacauli": [0, 10, 140, 205, 247, 289], "biprosthecum": [0, 10, 140, 205, 247, 289], "c19": [0, 10, 140, 205, 247, 289], "herbicidovoran": [0, 10, 140, 205, 247, 289], "16415": [0, 10, 140, 205, 247, 289], "pachydermati": [0, 10, 140, 205, 247, 289], "cylindrospermopsi": [0, 10, 140, 205, 247, 289], "raciborskii": [0, 10, 140, 205, 247, 289], "wno": [0, 10, 140, 205, 247, 289], "rosellinia": [0, 10, 140, 205, 247, 289], "necatrix": [0, 10, 140, 205, 247, 289], "boreali": [0, 10, 140, 205, 247, 289], "4128": [0, 10, 140, 205, 247, 289], "dendroctonu": [0, 10, 140, 205, 247, 289], "ponderosa": [0, 10, 140, 205, 247, 289], "gonderi": [0, 10, 140, 205, 247, 289], "leersia": [0, 10, 140, 205, 247, 289], "perrieri": [0, 10, 140, 205, 247, 289], "subtil": [0, 10, 140, 205, 247, 289], "albensi": [0, 10, 140, 205, 247, 289], "11370": [0, 10, 140, 205, 247, 289], "12258": [0, 10, 140, 205, 247, 289], "succinispira": [0, 10, 140, 205, 247, 289], "6222": [0, 10, 140, 205, 247, 289], "oidiodendron": [0, 10, 140, 205, 247, 289], "maiu": [0, 10, 140, 205, 247, 289], "parascardovia": [0, 10, 140, 205, 247, 289], "denticolen": [0, 10, 140, 205, 247, 289], "10105": [0, 10, 140, 205, 247, 289], "12538": [0, 10, 140, 205, 247, 289], "scardovia": [0, 10, 140, 205, 247, 289], "inopinata": [0, 10, 140, 205, 247, 289], "f0304": [0, 10, 140, 205, 247, 289], "mosselii": [0, 10, 140, 205, 247, 289], "sj10": [0, 10, 140, 205, 247, 289], "canettii": [0, 10, 140, 205, 247, 289], "cipt": [0, 10, 140, 205, 247, 289], "140070017": [0, 10, 140, 205, 247, 289], "20093": [0, 10, 140, 205, 247, 289], "11596": [0, 10, 140, 205, 247, 289], "merycicum": [0, 10, 140, 205, 247, 289], "somaliensi": [0, 10, 140, 205, 247, 289], "40738": [0, 10, 140, 205, 247, 289], "odoriferum": [0, 10, 140, 205, 247, 289], "neonectria": [0, 10, 140, 205, 247, 289], "ditissima": [0, 10, 140, 205, 247, 289], "20433": [0, 10, 140, 205, 247, 289], "undicola": [0, 10, 140, 205, 247, 289], "992": [0, 10, 140, 205, 247, 289], "700741": [0, 10, 140, 205, 247, 289], "thermothelomyc": [0, 10, 140, 205, 247, 289], "excentricu": [0, 10, 140, 205, 247, 289], "podila": [0, 10, 140, 205, 247, 289], "verticillata": [0, 10, 140, 205, 247, 289], "meridiei": [0, 10, 140, 205, 247, 289], "13257": [0, 10, 140, 205, 247, 289], "chitinophaga": [0, 10, 140, 205, 247, 289], "pinensi": [0, 10, 140, 205, 247, 289], "2588": [0, 10, 140, 205, 247, 289], "brachyelytri": [0, 10, 140, 205, 247, 289], "cimex": [0, 10, 140, 205, 247, 289], "lectulariu": [0, 10, 140, 205, 247, 289], "clausii": [0, 10, 140, 205, 247, 289], "ksm": [0, 10, 140, 205, 247, 289], "k16": [0, 10, 140, 205, 247, 289], "pseudofirmu": [0, 10, 140, 205, 247, 289], "of4": [0, 10, 140, 205, 247, 289], "pyrifolia": [0, 10, 140, 205, 247, 289], "ep1": [0, 10, 140, 205, 247, 289], "96": [0, 10, 140, 205, 247, 289, 324, 325], "coniophora": [0, 10, 140, 205, 247, 289], "puteana": [0, 10, 140, 205, 247, 289], "piloderma": [0, 10, 140, 205, 247, 289], "croceum": [0, 10, 140, 205, 247, 289], "1598": [0, 10, 140, 205, 247, 289], "thioflavicoccu": [0, 10, 140, 205, 247, 289], "8321": [0, 10, 140, 205, 247, 289], "aphi": [0, 10, 140, 205, 247, 289], "haliangium": [0, 10, 140, 205, 247, 289], "ochraceum": [0, 10, 140, 205, 247, 289], "14365": [0, 10, 140, 205, 247, 289], "wodani": [0, 10, 140, 205, 247, 289], "moritella": [0, 10, 140, 205, 247, 289], "delftia": [0, 10, 140, 205, 247, 289], "acidovoran": [0, 10, 140, 205, 247, 289], "sph": [0, 10, 140, 205, 247, 289], "acidovorax": [0, 10, 140, 205, 247, 289], "19860": [0, 10, 140, 205, 247, 289], "citrulli": [0, 10, 140, 205, 247, 289], "aac00": [0, 10, 140, 205, 247, 289], "cryptosporangium": [0, 10, 140, 205, 247, 289], "arvum": [0, 10, 140, 205, 247, 289], "44712": [0, 10, 140, 205, 247, 289], "hylemonella": [0, 10, 140, 205, 247, 289], "niagara": [0, 10, 140, 205, 247, 289], "simplicispira": [0, 10, 140, 205, 247, 289], "psychrophila": [0, 10, 140, 205, 247, 289], "11588": [0, 10, 140, 205, 247, 289], "higginsianum": [0, 10, 140, 205, 247, 289], "brennaborens": [0, 10, 140, 205, 247, 289], "12168": [0, 10, 140, 205, 247, 289], "mh": [0, 10, 140, 205, 247, 289], "neptunium": [0, 10, 140, 205, 247, 289], "15444": [0, 10, 140, 205, 247, 289], "ocean": [0, 10, 140, 205, 247, 289], "sch89": [0, 10, 140, 205, 247, 289], "wolfiporia": [0, 10, 140, 205, 247, 289], "coco": [0, 10, 140, 205, 247, 289], "md": [0, 10, 140, 205, 247, 289], "ss10": [0, 10, 140, 205, 247, 289], "alcoholivoran": [0, 10, 140, 205, 247, 289], "5433": [0, 10, 140, 205, 247, 289], "caldoxylosilyticu": [0, 10, 140, 205, 247, 289], "cic9": [0, 10, 140, 205, 247, 289], "aminomona": [0, 10, 140, 205, 247, 289], "paucivoran": [0, 10, 140, 205, 247, 289], "12260": [0, 10, 140, 205, 247, 289], "12254": [0, 10, 140, 205, 247, 289], "thermanaerovibrio": [0, 10, 140, 205, 247, 289], "acidaminovoran": [0, 10, 140, 205, 247, 289], "6589": [0, 10, 140, 205, 247, 289], "aminobacterium": [0, 10, 140, 205, 247, 289], "12262": [0, 10, 140, 205, 247, 289], "colombiens": [0, 10, 140, 205, 247, 289], "12261": [0, 10, 140, 205, 247, 289], "frateuria": [0, 10, 140, 205, 247, 289], "aurantia": [0, 10, 140, 205, 247, 289], "6220": [0, 10, 140, 205, 247, 289], "cheerisanensi": [0, 10, 140, 205, 247, 289], "2395": [0, 10, 140, 205, 247, 289], "vagococcu": [0, 10, 140, 205, 247, 289], "lutra": [0, 10, 140, 205, 247, 289], "lbd1": [0, 10, 140, 205, 247, 289], "halleri": [0, 10, 140, 205, 247, 289], "gemmifera": [0, 10, 140, 205, 247, 289], "capsella": [0, 10, 140, 205, 247, 289], "rubella": [0, 10, 140, 205, 247, 289], "picrophilu": [0, 10, 140, 205, 247, 289], "torridu": [0, 10, 140, 205, 247, 289], "vagina": [0, 10, 140, 205, 247, 289], "15829": [0, 10, 140, 205, 247, 289], "centipeda": [0, 10, 140, 205, 247, 289], "periodontii": [0, 10, 140, 205, 247, 289], "2778": [0, 10, 140, 205, 247, 289], "phlebiopsi": [0, 10, 140, 205, 247, 289], "gigantea": [0, 10, 140, 205, 247, 289], "11061_1": [0, 10, 140, 205, 247, 289], "cr5": [0, 10, 140, 205, 247, 289], "facklamia": [0, 10, 140, 205, 247, 289], "languida": [0, 10, 140, 205, 247, 289], "37842": [0, 10, 140, 205, 247, 289], "pantotrophu": [0, 10, 140, 205, 247, 289], "j46": [0, 10, 140, 205, 247, 289], "anaerovibrio": [0, 10, 140, 205, 247, 289], "lipolyticu": [0, 10, 140, 205, 247, 289], "lb2005": [0, 10, 140, 205, 247, 289], "anaeroarcu": [0, 10, 140, 205, 247, 289], "burkinensi": [0, 10, 140, 205, 247, 289], "6283": [0, 10, 140, 205, 247, 289], "trichosporon": [0, 10, 140, 205, 247, 289], "asahii": [0, 10, 140, 205, 247, 289], "pseudanabaena": [0, 10, 140, 205, 247, 289], "7367": [0, 10, 140, 205, 247, 289], "16829": [0, 10, 140, 205, 247, 289], "arrhenoman": [0, 10, 140, 205, 247, 289], "12531": [0, 10, 140, 205, 247, 289], "buttiauxella": [0, 10, 140, 205, 247, 289], "agresti": [0, 10, 140, 205, 247, 289], "33320": [0, 10, 140, 205, 247, 289], "budvicia": [0, 10, 140, 205, 247, 289], "aquatica": [0, 10, 140, 205, 247, 289], "5075": [0, 10, 140, 205, 247, 289], "35567": [0, 10, 140, 205, 247, 289], "leminorella": [0, 10, 140, 205, 247, 289], "grimontii": [0, 10, 140, 205, 247, 289], "33999": [0, 10, 140, 205, 247, 289], "5078": [0, 10, 140, 205, 247, 289], "tatumella": [0, 10, 140, 205, 247, 289], "ptyseo": [0, 10, 140, 205, 247, 289], "33301": [0, 10, 140, 205, 247, 289], "grimesii": [0, 10, 140, 205, 247, 289], "plymuthica": [0, 10, 140, 205, 247, 289], "ferven": [0, 10, 140, 205, 247, 289], "ag86": [0, 10, 140, 205, 247, 289], "mediterraneu": [0, 10, 140, 205, 247, 289], "p6b11": [0, 10, 140, 205, 247, 289], "rhizosphera": [0, 10, 140, 205, 247, 289], "16068": [0, 10, 140, 205, 247, 289], "14675": [0, 10, 140, 205, 247, 289], "linepithema": [0, 10, 140, 205, 247, 289], "humil": [0, 10, 140, 205, 247, 289], "parachlamydia": [0, 10, 140, 205, 247, 289], "uv": [0, 10, 140, 205, 247, 289], "psittaci": [0, 10, 140, 205, 247, 289], "10_1398_11": [0, 10, 140, 205, 247, 289], "s26": [0, 10, 140, 205, 247, 289], "fe": [0, 10, 140, 205, 247, 289], "gpic": [0, 10, 140, 205, 247, 289], "tw": [0, 10, 140, 205, 247, 289], "183": [0, 10, 140, 205, 247, 289], "md56": [0, 10, 140, 205, 247, 289], "muridarum": [0, 10, 140, 205, 247, 289], "nigg": [0, 10, 140, 205, 247, 289], "simkania": [0, 10, 140, 205, 247, 289], "negevensi": [0, 10, 140, 205, 247, 289], "leclercia": [0, 10, 140, 205, 247, 289], "adecarboxylata": [0, 10, 140, 205, 247, 289], "23216": [0, 10, 140, 205, 247, 289], "102595": [0, 10, 140, 205, 247, 289], "11664": [0, 10, 140, 205, 247, 289], "succinimona": [0, 10, 140, 205, 247, 289], "amylolytica": [0, 10, 140, 205, 247, 289], "2873": [0, 10, 140, 205, 247, 289], "succinivibrio": [0, 10, 140, 205, 247, 289], "dextrinosolven": [0, 10, 140, 205, 247, 289], "h5": [0, 10, 140, 205, 247, 289], "conorhini": [0, 10, 140, 205, 247, 289], "methanocorpusculum": [0, 10, 140, 205, 247, 289], "labreanum": [0, 10, 140, 205, 247, 289], "bourgensi": [0, 10, 140, 205, 247, 289], "ms2": [0, 10, 140, 205, 247, 289], "autoethanogenum": [0, 10, 140, 205, 247, 289], "10061": [0, 10, 140, 205, 247, 289], "9693": [0, 10, 140, 205, 247, 289], "alkanivoran": [0, 10, 140, 205, 247, 289], "16433": [0, 10, 140, 205, 247, 289], "slackia": [0, 10, 140, 205, 247, 289], "exigua": [0, 10, 140, 205, 247, 289], "700122": [0, 10, 140, 205, 247, 289], "heliotrinireducen": [0, 10, 140, 205, 247, 289], "20476": [0, 10, 140, 205, 247, 289], "eggerthella": [0, 10, 140, 205, 247, 289], "lenta": [0, 10, 140, 205, 247, 289], "2243": [0, 10, 140, 205, 247, 289], "m325": [0, 10, 140, 205, 247, 289], "bergeri": [0, 10, 140, 205, 247, 289], "700627": [0, 10, 140, 205, 247, 289], "profundu": [0, 10, 140, 205, 247, 289], "5631": [0, 10, 140, 205, 247, 289], "magneticum": [0, 10, 140, 205, 247, 289], "amb": [0, 10, 140, 205, 247, 289], "cryptobacterium": [0, 10, 140, 205, 247, 289], "curtum": [0, 10, 140, 205, 247, 289], "15641": [0, 10, 140, 205, 247, 289], "pw": [0, 10, 140, 205, 247, 289], "murdochii": [0, 10, 140, 205, 247, 289], "12563": [0, 10, 140, 205, 247, 289], "hippea": [0, 10, 140, 205, 247, 289], "10411": [0, 10, 140, 205, 247, 289], "lysobact": [0, 10, 140, 205, 247, 289], "antibioticu": [0, 10, 140, 205, 247, 289], "8102": [0, 10, 140, 205, 247, 289], "asinigenitali": [0, 10, 140, 205, 247, 289], "mce3": [0, 10, 140, 205, 247, 289], "polyisoprenivoran": [0, 10, 140, 205, 247, 289], "vh2": [0, 10, 140, 205, 247, 289], "hellenicu": [0, 10, 140, 205, 247, 289], "12710": [0, 10, 140, 205, 247, 289], "odyssella": [0, 10, 140, 205, 247, 289], "thessalonicensi": [0, 10, 140, 205, 247, 289], "l13": [0, 10, 140, 205, 247, 289], "anthracocysti": [0, 10, 140, 205, 247, 289], "flocculosa": [0, 10, 140, 205, 247, 289], "moesziomyc": [0, 10, 140, 205, 247, 289], "aphidi": [0, 10, 140, 205, 247, 289], "70725": [0, 10, 140, 205, 247, 289], "beutenbergia": [0, 10, 140, 205, 247, 289], "caverna": [0, 10, 140, 205, 247, 289], "12333": [0, 10, 140, 205, 247, 289], "desulfotalea": [0, 10, 140, 205, 247, 289], "lsv54": [0, 10, 140, 205, 247, 289], "brachyrhyncho": [0, 10, 140, 205, 247, 289], "pseudarthrobact": [0, 10, 140, 205, 247, 289], "chlorophenolicu": [0, 10, 140, 205, 247, 289], "a6": [0, 10, 140, 205, 247, 289], "clogmia": [0, 10, 140, 205, 247, 289], "albipunctata": [0, 10, 140, 205, 247, 289], "varigena": [0, 10, 140, 205, 247, 289], "1296": [0, 10, 140, 205, 247, 289], "relictum": [0, 10, 140, 205, 247, 289], "mz1t": [0, 10, 140, 205, 247, 289], "clementina": [0, 10, 140, 205, 247, 289], "dicoccoid": [0, 10, 140, 205, 247, 289], "xylosoxidan": [0, 10, 140, 205, 247, 289], "a8": [0, 10, 140, 205, 247, 289], "tribocorum": [0, 10, 140, 205, 247, 289], "105476": [0, 10, 140, 205, 247, 289], "thermacetogenium": [0, 10, 140, 205, 247, 289], "phaeum": [0, 10, 140, 205, 247, 289], "12270": [0, 10, 140, 205, 247, 289], "sphaerulina": [0, 10, 140, 205, 247, 289], "musiva": [0, 10, 140, 205, 247, 289], "serpula": [0, 10, 140, 205, 247, 289], "lacryman": [0, 10, 140, 205, 247, 289], "pecorum": [0, 10, 140, 205, 247, 289], "e58": [0, 10, 140, 205, 247, 289], "cladophialophora": [0, 10, 140, 205, 247, 289], "carrionii": [0, 10, 140, 205, 247, 289], "rhinocladiella": [0, 10, 140, 205, 247, 289], "mackenziei": [0, 10, 140, 205, 247, 289], "650": [0, 10, 140, 205, 247, 289], "arenibact": [0, 10, 140, 205, 247, 289], "latericiu": [0, 10, 140, 205, 247, 289], "15913": [0, 10, 140, 205, 247, 289], "syntrophothermu": [0, 10, 140, 205, 247, 289], "lipocalidu": [0, 10, 140, 205, 247, 289], "12680": [0, 10, 140, 205, 247, 289], "phaseolibact": [0, 10, 140, 205, 247, 289], "flecten": [0, 10, 140, 205, 247, 289], "12775": [0, 10, 140, 205, 247, 289], "saccharophagu": [0, 10, 140, 205, 247, 289], "degradan": [0, 10, 140, 205, 247, 289], "flexu": [0, 10, 140, 205, 247, 289], "t6186": [0, 10, 140, 205, 247, 289], "haloduran": [0, 10, 140, 205, 247, 289], "125": [0, 2, 10, 140, 205, 247, 289], "propionispira": [0, 10, 140, 205, 247, 289], "raffinosivoran": [0, 10, 140, 205, 247, 289], "20765": [0, 10, 140, 205, 247, 289], "sourekii": [0, 10, 140, 205, 247, 289], "700629": [0, 10, 140, 205, 247, 289], "17616": [0, 10, 140, 205, 247, 289], "primitia": [0, 10, 140, 205, 247, 289], "za": [0, 10, 140, 205, 247, 289], "eremococcu": [0, 10, 140, 205, 247, 289], "coleocola": [0, 10, 140, 205, 247, 289], "15696": [0, 10, 140, 205, 247, 289], "igniterra": [0, 10, 140, 205, 247, 289], "700962": [0, 10, 140, 205, 247, 289], "antranikianii": [0, 10, 140, 205, 247, 289], "12462": [0, 10, 140, 205, 247, 289], "longicatena": [0, 10, 140, 205, 247, 289], "agr2136": [0, 10, 140, 205, 247, 289], "cyclospora": [0, 10, 140, 205, 247, 289], "cayetanensi": [0, 10, 140, 205, 247, 289], "abdita": [0, 10, 140, 205, 247, 289], "21756": [0, 10, 140, 205, 247, 289], "ceratocysti": [0, 10, 140, 205, 247, 289], "platani": [0, 10, 140, 205, 247, 289], "spielmanii": [0, 10, 140, 205, 247, 289], "a14": [0, 10, 140, 205, 247, 289], "yeochonensi": [0, 10, 140, 205, 247, 289], "cn732": [0, 10, 140, 205, 247, 289], "amicali": [0, 10, 140, 205, 247, 289], "ccma": [0, 10, 140, 205, 247, 289], "559": [0, 10, 140, 205, 247, 289], "terpenotabidum": [0, 10, 140, 205, 247, 289], "pomeroyi": [0, 10, 140, 205, 247, 289], "dss": [0, 10, 140, 205, 247, 289], "amethystina": [0, 10, 140, 205, 247, 289], "laam": [0, 10, 140, 205, 247, 289], "bubalu": [0, 10, 140, 205, 247, 289], "bubali": [0, 10, 140, 205, 247, 289], "bantiana": [0, 10, 140, 205, 247, 289], "173": [0, 10, 140, 205, 247, 289], "19149": [0, 10, 140, 205, 247, 289], "oligella": [0, 10, 140, 205, 247, 289], "ureolytica": [0, 10, 140, 205, 247, 289], "18253": [0, 10, 140, 205, 247, 289], "urethrali": [0, 10, 140, 205, 247, 289], "dnf00040": [0, 10, 140, 205, 247, 289], "absidia": [0, 10, 140, 205, 247, 289], "repen": [0, 10, 140, 205, 247, 289], "camelina": [0, 10, 140, 205, 247, 289], "15381": [0, 10, 140, 205, 247, 289], "milo": [0, 10, 140, 205, 247, 289], "t1": [0, 10, 140, 205, 247, 289], "thiomicrorhabdu": [0, 10, 140, 205, 247, 289], "t2": [0, 10, 140, 205, 247, 289], "enterovibrio": [0, 10, 140, 205, 247, 289], "calviensi": [0, 10, 140, 205, 247, 289], "1f": [0, 10, 140, 205, 247, 289], "polist": [0, 10, 140, 205, 247, 289], "7335": [0, 10, 140, 205, 247, 289], "udagawa": [0, 10, 140, 205, 247, 289], "paracaedibact": [0, 10, 140, 205, 247, 289], "ambiguu": [0, 10, 140, 205, 247, 289], "portiera": [0, 10, 140, 205, 247, 289], "aleyrodidarum": [0, 10, 140, 205, 247, 289], "bt": [0, 10, 140, 205, 247, 289], "qvlc": [0, 10, 140, 205, 247, 289], "spinifera": [0, 10, 140, 205, 247, 289], "hortaea": [0, 10, 140, 205, 247, 289], "werneckii": [0, 10, 140, 205, 247, 289], "koehlera": [0, 10, 140, 205, 247, 289], "29": [0, 10, 140, 183, 191, 194, 205, 247, 289], "aerophila": [0, 10, 140, 205, 247, 289], "al3": [0, 10, 140, 205, 247, 289], "1941": [0, 10, 140, 205, 247, 289], "acridum": [0, 10, 140, 205, 247, 289], "cqma": [0, 10, 140, 205, 247, 289], "102": [0, 10, 140, 167, 205, 247, 289], "frisingens": [0, 10, 140, 205, 247, 289], "gsf30": [0, 10, 140, 205, 247, 289], "fischerella": [0, 10, 140, 205, 247, 289], "muscicola": [0, 10, 140, 205, 247, 289], "7414": [0, 10, 140, 205, 247, 289], "ketogulonicigenium": [0, 10, 140, 205, 247, 289], "wsh": [0, 10, 140, 205, 247, 289], "pandoraea": [0, 10, 140, 205, 247, 289], "apista": [0, 10, 140, 205, 247, 289], "pnomenusa": [0, 10, 140, 205, 247, 289], "pulmonicola": [0, 10, 140, 205, 247, 289], "pseudaminobact": [0, 10, 140, 205, 247, 289], "salicylatoxidan": [0, 10, 140, 205, 247, 289], "kct001": [0, 10, 140, 205, 247, 289], "hoshina": [0, 10, 140, 205, 247, 289], "105699": [0, 10, 140, 205, 247, 289], "33379": [0, 10, 140, 205, 247, 289], "pennivoran": [0, 10, 140, 205, 247, 289], "9078": [0, 10, 140, 205, 247, 289], "exserohilum": [0, 10, 140, 205, 247, 289], "turcicum": [0, 10, 140, 205, 247, 289], "roseivivax": [0, 10, 140, 205, 247, 289], "10272": [0, 10, 140, 205, 247, 289], "cerasi": [0, 10, 140, 205, 247, 289], "petrophila": [0, 10, 140, 205, 247, 289], "rku": [0, 10, 140, 205, 247, 289], "naphthophila": [0, 10, 140, 205, 247, 289], "thermicanu": [0, 10, 140, 205, 247, 289], "aegyptiu": [0, 10, 140, 205, 247, 289], "12793": [0, 10, 140, 205, 247, 289], "rhizophagu": [0, 10, 140, 205, 247, 289], "claru": [0, 10, 140, 205, 247, 289], "ramlibact": [0, 10, 140, 205, 247, 289], "tataouinensi": [0, 10, 140, 205, 247, 289], "ttb310": [0, 10, 140, 205, 247, 289], "paradoxum": [0, 10, 140, 205, 247, 289], "dyadobact": [0, 10, 140, 205, 247, 289], "18053": [0, 10, 140, 205, 247, 289], "petrii": [0, 10, 140, 205, 247, 289], "intermedium": [0, 10, 140, 205, 247, 289], "3301": [0, 10, 140, 205, 247, 289], "besnoitia": [0, 10, 140, 205, 247, 289], "besnoiti": [0, 10, 140, 205, 247, 289], "1221n": [0, 10, 140, 205, 247, 289], "gaviali": [0, 10, 140, 205, 247, 289], "gangeticu": [0, 10, 140, 205, 247, 289], "pametensi": [0, 10, 140, 205, 247, 289], "51478": [0, 10, 140, 205, 247, 289], "cenocepacia": [0, 10, 140, 205, 247, 289], "j2315": [0, 10, 140, 205, 247, 289], "fallonii": [0, 10, 140, 205, 247, 289], "llap": [0, 10, 140, 205, 247, 289], "psychrophilum": [0, 10, 140, 205, 247, 289], "jip02": [0, 10, 140, 205, 247, 289], "hamsteri": [0, 10, 140, 205, 247, 289], "5661": [0, 10, 140, 205, 247, 289], "6256": [0, 10, 140, 205, 247, 289], "halobacteriovorax": [0, 10, 140, 205, 247, 289], "sj": [0, 10, 140, 205, 247, 289], "eutypa": [0, 10, 140, 205, 247, 289], "lata": [0, 10, 140, 205, 247, 289], "phaethon": [0, 10, 140, 205, 247, 289], "lepturu": [0, 10, 140, 205, 247, 289], "asf360": [0, 10, 140, 205, 247, 289], "md294": [0, 10, 140, 205, 247, 289], "plexicaudatum": [0, 10, 140, 205, 247, 289], "asf492": [0, 10, 140, 205, 247, 289], "ferroplasma": [0, 10, 140, 205, 247, 289], "acidarmanu": [0, 10, 140, 205, 247, 289], "fer1": [0, 10, 140, 205, 247, 289], "acetomicrobium": [0, 10, 140, 205, 247, 289], "13181": [0, 10, 140, 205, 247, 289], "lm1": [0, 10, 140, 205, 247, 289], "periconia": [0, 10, 140, 205, 247, 289], "macrospinosa": [0, 10, 140, 205, 247, 289], "oxb": [0, 10, 140, 205, 247, 289], "drechmeria": [0, 10, 140, 205, 247, 289], "coniospora": [0, 10, 140, 205, 247, 289], "septicum": [0, 10, 140, 205, 247, 289], "44393": [0, 10, 140, 205, 247, 289], "phlebia": [0, 10, 140, 205, 247, 289], "centrifuga": [0, 10, 140, 205, 247, 289], "oguniens": [0, 10, 140, 205, 247, 289], "te7": [0, 10, 140, 205, 247, 289], "hammondia": [0, 10, 140, 205, 247, 289], "hammondi": [0, 10, 140, 205, 247, 289], "frigidarium": [0, 10, 140, 205, 247, 289], "17623": [0, 10, 140, 205, 247, 289], "7507": [0, 10, 140, 205, 247, 289], "austwickia": [0, 10, 140, 205, 247, 289], "105200": [0, 10, 140, 205, 247, 289], "onion": [0, 10, 140, 205, 247, 289], "yellow": [0, 10, 140, 205, 247, 289], "chloroherpeton": [0, 10, 140, 205, 247, 289], "thalassium": [0, 10, 140, 205, 247, 289], "35110": [0, 10, 140, 205, 247, 289], "longisporum": [0, 10, 140, 205, 247, 289], "madurella": [0, 10, 140, 205, 247, 289], "mycetomati": [0, 10, 140, 205, 247, 289], "ochengi": [0, 10, 140, 205, 247, 289], "pseudograminearum": [0, 10, 140, 205, 247, 289], "cs3096": [0, 10, 140, 205, 247, 289], "choanephora": [0, 10, 140, 205, 247, 289], "cucurbitarum": [0, 10, 140, 205, 247, 289], "hesseltinella": [0, 10, 140, 205, 247, 289], "vesiculosa": [0, 10, 140, 205, 247, 289], "methanomethylovoran": [0, 10, 140, 205, 247, 289], "15978": [0, 10, 140, 205, 247, 289], "asperellum": [0, 10, 140, 205, 247, 289], "433": [0, 10, 140, 205, 247, 289], "97": [0, 10, 140, 165, 169, 171, 205, 216, 247, 257, 289, 301, 324, 325], "saprolegnia": [0, 10, 140, 205, 247, 289], "223": [0, 10, 140, 205, 247, 289], "aequorivita": [0, 10, 140, 205, 247, 289], "sublithincola": [0, 10, 140, 205, 247, 289], "14238": [0, 10, 140, 205, 247, 289], "interdigital": [0, 10, 140, 205, 247, 289], "h6": [0, 10, 140, 205, 247, 289], "blochmannia": [0, 10, 140, 205, 247, 289], "pennsylvanicu": [0, 10, 140, 205, 247, 289], "bpen": [0, 10, 140, 205, 247, 289], "ubonensi": [0, 10, 140, 205, 247, 289], "msmb22": [0, 10, 140, 205, 247, 289], "tetrasphaera": [0, 10, 140, 205, 247, 289], "lp2": [0, 10, 140, 205, 247, 289], "glarea": [0, 10, 140, 205, 247, 289], "lozoyensi": [0, 10, 140, 205, 247, 289], "20868": [0, 10, 140, 205, 247, 289], "mume": [0, 10, 140, 205, 247, 289], "stanieria": [0, 10, 140, 205, 247, 289], "cyanosphaera": [0, 10, 140, 205, 247, 289], "7437": [0, 10, 140, 205, 247, 289], "xenococcu": [0, 10, 140, 205, 247, 289], "7305": [0, 10, 140, 205, 247, 289], "7375": [0, 10, 140, 205, 247, 289], "desulfalla": [0, 10, 140, 205, 247, 289], "gibsonia": [0, 10, 140, 205, 247, 289], "7213": [0, 10, 140, 205, 247, 289], "solobacterium": [0, 10, 140, 205, 247, 289], "moorei": [0, 10, 140, 205, 247, 289], "22971": [0, 10, 140, 205, 247, 289], "gloeocapsa": [0, 10, 140, 205, 247, 289], "73106": [0, 10, 140, 205, 247, 289], "cyanobacterium": [0, 10, 140, 205, 247, 289], "7202": [0, 10, 140, 205, 247, 289], "infantariu": [0, 10, 140, 205, 247, 289], "cj18": [0, 10, 140, 205, 247, 289], "penneri": [0, 10, 140, 205, 247, 289], "35198": [0, 10, 140, 205, 247, 289], "didelphi": [0, 10, 140, 205, 247, 289], "15616": [0, 10, 140, 205, 247, 289], "acromyrmex": [0, 10, 140, 205, 247, 289], "echinatior": [0, 10, 140, 205, 247, 289], "vavraia": [0, 10, 140, 205, 247, 289], "floridensi": [0, 10, 140, 205, 247, 289], "coleocani": [0, 10, 140, 205, 247, 289], "15436": [0, 10, 140, 205, 247, 289], "urogenitali": [0, 10, 140, 205, 247, 289], "15434": [0, 10, 140, 205, 247, 289], "7120": [0, 10, 140, 205, 247, 289], "fachb": [0, 10, 140, 205, 247, 289], "418": [0, 10, 140, 205, 247, 289], "saccharothrix": [0, 10, 140, 205, 247, 289], "espanaensi": [0, 10, 140, 205, 247, 289], "44229": [0, 10, 140, 205, 247, 289], "columbina": [0, 10, 140, 205, 247, 289], "16469": [0, 10, 140, 205, 247, 289], "pyridinivoran": [0, 10, 140, 205, 247, 289], "sb3094": [0, 10, 140, 205, 247, 289], "hinzii": [0, 10, 140, 205, 247, 289], "51730": [0, 10, 140, 205, 247, 289], "oscillochlori": [0, 10, 140, 205, 247, 289], "trichoid": [0, 10, 140, 205, 247, 289], "dg": [0, 10, 140, 205, 247, 289], "brasilianum": [0, 10, 140, 205, 247, 289], "postia": [0, 10, 140, 205, 247, 289], "placenta": [0, 10, 140, 205, 247, 289], "mad": [0, 10, 140, 205, 247, 289], "698": [0, 10, 140, 205, 247, 289], "gloeophyllum": [0, 10, 140, 205, 247, 289], "trabeum": [0, 10, 140, 205, 247, 289], "camponotu": [0, 10, 140, 205, 247, 289], "floridanu": [0, 10, 140, 205, 247, 289], "39006": [0, 10, 140, 205, 247, 289], "hs1": [0, 10, 140, 205, 247, 289], "amylolentu": [0, 10, 140, 205, 247, 289], "adineta": [0, 10, 140, 205, 247, 289], "vaga": [0, 10, 140, 205, 247, 289], "mannitolilytica": [0, 10, 140, 205, 247, 289], "streptacidiphilu": [0, 10, 140, 205, 247, 289], "neutrinimicu": [0, 10, 140, 205, 247, 289], "carboni": [0, 10, 140, 205, 247, 289], "desulfohalotomaculum": [0, 10, 140, 205, 247, 289], "alkaliphilum": [0, 10, 140, 205, 247, 289], "12257": [0, 10, 140, 205, 247, 289], "valsa": [0, 10, 140, 205, 247, 289], "pyri": [0, 10, 140, 205, 247, 289], "methylibium": [0, 10, 140, 205, 247, 289], "petroleiphilum": [0, 10, 140, 205, 247, 289], "pm1": [0, 10, 140, 205, 247, 289], "epicoccum": [0, 10, 140, 205, 247, 289], "nigrum": [0, 10, 140, 205, 247, 289], "cryptoterm": [0, 10, 140, 205, 247, 289], "secundu": [0, 10, 140, 205, 247, 289], "anaerostip": [0, 10, 140, 205, 247, 289], "14662": [0, 10, 140, 205, 247, 289], "leucosporidium": [0, 10, 140, 205, 247, 289], "creatinivorum": [0, 10, 140, 205, 247, 289], "casuarina": [0, 10, 140, 205, 247, 289], "siderophilu": [0, 10, 140, 205, 247, 289], "sr4": [0, 10, 140, 205, 247, 289], "pseudoflavonifractor": [0, 10, 140, 205, 247, 289], "capillosu": [0, 10, 140, 205, 247, 289], "29799": [0, 10, 140, 205, 247, 289], "cupriavidu": [0, 10, 140, 205, 247, 289], "h16": [0, 10, 140, 205, 247, 289], "ensif": [0, 10, 140, 205, 247, 289], "ov14": [0, 10, 140, 205, 247, 289], "berezinia": [0, 10, 140, 205, 247, 289], "guillouia": [0, 10, 140, 205, 247, 289], "niph": [0, 10, 140, 205, 247, 289], "991": [0, 10, 140, 205, 247, 289], "ruh2624": [0, 10, 140, 205, 247, 289], "tenacibaculum": [0, 10, 140, 205, 247, 289], "maritimum": [0, 10, 140, 205, 247, 289], "lw3": [0, 10, 140, 205, 247, 289], "pw1": [0, 10, 140, 205, 247, 289], "opitutu": [0, 10, 140, 205, 247, 289], "pb90": [0, 10, 140, 205, 247, 289], "velox": [0, 10, 140, 205, 247, 289], "12556": [0, 10, 140, 205, 247, 289], "italicu": [0, 10, 140, 205, 247, 289], "ab9": [0, 10, 140, 205, 247, 289], "falsenii": [0, 10, 140, 205, 247, 289], "44353": [0, 10, 140, 205, 247, 289], "platensi": [0, 10, 140, 205, 247, 289], "11748": [0, 10, 140, 205, 247, 289], "ursingii": [0, 10, 140, 205, 247, 289], "16037": [0, 10, 140, 205, 247, 289], "107286": [0, 10, 140, 205, 247, 289], "schindleri": [0, 10, 140, 205, 247, 289], "900": [0, 10, 140, 205, 247, 289], "monacensi": [0, 10, 140, 205, 247, 289], "anaerovorax": [0, 10, 140, 205, 247, 289], "odorimutan": [0, 10, 140, 205, 247, 289], "5092": [0, 10, 140, 205, 247, 289], "trevisanii": [0, 10, 140, 205, 247, 289], "22070": [0, 10, 140, 205, 247, 289], "varroa": [0, 10, 140, 205, 247, 289], "brandtii": [0, 10, 140, 205, 247, 289], "galerina": [0, 10, 140, 205, 247, 289], "marginata": [0, 10, 140, 205, 247, 289], "339": [0, 10, 140, 205, 247, 289], "88": [0, 10, 140, 165, 166, 167, 205, 247, 289], "spizellomyc": [0, 10, 140, 205, 247, 289], "115": [0, 10, 140, 205, 247, 289], "chn": [0, 10, 140, 205, 247, 289], "jam81": [0, 10, 140, 205, 247, 289], "catenaria": [0, 10, 140, 205, 247, 289], "anguillula": [0, 10, 140, 205, 247, 289], "pl171": [0, 10, 140, 205, 247, 289], "vermifera": [0, 10, 140, 205, 247, 289], "305830": [0, 10, 140, 205, 247, 289], "nocardioid": [0, 10, 140, 205, 247, 289], "cf8": [0, 10, 140, 205, 247, 289], "medica": [0, 10, 140, 205, 247, 289], "wsm419": [0, 10, 140, 205, 247, 289], "gregarina": [0, 10, 140, 205, 247, 289], "niphandrod": [0, 10, 140, 205, 247, 289], "pelotomaculum": [0, 10, 140, 205, 247, 289], "thermopropionicum": [0, 10, 140, 205, 247, 289], "si": [0, 10, 140, 205, 247, 289], "vanbaalenii": [0, 10, 140, 205, 247, 289], "cc9605": [0, 10, 140, 205, 247, 289], "cc9616": [0, 10, 140, 205, 247, 289], "tef": [0, 10, 140, 205, 247, 289], "gula": [0, 10, 140, 205, 247, 289], "muricauda": [0, 10, 140, 205, 247, 289], "ruestringensi": [0, 10, 140, 205, 247, 289], "13258": [0, 10, 140, 205, 247, 289], "birtlesii": [0, 10, 140, 205, 247, 289], "e11": [0, 10, 140, 205, 247, 289], "kineosphaera": [0, 10, 140, 205, 247, 289], "limosa": [0, 10, 140, 205, 247, 289], "100340": [0, 10, 140, 205, 247, 289], "7376": [0, 10, 140, 205, 247, 289], "sulfurisphaera": [0, 10, 140, 205, 247, 289], "tokodaii": [0, 10, 140, 205, 247, 289], "ignatzschineria": [0, 10, 140, 205, 247, 289], "13226": [0, 10, 140, 205, 247, 289], "aphanomyc": [0, 10, 140, 205, 247, 289], "astaci": [0, 10, 140, 205, 247, 289], "diclina": [0, 10, 140, 205, 247, 289], "minimu": [0, 10, 140, 205, 247, 289], "ramularia": [0, 10, 140, 205, 247, 289], "collo": [0, 10, 140, 205, 247, 289], "cygni": [0, 10, 140, 205, 247, 289], "villorum": [0, 10, 140, 205, 247, 289], "700913": [0, 10, 140, 205, 247, 289], "700641": [0, 10, 140, 205, 247, 289], "pseudocercospora": [0, 10, 140, 205, 247, 289], "pseudoramibact": [0, 10, 140, 205, 247, 289], "alactolyticu": [0, 10, 140, 205, 247, 289], "23263": [0, 10, 140, 205, 247, 289], "melitaea": [0, 10, 140, 205, 247, 289], "cinxia": [0, 10, 140, 205, 247, 289], "tv2a": [0, 10, 140, 205, 247, 289], "globisporu": [0, 10, 140, 205, 247, 289], "43857": [0, 10, 140, 205, 247, 289], "tetrapisispora": [0, 10, 140, 205, 247, 289], "phaffii": [0, 10, 140, 205, 247, 289], "4417": [0, 10, 140, 205, 247, 289], "geoglobu": [0, 10, 140, 205, 247, 289], "ahangari": [0, 10, 140, 205, 247, 289], "dichomitu": [0, 10, 140, 205, 247, 289], "squalen": [0, 10, 140, 205, 247, 289], "lyad": [0, 10, 140, 205, 247, 289], "carsonella": [0, 10, 140, 205, 247, 289], "ruddii": [0, 10, 140, 205, 247, 289], "fumosorosea": [0, 10, 140, 205, 247, 289], "2679": [0, 10, 140, 205, 247, 289], "mikata": [0, 10, 140, 205, 247, 289], "278": [0, 10, 140, 205, 247, 289], "nodulan": [0, 10, 140, 205, 247, 289], "2060": [0, 10, 140, 205, 247, 289], "alkaliphilu": [0, 10, 140, 205, 247, 289], "transvaalensi": [0, 10, 140, 205, 247, 289], "700919": [0, 10, 140, 205, 247, 289], "orisratti": [0, 10, 140, 205, 247, 289], "15617": [0, 10, 140, 205, 247, 289], "agr0001": [0, 10, 140, 205, 247, 289], "columbinum": [0, 10, 140, 205, 247, 289], "sf7": [0, 10, 140, 205, 247, 289], "phoroni": [0, 10, 140, 205, 247, 289], "iwayama": [0, 10, 140, 205, 247, 289], "15354": [0, 10, 140, 205, 247, 289], "andersoni": [0, 10, 140, 205, 247, 289], "walkeri": [0, 10, 140, 205, 247, 289], "verticillioid": [0, 10, 140, 205, 247, 289], "sphingopyxi": [0, 10, 140, 205, 247, 289], "rb2256": [0, 10, 140, 205, 247, 289], "denitrovibrio": [0, 10, 140, 205, 247, 289], "acetiphilu": [0, 10, 140, 205, 247, 289], "12809": [0, 10, 140, 205, 247, 289], "7319": [0, 10, 140, 205, 247, 289], "6802": [0, 10, 140, 205, 247, 289], "picoid": [0, 10, 140, 205, 247, 289], "pubescen": [0, 10, 140, 205, 247, 289], "beauveria": [0, 10, 140, 205, 247, 289], "brongniartii": [0, 10, 140, 205, 247, 289], "rcef": [0, 10, 140, 205, 247, 289], "oscillatoria": [0, 10, 140, 205, 247, 289], "6304": [0, 10, 140, 205, 247, 289], "arthrospira": [0, 10, 140, 205, 247, 289], "39": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "noctiflora": [0, 10, 140, 205, 247, 289], "bulleidia": [0, 10, 140, 205, 247, 289], "extructa": [0, 10, 140, 205, 247, 289], "w1219": [0, 10, 140, 205, 247, 289], "lipot": [0, 10, 140, 205, 247, 289], "vexillif": [0, 10, 140, 205, 247, 289], "metalliduran": [0, 10, 140, 205, 247, 289], "ch34": [0, 10, 140, 205, 247, 289], "pseudothermotoga": [0, 10, 140, 205, 247, 289], "thermarum": [0, 10, 140, 205, 247, 289], "5069": [0, 10, 140, 205, 247, 289], "syntrophobact": [0, 10, 140, 205, 247, 289], "fumaroxidan": [0, 10, 140, 205, 247, 289], "mpob": [0, 10, 140, 205, 247, 289], "microcoleu": [0, 10, 140, 205, 247, 289], "vaginatu": [0, 10, 140, 205, 247, 289], "fgp": [0, 10, 140, 205, 247, 289], "sonorensi": [0, 10, 140, 205, 247, 289], "l12": [0, 10, 140, 205, 247, 289], "marinomona": [0, 10, 140, 205, 247, 289], "mediterranea": [0, 10, 140, 205, 247, 289], "mmb": [0, 10, 140, 205, 247, 289], "hordei": [0, 10, 140, 205, 247, 289], "uh4857": [0, 10, 140, 205, 247, 289], "pinnipediali": [0, 10, 140, 205, 247, 289], "b2": [0, 10, 140, 205, 247, 289], "ceti": [0, 10, 140, 205, 247, 289], "m644": [0, 10, 140, 205, 247, 289], "roseiflexu": [0, 10, 140, 205, 247, 289], "castenholzii": [0, 10, 140, 205, 247, 289], "13941": [0, 10, 140, 205, 247, 289], "ferrimicrobium": [0, 10, 140, 205, 247, 289], "acidiphilum": [0, 10, 140, 205, 247, 289], "19497": [0, 10, 140, 205, 247, 289], "helicocarpu": [0, 10, 140, 205, 247, 289], "uamh5409": [0, 10, 140, 205, 247, 289], "suimastitidi": [0, 10, 140, 205, 247, 289], "15538": [0, 10, 140, 205, 247, 289], "pediculu": [0, 10, 140, 205, 247, 289], "humanu": [0, 10, 140, 205, 247, 289], "arsenaticum": [0, 10, 140, 205, 247, 289], "13514": [0, 10, 140, 205, 247, 289], "xenophagum": [0, 10, 140, 205, 247, 289], "qyi": [0, 10, 140, 205, 247, 289], "tauraco": [0, 10, 140, 205, 247, 289], "erythrolophu": [0, 10, 140, 205, 247, 289], "pannonibact": [0, 10, 140, 205, 247, 289], "phragmitetu": [0, 10, 140, 205, 247, 289], "14782": [0, 10, 140, 205, 247, 289], "ska34": [0, 10, 140, 205, 247, 289], "paracoccidioid": [0, 10, 140, 205, 247, 289], "diaphorina": [0, 10, 140, 205, 247, 289], "cercospora": [0, 10, 140, 205, 247, 289], "beticola": [0, 10, 140, 205, 247, 289], "herbariu": [0, 10, 140, 205, 247, 289], "13609": [0, 10, 140, 205, 247, 289], "5491": [0, 10, 140, 205, 247, 289], "trematum": [0, 10, 140, 205, 247, 289], "yim": [0, 10, 140, 205, 247, 289], "90004": [0, 10, 140, 205, 247, 289], "thiolinea": [0, 10, 140, 205, 247, 289], "disciformi": [0, 10, 140, 205, 247, 289], "14473": [0, 10, 140, 205, 247, 289], "thiofilum": [0, 10, 140, 205, 247, 289], "flexil": [0, 10, 140, 205, 247, 289], "14609": [0, 10, 140, 205, 247, 289], "biarmip": [0, 10, 140, 205, 247, 289], "halodesulfovibrio": [0, 10, 140, 205, 247, 289], "10141": [0, 10, 140, 205, 247, 289], "alcalifacien": [0, 10, 140, 205, 247, 289], "30120": [0, 10, 140, 205, 247, 289], "rq7": [0, 10, 140, 205, 247, 289], "rq2": [0, 10, 140, 205, 247, 289], "strigamia": [0, 10, 140, 205, 247, 289], "nipponia": [0, 10, 140, 205, 247, 289], "nippon": [0, 10, 140, 205, 247, 289], "catelliglobosispora": [0, 10, 140, 205, 247, 289], "koreensi": [0, 10, 140, 205, 247, 289], "44566": [0, 10, 140, 205, 247, 289], "santomea": [0, 10, 140, 205, 247, 289], "mpf4": [0, 10, 140, 205, 247, 289], "328": [0, 10, 140, 205, 247, 289], "carboxydothermu": [0, 10, 140, 205, 247, 289], "hydrogenoforman": [0, 10, 140, 205, 247, 289], "2901": [0, 10, 140, 205, 247, 289], "halobiforma": [0, 10, 140, 205, 247, 289], "nitratireducen": [0, 10, 140, 205, 247, 289], "10879": [0, 10, 140, 205, 247, 289], "galdieria": [0, 10, 140, 205, 247, 289], "sulphuraria": [0, 10, 140, 205, 247, 289], "capitovi": [0, 10, 140, 205, 247, 289], "44611": [0, 10, 140, 205, 247, 289], "turicensi": [0, 10, 140, 205, 247, 289], "col4": [0, 10, 140, 205, 247, 289], "13458": [0, 10, 140, 205, 247, 289], "kineococcu": [0, 10, 140, 205, 247, 289], "srs30216": [0, 10, 140, 205, 247, 289], "impatien": [0, 10, 140, 205, 247, 289], "glomeribact": [0, 10, 140, 205, 247, 289], "gigasporarum": [0, 10, 140, 205, 247, 289], "beg34": [0, 10, 140, 205, 247, 289], "veterana": [0, 10, 140, 205, 247, 289], "100344": [0, 10, 140, 205, 247, 289], "jostii": [0, 10, 140, 205, 247, 289], "rha1": [0, 10, 140, 205, 247, 289], "exiguobacterium": [0, 10, 140, 205, 247, 289], "antarcticum": [0, 10, 140, 205, 247, 289], "b7": [0, 10, 140, 205, 247, 289], "younga": [0, 10, 140, 205, 247, 289], "29220": [0, 10, 140, 205, 247, 289], "caldilinea": [0, 10, 140, 205, 247, 289], "14535": [0, 10, 140, 205, 247, 289], "104270": [0, 10, 140, 205, 247, 289], "nc": [0, 10, 140, 205, 247, 289], "methylocapsa": [0, 10, 140, 205, 247, 289], "acidiphila": [0, 10, 140, 205, 247, 289], "frankliniella": [0, 10, 140, 205, 247, 289], "leisingera": [0, 10, 140, 205, 247, 289], "methylohalidivoran": [0, 10, 140, 205, 247, 289], "14336": [0, 10, 140, 205, 247, 289], "olsenella": [0, 10, 140, 205, 247, 289], "uli": [0, 10, 140, 205, 247, 289], "7084": [0, 10, 140, 205, 247, 289], "phytomona": [0, 10, 140, 205, 247, 289], "isol": [0, 10, 140, 205, 247, 289], "em1": [0, 10, 140, 205, 247, 289], "hart1": [0, 10, 140, 205, 247, 289], "freneyi": [0, 10, 140, 205, 247, 289], "dnf00450": [0, 10, 140, 205, 247, 289], "1103": [0, 10, 140, 205, 247, 289], "gyllenbergii": [0, 10, 140, 205, 247, 289], "230": [0, 10, 140, 205, 247, 289], "fungorum": [0, 10, 140, 205, 247, 289], "ministeria": [0, 10, 140, 205, 247, 289], "vibran": [0, 10, 140, 205, 247, 289], "se50": [0, 10, 140, 205, 247, 289], "110": [0, 10, 140, 205, 247, 289], "27815": [0, 10, 140, 205, 247, 289], "flueggei": [0, 10, 140, 205, 247, 289], "43531": [0, 10, 140, 205, 247, 289], "infelix": [0, 10, 140, 205, 247, 289], "43532": [0, 10, 140, 205, 247, 289], "noxia": [0, 10, 140, 205, 247, 289], "43541": [0, 10, 140, 205, 247, 289], "daejeonensi": [0, 10, 140, 205, 247, 289], "15491": [0, 10, 140, 205, 247, 289], "cyriacigeorgica": [0, 10, 140, 205, 247, 289], "guh": [0, 10, 140, 205, 247, 289], "vulcani": [0, 10, 140, 205, 247, 289], "pss1": [0, 10, 140, 205, 247, 289], "idiomarina": [0, 10, 140, 205, 247, 289], "loihiensi": [0, 10, 140, 205, 247, 289], "l2tr": [0, 10, 140, 205, 247, 289], "brenneri": [0, 10, 140, 205, 247, 289], "endophyticu": [0, 10, 140, 205, 247, 289], "2102": [0, 10, 140, 168, 205, 247, 289], "zootermopsi": [0, 10, 140, 205, 247, 289], "nevadensi": [0, 10, 140, 205, 247, 289], "14484": [0, 10, 140, 205, 247, 289], "knoellia": [0, 10, 140, 205, 247, 289], "19936": [0, 10, 140, 205, 247, 289], "haemocani": [0, 10, 140, 205, 247, 289], "polari": [0, 10, 140, 205, 247, 289], "atopobact": [0, 10, 140, 205, 247, 289], "phoca": [0, 10, 140, 205, 247, 289], "285": [0, 2, 10, 140, 205, 247, 289], "kimchii": [0, 10, 140, 205, 247, 289], "imsnu": [0, 10, 140, 205, 247, 289], "11154": [0, 10, 140, 205, 247, 289], "lw4": [0, 10, 140, 205, 247, 289], "cibaria": [0, 10, 140, 205, 247, 289], "kacc": [0, 10, 140, 205, 247, 289], "11862": [0, 10, 140, 205, 247, 289], "37419": [0, 10, 140, 205, 247, 289], "700633": [0, 10, 140, 205, 247, 289], "hamiltonella": [0, 10, 140, 205, 247, 289], "defensa": [0, 10, 140, 205, 247, 289], "5at": [0, 10, 140, 205, 247, 289], "regiella": [0, 10, 140, 205, 247, 289], "insecticola": [0, 10, 140, 205, 247, 289], "lsr1": [0, 10, 140, 205, 247, 289], "symbiotica": [0, 10, 140, 205, 247, 289], "cinara": [0, 10, 140, 205, 247, 289], "cedri": [0, 10, 140, 205, 247, 289], "blastococcu": [0, 10, 140, 205, 247, 289], "saxobsiden": [0, 10, 140, 205, 247, 289], "dd2": [0, 10, 140, 205, 247, 289], "cetorum": [0, 10, 140, 205, 247, 289], "7128": [0, 10, 140, 205, 247, 289], "profusa": [0, 10, 140, 205, 247, 289], "f0195": [0, 10, 140, 205, 247, 289], "sistotremastrum": [0, 10, 140, 205, 247, 289], "niveocremeum": [0, 10, 140, 205, 247, 289], "hhb9708": [0, 10, 140, 205, 247, 289], "isoptericola": [0, 10, 140, 205, 247, 289], "variabili": [0, 10, 140, 205, 247, 289], "plicaturopsi": [0, 10, 140, 205, 247, 289], "crispa": [0, 10, 140, 205, 247, 289], "325": [0, 10, 140, 205, 247, 289], "teleopsi": [0, 10, 140, 205, 247, 289], "dalmanni": [0, 10, 140, 205, 247, 289], "culicifaci": [0, 10, 140, 205, 247, 289], "shimazuella": [0, 10, 140, 205, 247, 289], "kribbensi": [0, 10, 140, 205, 247, 289], "45090": [0, 10, 140, 205, 247, 289], "lachnobacterium": [0, 10, 140, 205, 247, 289], "cordifolia": [0, 10, 140, 205, 247, 289], "haemolama": [0, 10, 140, 205, 247, 289], "purdu": [0, 10, 140, 205, 247, 289], "kunsanensi": [0, 10, 140, 205, 247, 289], "44524": [0, 10, 140, 205, 247, 289], "cylindrospermum": [0, 10, 140, 205, 247, 289], "stagnal": [0, 10, 140, 205, 247, 289], "7417": [0, 10, 140, 205, 247, 289], "15288": [0, 10, 140, 205, 247, 289], "uliginosa": [0, 10, 140, 205, 247, 289], "filifactor": [0, 10, 140, 205, 247, 289], "aloci": [0, 10, 140, 205, 247, 289], "35896": [0, 10, 140, 205, 247, 289], "sulci": [0, 10, 140, 205, 247, 289], "35585": [0, 10, 140, 205, 247, 289], "diuraphi": [0, 10, 140, 205, 247, 289], "sipha": [0, 10, 140, 205, 247, 289], "flava": [0, 10, 140, 205, 247, 289], "pogonomyrmex": [0, 10, 140, 205, 247, 289], "barbatu": [0, 10, 140, 205, 247, 289], "35242": [0, 10, 140, 205, 247, 289], "h1aii": [0, 10, 140, 205, 247, 289], "methanothermobact": [0, 10, 140, 205, 247, 289], "thermautotrophicu": [0, 10, 140, 205, 247, 289], "delta": [0, 10, 140, 205, 247, 289], "marburgensi": [0, 10, 140, 205, 247, 289], "marburg": [0, 10, 140, 205, 247, 289], "rathayibact": [0, 10, 140, 205, 247, 289], "toxicu": [0, 10, 140, 205, 247, 289], "7488": [0, 10, 140, 205, 247, 289], "thermosynechococcu": [0, 10, 140, 205, 247, 289], "halorhabdu": [0, 10, 140, 205, 247, 289], "12940": [0, 10, 140, 205, 247, 289], "pseudoloma": [0, 10, 140, 205, 247, 289], "neurophilia": [0, 10, 140, 205, 247, 289], "salinibact": [0, 10, 140, 205, 247, 289], "13855": [0, 10, 140, 205, 247, 289], "griseofuscu": [0, 10, 140, 205, 247, 289], "azovibrio": [0, 10, 140, 205, 247, 289], "23866": [0, 10, 140, 205, 247, 289], "azospira": [0, 10, 140, 205, 247, 289], "collinsella": [0, 10, 140, 205, 247, 289], "13279": [0, 10, 140, 205, 247, 289], "13280": [0, 10, 140, 205, 247, 289], "albertimagni": [0, 10, 140, 205, 247, 289], "aol15": [0, 10, 140, 205, 247, 289], "cyclica": [0, 10, 140, 205, 247, 289], "alm1": [0, 10, 140, 205, 247, 289], "limnospira": [0, 10, 140, 205, 247, 289], "8005": [0, 10, 140, 205, 247, 289], "yeei": [0, 10, 140, 205, 247, 289], "599": [0, 10, 140, 205, 247, 289], "inhiben": [0, 10, 140, 205, 247, 289], "gilichinskyi": [0, 10, 140, 205, 247, 289], "iner": [0, 10, 140, 205, 247, 289], "ab": [0, 10, 140, 205, 247, 289, 324], "magnaporthiopsi": [0, 10, 140, 205, 247, 289], "pyricularia": [0, 10, 140, 205, 247, 289], "grisea": [0, 10, 140, 205, 247, 289], "phymatum": [0, 10, 140, 205, 247, 289], "stm815": [0, 10, 140, 205, 247, 289], "ingluviei": [0, 10, 140, 205, 247, 289], "autruch": [0, 10, 140, 205, 247, 289], "sulfuricurvum": [0, 10, 140, 205, 247, 289], "kujiens": [0, 10, 140, 205, 247, 289], "16994": [0, 10, 140, 205, 247, 289], "kunkeei": [0, 10, 140, 205, 247, 289], "wallemia": [0, 10, 140, 205, 247, 289], "sebi": [0, 10, 140, 205, 247, 289], "urinali": [0, 10, 140, 205, 247, 289], "2285": [0, 10, 140, 205, 247, 289], "phialocephala": [0, 10, 140, 205, 247, 289], "scopiformi": [0, 10, 140, 205, 247, 289], "marinitoga": [0, 10, 140, 205, 247, 289], "piezophila": [0, 10, 140, 205, 247, 289], "ka3": [0, 10, 140, 205, 247, 289], "lutetiensi": [0, 10, 140, 205, 247, 289], "033": [0, 10, 140, 205, 247, 289], "halonatronum": [0, 10, 140, 205, 247, 289], "13868": [0, 10, 140, 205, 247, 289], "15828": [0, 10, 140, 205, 247, 289], "insectorum": [0, 10, 140, 205, 247, 289], "264": [0, 10, 140, 205, 247, 289], "escovopsi": [0, 10, 140, 205, 247, 289], "weberi": [0, 10, 140, 205, 247, 289], "mt": [0, 10, 140, 205, 247, 289], "azotonutricium": [0, 10, 140, 205, 247, 289], "ruthenica": [0, 10, 140, 205, 247, 289], "cp76": [0, 10, 140, 205, 247, 289], "coprosui": [0, 10, 140, 205, 247, 289], "18011": [0, 10, 140, 205, 247, 289], "birgia": [0, 10, 140, 205, 247, 289], "34632": [0, 10, 140, 205, 247, 289], "xenophilu": [0, 10, 140, 205, 247, 289], "azovoran": [0, 10, 140, 205, 247, 289], "13620": [0, 10, 140, 205, 247, 289], "pseudopedobact": [0, 10, 140, 205, 247, 289], "12145": [0, 10, 140, 205, 247, 289], "9485": [0, 10, 140, 205, 247, 289], "suebicu": [0, 10, 140, 205, 247, 289], "5007": [0, 10, 140, 205, 247, 289], "3549": [0, 10, 140, 205, 247, 289], "thioalkalivibrio": [0, 10, 140, 205, 247, 289], "thiocyanoxidan": [0, 10, 140, 205, 247, 289], "arh": [0, 10, 140, 205, 247, 289], "ambifaria": [0, 10, 140, 205, 247, 289], "ammd": [0, 10, 140, 205, 247, 289], "dolosa": [0, 10, 140, 205, 247, 289], "pc543": [0, 10, 140, 205, 247, 289], "meloni": [0, 10, 140, 205, 247, 289], "dapp": [0, 10, 140, 205, 247, 289], "224": [0, 10, 140, 168, 205, 247, 289], "efficien": [0, 10, 140, 205, 247, 289], "314": [0, 10, 140, 205, 247, 289], "desulforegula": [0, 10, 140, 205, 247, 289], "conservatrix": [0, 10, 140, 205, 247, 289], "mb1pa": [0, 10, 140, 205, 247, 289], "oceanicauli": [0, 10, 140, 205, 247, 289], "alexandrii": [0, 10, 140, 205, 247, 289], "11625": [0, 10, 140, 205, 247, 289], "alysiella": [0, 10, 140, 205, 247, 289], "2578": [0, 10, 140, 205, 247, 289], "conchiformibiu": [0, 10, 140, 205, 247, 289], "steeda": [0, 10, 140, 205, 247, 289], "2580": [0, 10, 140, 205, 247, 289], "kozakia": [0, 10, 140, 205, 247, 289], "baliensi": [0, 10, 140, 205, 247, 289], "moniliophthora": [0, 10, 140, 205, 247, 289], "perniciosa": [0, 10, 140, 205, 247, 289], "fa553": [0, 10, 140, 205, 247, 289], "sporocytophaga": [0, 10, 140, 205, 247, 289], "myxococcoid": [0, 10, 140, 205, 247, 289], "al212": [0, 10, 140, 205, 247, 289], "hungatella": [0, 10, 140, 205, 247, 289], "hathewayi": [0, 10, 140, 205, 247, 289], "13479": [0, 10, 140, 205, 247, 289], "turicibact": [0, 10, 140, 205, 247, 289], "pc909": [0, 10, 140, 205, 247, 289], "thiorhodospira": [0, 10, 140, 205, 247, 289], "700588": [0, 10, 140, 205, 247, 289], "phoeniculicola": [0, 10, 140, 205, 247, 289], "412": [0, 10, 140, 205, 247, 289], "ueda107": [0, 10, 140, 205, 247, 289], "91": [0, 10, 140, 205, 247, 289], "toyonensi": [0, 10, 140, 205, 247, 289], "bct": [0, 10, 140, 205, 247, 289], "7112": [0, 10, 140, 205, 247, 289], "genomosp": [0, 10, 140, 205, 247, 289], "moraviensi": [0, 10, 140, 205, 247, 289], "383": [0, 10, 140, 205, 247, 289], "haemoperoxidu": [0, 10, 140, 205, 247, 289], "entericu": [0, 10, 140, 205, 247, 289], "14446": [0, 10, 140, 205, 247, 289], "okinawensi": [0, 10, 140, 205, 247, 289], "ih1": [0, 10, 140, 205, 247, 289], "vibrioid": [0, 10, 140, 205, 247, 289], "na1000": [0, 10, 140, 205, 247, 289], "actinokineospora": [0, 10, 140, 205, 247, 289], "enzanensi": [0, 10, 140, 205, 247, 289], "44649": [0, 10, 140, 205, 247, 289], "acaryochlori": [0, 10, 140, 205, 247, 289], "mbic11017": [0, 10, 140, 205, 247, 289], "anaeroglobu": [0, 10, 140, 205, 247, 289], "geminatu": [0, 10, 140, 205, 247, 289], "f0357": [0, 10, 140, 205, 247, 289], "tulasnella": [0, 10, 140, 205, 247, 289], "calospora": [0, 10, 140, 205, 247, 289], "mut": [0, 10, 140, 205, 247, 289], "4182": [0, 10, 140, 205, 247, 289], "alteromonadal": [0, 10, 140, 205, 247, 289], "bacterium": [0, 10, 140, 205, 247, 289], "flavobacteria": [0, 10, 140, 205, 247, 289], "bbfl7": [0, 10, 140, 205, 247, 289], "dysgonomona": [0, 10, 140, 205, 247, 289], "gadei": [0, 10, 140, 205, 247, 289], "286": [0, 10, 140, 205, 247, 289], "imitan": [0, 10, 140, 205, 247, 289], "invadan": [0, 10, 140, 205, 247, 289], "jeotgalicoccu": [0, 10, 140, 205, 247, 289], "psychrophilu": [0, 10, 140, 205, 247, 289], "19085": [0, 10, 140, 205, 247, 289], "winghamensi": [0, 10, 140, 205, 247, 289], "430": [0, 10, 140, 205, 247, 289], "pyrrhocori": [0, 10, 140, 205, 247, 289], "wadei": [0, 10, 140, 205, 247, 289], "f0279": [0, 10, 140, 205, 247, 289], "hofstadii": [0, 10, 140, 205, 247, 289], "f0254": [0, 10, 140, 205, 247, 289], "shahii": [0, 10, 140, 205, 247, 289], "19757": [0, 10, 140, 205, 247, 289], "goodfellowii": [0, 10, 140, 205, 247, 289], "f0264": [0, 10, 140, 205, 247, 289], "parafulva": [0, 10, 140, 205, 247, 289], "16636": [0, 10, 140, 205, 247, 289], "17004": [0, 10, 140, 205, 247, 289], "cremoricolorata": [0, 10, 140, 205, 247, 289], "radiata": [0, 10, 140, 205, 247, 289], "phaeomoniella": [0, 10, 140, 205, 247, 289], "chlamydospora": [0, 10, 140, 205, 247, 289], "chromohalobact": [0, 10, 140, 205, 247, 289], "3043": [0, 10, 140, 205, 247, 289], "hahella": [0, 10, 140, 205, 247, 289], "chejuensi": [0, 10, 140, 205, 247, 289], "2396": [0, 10, 140, 205, 247, 289], "folsomia": [0, 10, 140, 205, 247, 289], "cedecea": [0, 10, 140, 205, 247, 289], "davisa": [0, 10, 140, 205, 247, 289], "4568": [0, 10, 140, 205, 247, 289], "resinovorum": [0, 10, 140, 205, 247, 289], "coccinea": [0, 10, 140, 205, 247, 289], "brfm310": [0, 10, 140, 205, 247, 289], "diaporth": [0, 10, 140, 205, 247, 289], "helianthi": [0, 10, 140, 205, 247, 289], "scardovii": [0, 10, 140, 205, 247, 289], "neteri": [0, 10, 140, 205, 247, 289], "megamona": [0, 10, 140, 205, 247, 289], "hypermegal": [0, 10, 140, 205, 247, 289], "1672": [0, 10, 140, 205, 247, 289], "rustigianii": [0, 10, 140, 205, 247, 289], "4541": [0, 10, 140, 205, 247, 289], "trabulsiella": [0, 10, 140, 205, 247, 289], "guamensi": [0, 10, 140, 205, 247, 289], "49490": [0, 10, 140, 205, 247, 289], "yokenella": [0, 10, 140, 205, 247, 289], "regensburgei": [0, 10, 140, 205, 247, 289], "43003": [0, 10, 140, 205, 247, 289], "collimona": [0, 10, 140, 205, 247, 289], "fungivoran": [0, 10, 140, 205, 247, 289], "ter331": [0, 10, 140, 205, 247, 289], "roseibacterium": [0, 10, 140, 205, 247, 289], "elongatum": [0, 10, 140, 205, 247, 289], "19469": [0, 10, 140, 205, 247, 289], "embleya": [0, 10, 140, 205, 247, 289], "scabrispora": [0, 10, 140, 205, 247, 289], "41855": [0, 10, 140, 205, 247, 289], "hpl": [0, 10, 140, 205, 247, 289], "003": [0, 10, 140, 205, 247, 289], "oceanica": [0, 10, 140, 205, 247, 289], "gubbeenens": [0, 10, 140, 205, 247, 289], "15944": [0, 10, 140, 205, 247, 289], "nanoarchaeum": [0, 10, 140, 205, 247, 289], "equitan": [0, 10, 140, 205, 247, 289], "kin4": [0, 10, 140, 205, 247, 289], "ignicoccu": [0, 10, 140, 205, 247, 289], "hospitali": [0, 10, 140, 205, 247, 289], "19264": [0, 10, 140, 205, 247, 289], "350": [0, 10, 140, 205, 247, 289], "351": [0, 10, 140, 205, 247, 289], "wittichii": [0, 10, 140, 205, 247, 289], "rw1": [0, 10, 140, 205, 247, 289], "ferrivoran": [0, 10, 140, 205, 247, 289], "ss3": [0, 10, 140, 205, 247, 289], "auricularia": [0, 10, 140, 205, 247, 289], "delicata": [0, 10, 140, 205, 247, 289], "hydrogeniphilum": [0, 10, 140, 205, 247, 289], "planococcu": [0, 10, 140, 205, 247, 289], "14505": [0, 10, 140, 205, 247, 289], "anaeromyxobact": [0, 10, 140, 205, 247, 289], "2cp": [0, 10, 140, 205, 247, 289], "sd": [0, 10, 140, 205, 247, 289], "kroppenstedtii": [0, 10, 140, 205, 247, 289], "44385": [0, 10, 140, 205, 247, 289], "lipophiloflavum": [0, 10, 140, 205, 247, 289], "44291": [0, 10, 140, 205, 247, 289], "mastitidi": [0, 10, 140, 205, 247, 289], "44356": [0, 10, 140, 205, 247, 289], "camporealensi": [0, 10, 140, 205, 247, 289], "singular": [0, 10, 140, 205, 247, 289], "beta": [0, 5, 10, 140, 205, 247, 289], "a4": [0, 10, 140, 205, 247, 289], "cleftensi": [0, 10, 140, 205, 247, 289], "mossii": [0, 10, 140, 205, 247, 289], "22836": [0, 10, 140, 205, 247, 289], "sagamiensi": [0, 10, 140, 205, 247, 289], "14643": [0, 10, 140, 205, 247, 289], "7108": [0, 10, 140, 205, 247, 289], "fuchuensi": [0, 10, 140, 205, 247, 289], "14340": [0, 10, 140, 205, 247, 289], "11249": [0, 10, 140, 205, 247, 289], "vulcanisaeta": [0, 10, 140, 205, 247, 289], "distributa": [0, 10, 140, 205, 247, 289], "14429": [0, 10, 140, 205, 247, 289], "cryptocercu": [0, 10, 140, 205, 247, 289], "punctulatu": [0, 10, 140, 205, 247, 289], "cpu": [0, 10, 140, 205, 247, 289], "taiwanensi": [0, 10, 140, 205, 247, 289], "19424": [0, 10, 140, 205, 247, 289], "mc": [0, 10, 140, 205, 247, 289], "15510": [0, 10, 140, 205, 247, 289], "copri": [0, 10, 140, 205, 247, 289], "18205": [0, 10, 140, 205, 247, 289], "schoenbuchensi": [0, 10, 140, 205, 247, 289], "m07a": [0, 10, 140, 205, 247, 289], "8109": [0, 10, 140, 205, 247, 289], "8016": [0, 10, 140, 205, 247, 289], "roseburia": [0, 10, 140, 205, 247, 289], "thermobaculum": [0, 10, 140, 205, 247, 289], "terrenum": [0, 10, 140, 205, 247, 289], "798": [0, 10, 140, 205, 247, 289], "translucida": [0, 10, 140, 205, 247, 289], "tac125": [0, 10, 140, 205, 247, 289], "allofusti": [0, 10, 140, 205, 247, 289], "semini": [0, 10, 140, 205, 247, 289], "15817": [0, 10, 140, 205, 247, 289], "ilyobact": [0, 10, 140, 205, 247, 289], "polytropu": [0, 10, 140, 205, 247, 289], "2926": [0, 10, 140, 205, 247, 289], "anaerolinea": [0, 10, 140, 205, 247, 289], "uni": [0, 10, 140, 205, 247, 289], "ishikawaella": [0, 10, 140, 205, 247, 289], "capsulata": [0, 10, 140, 205, 247, 289], "mpkobe": [0, 10, 140, 205, 247, 289], "marvinbryantia": [0, 10, 140, 205, 247, 289], "formatexigen": [0, 10, 140, 205, 247, 289], "14469": [0, 10, 140, 205, 247, 289], "laribact": [0, 10, 140, 205, 247, 289], "hongkongensi": [0, 10, 140, 205, 247, 289], "hlhk9": [0, 10, 140, 205, 247, 289], "salinispora": [0, 10, 140, 205, 247, 289], "tropica": [0, 10, 140, 205, 247, 289], "cnb": [0, 10, 140, 205, 247, 289], "440": [0, 10, 140, 205, 247, 289], "arenicola": [0, 10, 140, 205, 247, 289], "205": [0, 10, 140, 205, 247, 289], "drancourtii": [0, 10, 140, 205, 247, 289], "llap12": [0, 10, 140, 205, 247, 289], "guizhouens": [0, 10, 140, 205, 247, 289], "977": [0, 10, 140, 205, 247, 289], "gelidibact": [0, 10, 140, 205, 247, 289], "mesophilu": [0, 10, 140, 205, 247, 289], "14095": [0, 10, 140, 205, 247, 289], "tardaugen": [0, 10, 140, 205, 247, 289], "16725": [0, 10, 140, 205, 247, 289], "unda": [0, 10, 140, 205, 247, 289], "14481": [0, 10, 140, 205, 247, 289], "aurimucosum": [0, 10, 140, 205, 247, 289], "700975": [0, 10, 140, 205, 247, 289], "anaerotruncu": [0, 10, 140, 205, 247, 289], "colihomini": [0, 10, 140, 205, 247, 289], "17241": [0, 10, 140, 205, 247, 289], "saccharospirillum": [0, 10, 140, 205, 247, 289], "12546": [0, 10, 140, 205, 247, 289], "saccharobutylicum": [0, 10, 140, 205, 247, 289], "13864": [0, 10, 140, 205, 247, 289], "stellif": [0, 10, 140, 205, 247, 289], "aotearoa": [0, 10, 140, 205, 247, 289], "pettenkoferi": [0, 10, 140, 205, 247, 289], "vcu012": [0, 10, 140, 205, 247, 289], "20546": [0, 10, 140, 205, 247, 289], "kanaloa": [0, 10, 140, 205, 247, 289], "lacustri": [0, 10, 140, 205, 247, 289], "7289": [0, 10, 140, 205, 247, 289], "sulfurihydrogenibium": [0, 10, 140, 205, 247, 289], "subterraneum": [0, 10, 140, 205, 247, 289], "15120": [0, 10, 140, 205, 247, 289], "halosimplex": [0, 10, 140, 205, 247, 289], "carlsbadens": [0, 10, 140, 205, 247, 289], "1340": [0, 10, 140, 205, 247, 289], "cyno": [0, 10, 140, 205, 247, 289], "c142": [0, 10, 140, 205, 247, 289], "tistrella": [0, 10, 140, 205, 247, 289], "ka081020": [0, 10, 140, 205, 247, 289], "065": [0, 10, 140, 205, 247, 289], "michigan": [0, 10, 140, 205, 247, 289], "oceanobacillu": [0, 10, 140, 205, 247, 289], "pictura": [0, 10, 140, 205, 247, 289], "thermodesulfat": [0, 10, 140, 205, 247, 289], "15286": [0, 10, 140, 205, 247, 289], "aeria": [0, 10, 140, 205, 247, 289], "f0184": [0, 10, 140, 205, 247, 289], "miricola": [0, 10, 140, 205, 247, 289], "sibiricu": [0, 10, 140, 205, 247, 289], "mm": [0, 10, 140, 205, 247, 289], "739": [0, 10, 140, 205, 247, 289], "th": [0, 10, 140, 205, 247, 289, 323, 324, 325], "14542": [0, 10, 140, 205, 247, 289], "paraconglomeratum": [0, 10, 140, 205, 247, 289], "lc44": [0, 10, 140, 205, 247, 289], "methylobact": [0, 10, 140, 205, 247, 289], "tundripaludum": [0, 10, 140, 205, 247, 289], "sv96": [0, 10, 140, 205, 247, 289], "gemmatimona": [0, 10, 140, 205, 247, 289], "sihwensi": [0, 10, 140, 205, 247, 289], "108236": [0, 10, 140, 205, 247, 289], "ordospora": [0, 10, 140, 205, 247, 289], "colligata": [0, 10, 140, 205, 247, 289], "oc4": [0, 10, 140, 205, 247, 289], "allobaculum": [0, 10, 140, 205, 247, 289], "stercoricani": [0, 10, 140, 205, 247, 289], "13633": [0, 10, 140, 205, 247, 289], "paraffinivoran": [0, 10, 140, 205, 247, 289], "108238": [0, 10, 140, 205, 247, 289], "subterraneu": [0, 10, 140, 205, 247, 289], "13965": [0, 10, 140, 205, 247, 289], "bucero": [0, 10, 140, 205, 247, 289], "rhinocero": [0, 10, 140, 205, 247, 289], "nestor": [0, 10, 140, 205, 247, 289], "notabili": [0, 10, 140, 205, 247, 289], "agarivoran": [0, 10, 140, 205, 247, 289], "s816": [0, 10, 140, 205, 247, 289], "bassiana": [0, 10, 140, 205, 247, 289], "halocynthia": [0, 10, 140, 205, 247, 289], "14573": [0, 10, 140, 205, 247, 289], "malefermentan": [0, 10, 140, 205, 247, 289], "5705": [0, 10, 140, 205, 247, 289], "3548": [0, 10, 140, 205, 247, 289], "python": [0, 1, 2, 5, 6, 8, 9, 10, 76, 77, 140, 205, 247, 289, 324], "bivittatu": [0, 10, 140, 205, 247, 289], "coniochaeta": [0, 10, 140, 205, 247, 289], "ligniaria": [0, 10, 140, 205, 247, 289], "30616": [0, 10, 140, 205, 247, 289], "anaerophaga": [0, 10, 140, 205, 247, 289], "thermohalophila": [0, 10, 140, 205, 247, 289], "12881": [0, 10, 140, 205, 247, 289], "lettinga": [0, 10, 140, 205, 247, 289], "tmo": [0, 10, 140, 205, 247, 289], "shuttleworthia": [0, 10, 140, 205, 247, 289], "satel": [0, 10, 140, 205, 247, 289], "sch10": [0, 10, 140, 205, 247, 289], "ferriphilum": [0, 10, 140, 205, 247, 289], "ml": [0, 10, 140, 205, 247, 289], "04": [0, 6, 10, 140, 205, 247, 289], "microcarpu": [0, 10, 140, 205, 247, 289], "441": [0, 10, 140, 205, 247, 289], "malorum": [0, 10, 140, 205, 247, 289], "colicani": [0, 10, 140, 205, 247, 289], "209318": [0, 10, 140, 205, 247, 289], "alicycliphilu": [0, 10, 140, 205, 247, 289], "k601": [0, 10, 140, 205, 247, 289], "culicoid": [0, 10, 140, 205, 247, 289], "elodea": [0, 10, 140, 205, 247, 289], "31461": [0, 10, 140, 205, 247, 289], "rhizopogon": [0, 10, 140, 205, 247, 289], "vesiculosu": [0, 10, 140, 205, 247, 289], "7001": [0, 10, 140, 205, 247, 289], "robinsoniella": [0, 10, 140, 205, 247, 289], "peoriensi": [0, 10, 140, 205, 247, 289], "salinisphaera": [0, 10, 140, 205, 247, 289], "shabanensi": [0, 10, 140, 205, 247, 289], "e1l3a": [0, 10, 140, 205, 247, 289], "proteocatella": [0, 10, 140, 205, 247, 289], "sphenisci": [0, 10, 140, 205, 247, 289], "23131": [0, 10, 140, 205, 247, 289], "pleistocenium": [0, 10, 140, 205, 247, 289], "ftr1": [0, 10, 140, 205, 247, 289], "pseudopodoc": [0, 10, 140, 205, 247, 289], "humili": [0, 10, 140, 205, 247, 289], "calidifonti": [0, 10, 140, 205, 247, 289], "11548": [0, 10, 140, 205, 247, 289], "cardiffensi": [0, 10, 140, 205, 247, 289], "f0333": [0, 10, 140, 205, 247, 289], "cyanoderma": [0, 10, 140, 205, 247, 289], "oleovoran": [0, 10, 140, 205, 247, 289], "hxd3": [0, 10, 140, 205, 247, 289], "coleohomini": [0, 10, 140, 205, 247, 289], "101": [0, 10, 140, 168, 205, 247, 289], "pseudodesulfovibrio": [0, 10, 140, 205, 247, 289], "aespoeensi": [0, 10, 140, 205, 247, 289], "aspo": [0, 10, 140, 205, 247, 289], "billingia": [0, 10, 140, 205, 247, 289], "eb661": [0, 10, 140, 205, 247, 289], "rubritepida": [0, 10, 140, 205, 247, 289], "flocculan": [0, 10, 140, 205, 247, 289], "14296": [0, 10, 140, 205, 247, 289], "kribbella": [0, 10, 140, 205, 247, 289], "flavida": [0, 10, 140, 205, 247, 289], "17836": [0, 10, 140, 205, 247, 289], "iheyensi": [0, 10, 140, 205, 247, 289], "hte831": [0, 10, 140, 205, 247, 289], "stemphylium": [0, 10, 140, 205, 247, 289], "lycopersici": [0, 10, 140, 205, 247, 289], "nitzschia": [0, 10, 140, 205, 247, 289], "multistriata": [0, 10, 140, 205, 247, 289], "5447": [0, 10, 140, 205, 247, 289], "vaccimaxilla": [0, 10, 140, 205, 247, 289], "15804": [0, 10, 140, 205, 247, 289], "thermodesulfobium": [0, 10, 140, 205, 247, 289], "narugens": [0, 10, 140, 205, 247, 289], "14796": [0, 10, 140, 205, 247, 289], "uzoniensi": [0, 10, 140, 205, 247, 289], "768": [0, 10, 140, 205, 247, 289], "crocinitomix": [0, 10, 140, 205, 247, 289], "catalasitica": [0, 10, 140, 205, 247, 289], "23190": [0, 10, 140, 205, 247, 289], "varibaculum": [0, 10, 140, 205, 247, 289], "cambriens": [0, 10, 140, 205, 247, 289], "dora_20": [0, 10, 140, 205, 247, 289], "subterranea": [0, 10, 140, 205, 247, 289], "19937": [0, 10, 140, 205, 247, 289], "corallococcu": [0, 10, 140, 205, 247, 289], "coralloid": [0, 10, 140, 205, 247, 289], "2259": [0, 10, 140, 168, 205, 247, 289], "magneticu": [0, 10, 140, 205, 247, 289], "17970": [0, 10, 140, 205, 247, 289], "paludiviven": [0, 10, 140, 205, 247, 289], "17968": [0, 10, 140, 205, 247, 289], "13650": [0, 10, 140, 205, 247, 289], "paludibact": [0, 10, 140, 205, 247, 289], "propionicigen": [0, 10, 140, 205, 247, 289], "wb4": [0, 10, 140, 205, 247, 289], "chrysochlori": [0, 10, 140, 205, 247, 289], "fragilariopsi": [0, 10, 140, 205, 247, 289], "cylindru": [0, 10, 140, 205, 247, 289], "ccmp1102": [0, 10, 140, 205, 247, 289], "xylanimona": [0, 10, 140, 205, 247, 289], "cellulosilytica": [0, 10, 140, 205, 247, 289], "15894": [0, 10, 140, 205, 247, 289], "marinithermu": [0, 10, 140, 205, 247, 289], "hydrothermali": [0, 10, 140, 205, 247, 289], "14884": [0, 10, 140, 205, 247, 289], "baumannia": [0, 10, 140, 205, 247, 289], "cicadellinicola": [0, 10, 140, 205, 247, 289], "washoeensi": [0, 10, 140, 205, 247, 289], "sb944nv": [0, 10, 140, 205, 247, 289], "14787": [0, 10, 140, 205, 247, 289], "sneathia": [0, 10, 140, 205, 247, 289], "amnii": [0, 10, 140, 205, 247, 289], "oceanithermu": [0, 10, 140, 205, 247, 289], "14977": [0, 10, 140, 205, 247, 289], "caldithrix": [0, 10, 140, 205, 247, 289], "13497": [0, 10, 140, 205, 247, 289], "labrenzia": [0, 10, 140, 205, 247, 289], "aggregata": [0, 10, 140, 205, 247, 289], "12614": [0, 10, 140, 205, 247, 289], "micronuciformi": [0, 10, 140, 205, 247, 289], "f0359": [0, 10, 140, 205, 247, 289], "intestini": [0, 10, 140, 205, 247, 289], "ryc": [0, 10, 140, 205, 247, 289], "mr95": [0, 10, 140, 205, 247, 289], "montpellierensi": [0, 10, 140, 205, 247, 289], "dnf00314": [0, 10, 140, 205, 247, 289], "chlamydoti": [0, 10, 140, 205, 247, 289], "macqueenii": [0, 10, 140, 205, 247, 289], "zeaxanthinifacien": [0, 10, 140, 205, 247, 289], "21588": [0, 10, 140, 205, 247, 289], "claussenii": [0, 10, 140, 205, 247, 289], "344": [0, 10, 140, 166, 205, 247, 289], "thalassolituu": [0, 10, 140, 205, 247, 289], "oleivoran": [0, 10, 140, 205, 247, 289], "mil": [0, 10, 140, 205, 247, 289], "gammatoleran": [0, 10, 140, 205, 247, 289], "ej3": [0, 10, 140, 205, 247, 289], "jalaludinii": [0, 10, 140, 205, 247, 289], "13811": [0, 10, 140, 205, 247, 289], "ff": [0, 10, 140, 205, 247, 289], "leptosomu": [0, 10, 140, 205, 247, 289], "discolor": [0, 10, 140, 205, 247, 289], "egretta": [0, 10, 140, 205, 247, 289], "garzetta": [0, 10, 140, 205, 247, 289], "ellin185": [0, 10, 140, 205, 247, 289], "oleispira": [0, 10, 140, 205, 247, 289], "antarctica": [0, 10, 140, 205, 247, 289], "rb": [0, 10, 140, 205, 247, 289], "cetobacterium": [0, 10, 140, 205, 247, 289], "somera": [0, 10, 140, 205, 247, 289], "474": [0, 10, 140, 205, 247, 289], "tremblaya": [0, 10, 140, 205, 247, 289], "pcit": [0, 10, 140, 205, 247, 289], "odorif": [0, 10, 140, 205, 247, 289], "elgii": [0, 10, 140, 205, 247, 289], "b69": [0, 10, 140, 205, 247, 289], "marshii": [0, 10, 140, 205, 247, 289], "16973": [0, 10, 140, 205, 247, 289], "13450": [0, 10, 140, 205, 247, 289], "mican": [0, 10, 140, 205, 247, 289], "f0438": [0, 10, 140, 205, 247, 289], "ec3": [0, 10, 140, 205, 247, 289], "urinal": [0, 10, 140, 205, 247, 289], "15805": [0, 10, 140, 205, 247, 289], "os145": [0, 10, 140, 205, 247, 289], "coralliilyticu": [0, 10, 140, 205, 247, 289], "450": [0, 10, 140, 205, 247, 289], "am13": [0, 10, 140, 205, 247, 289], "14728": [0, 10, 140, 205, 247, 289], "aetherivoran": [0, 10, 140, 205, 247, 289], "cm": [0, 10, 140, 205, 247, 289], "76r": [0, 10, 140, 205, 247, 289], "conexibact": [0, 10, 140, 205, 247, 289], "woesei": [0, 10, 140, 205, 247, 289], "14684": [0, 10, 140, 205, 247, 289], "epilithonimona": [0, 10, 140, 205, 247, 289], "16811": [0, 10, 140, 205, 247, 289], "fluviicola": [0, 10, 140, 205, 247, 289], "taffensi": [0, 10, 140, 205, 247, 289], "16823": [0, 10, 140, 205, 247, 289], "atypicum": [0, 10, 140, 205, 247, 289], "plesiocysti": [0, 10, 140, 205, 247, 289], "pacifica": [0, 10, 140, 205, 247, 289], "sir": [0, 10, 140, 205, 247, 289], "pardinu": [0, 10, 140, 205, 247, 289], "chthoniobact": [0, 10, 140, 205, 247, 289], "ellin428": [0, 10, 140, 205, 247, 289], "os217": [0, 10, 140, 205, 247, 289], "rhodoferax": [0, 10, 140, 205, 247, 289], "ferrireducen": [0, 10, 140, 205, 247, 289], "t118": [0, 10, 140, 205, 247, 289], "capsaspora": [0, 10, 140, 205, 247, 289], "owczarzaki": [0, 10, 140, 205, 247, 289], "30864": [0, 10, 140, 205, 247, 289], "niveu": [0, 10, 140, 205, 247, 289], "11891": [0, 10, 140, 205, 247, 289], "versmoldensi": [0, 10, 140, 205, 247, 289], "14857": [0, 10, 140, 205, 247, 289], "3814": [0, 10, 140, 205, 247, 289], "valvarum": [0, 10, 140, 205, 247, 289], "f0432": [0, 10, 140, 205, 247, 289], "31555": [0, 10, 140, 205, 247, 289], "americanum": [0, 10, 140, 205, 247, 289], "ccgm7": [0, 10, 140, 205, 247, 289], "chroomona": [0, 10, 140, 205, 247, 289], "mesostigmatica": [0, 10, 140, 205, 247, 289], "ccmp1168": [0, 10, 140, 205, 247, 289], "haematobact": [0, 10, 140, 205, 247, 289], "massiliensi": [0, 10, 140, 205, 247, 289], "7336": [0, 10, 140, 205, 247, 289], "6312": [0, 10, 140, 205, 247, 289], "nautili": [0, 10, 140, 205, 247, 289], "gillisia": [0, 10, 140, 205, 247, 289], "limnaea": [0, 10, 140, 205, 247, 289], "15749": [0, 10, 140, 205, 247, 289], "caldimona": [0, 10, 140, 205, 247, 289], "manganoxidan": [0, 10, 140, 205, 247, 289], "369": [0, 10, 140, 205, 247, 289], "microdochium": [0, 10, 140, 205, 247, 289], "bolleyi": [0, 10, 140, 205, 247, 289], "js614": [0, 10, 140, 205, 247, 289], "caballeronia": [0, 10, 140, 205, 247, 289], "sordidicola": [0, 10, 140, 205, 247, 289], "ai1a": [0, 10, 140, 205, 247, 289], "porphyrobact": [0, 10, 140, 205, 247, 289], "cryptu": [0, 10, 140, 205, 247, 289], "12079": [0, 10, 140, 205, 247, 289], "friuliensi": [0, 10, 140, 205, 247, 289], "7358": [0, 10, 140, 205, 247, 289], "deferribact": [0, 10, 140, 205, 247, 289], "ssm1": [0, 10, 140, 205, 247, 289], "alkanindig": [0, 10, 140, 205, 247, 289], "illinoisensi": [0, 10, 140, 205, 247, 289], "15370": [0, 10, 140, 205, 247, 289], "paraglaciecola": [0, 10, 140, 205, 247, 289], "mesophila": [0, 10, 140, 205, 247, 289], "kmm": [0, 10, 140, 205, 247, 289], "241": [0, 10, 140, 205, 247, 289, 323, 324, 325], "tropicu": [0, 10, 140, 205, 247, 289], "15496": [0, 10, 140, 205, 247, 289], "11116": [0, 10, 140, 205, 247, 289], "43144": [0, 10, 140, 205, 247, 289], "pelagibact": [0, 10, 140, 205, 247, 289], "ubiqu": [0, 10, 140, 205, 247, 289], "htcc7217": [0, 10, 140, 205, 247, 289], "gonensi": [0, 10, 140, 205, 247, 289], "verruculosu": [0, 10, 140, 205, 247, 289], "kirkii": [0, 10, 140, 205, 247, 289], "uzhbot1": [0, 10, 140, 205, 247, 289], "posadasii": [0, 10, 140, 205, 247, 289], "rmscc": [0, 10, 140, 205, 247, 289], "3488": [0, 10, 140, 205, 247, 289], "paraoxydan": [0, 10, 140, 205, 247, 289], "77mftsu3": [0, 10, 140, 205, 247, 289], "methylocella": [0, 10, 140, 205, 247, 289], "epiroticu": [0, 10, 140, 205, 247, 289], "obtusifolia": [0, 10, 140, 205, 247, 289], "caldisphaera": [0, 10, 140, 205, 247, 289], "lagunensi": [0, 10, 140, 205, 247, 289], "15908": [0, 10, 140, 205, 247, 289], "re": [0, 1, 2, 7, 9, 10, 140, 205, 247, 289, 323, 325], "odysseyi": [0, 10, 140, 205, 247, 289], "34h": [0, 10, 140, 205, 247, 289], "100172": [0, 10, 140, 205, 247, 289], "jaapia": [0, 10, 140, 205, 247, 289], "argillacea": [0, 10, 140, 205, 247, 289], "mucl": [0, 10, 140, 205, 247, 289], "33604": [0, 10, 140, 205, 247, 289], "punctularia": [0, 10, 140, 205, 247, 289], "strigosozonata": [0, 10, 140, 205, 247, 289], "16294": [0, 10, 140, 205, 247, 289], "actinobaculum": [0, 10, 140, 205, 247, 289], "massiliens": [0, 10, 140, 205, 247, 289], "171": [0, 10, 140, 205, 247, 289], "col2": [0, 10, 140, 205, 247, 289], "baylyi": [0, 10, 140, 205, 247, 289], "adp1": [0, 10, 140, 205, 247, 289], "bouvetii": [0, 10, 140, 205, 247, 289], "14964": [0, 10, 140, 205, 247, 289], "107468": [0, 10, 140, 205, 247, 289], "gerneri": [0, 10, 140, 205, 247, 289], "tandoii": [0, 10, 140, 205, 247, 289], "tjernbergia": [0, 10, 140, 205, 247, 289], "towneri": [0, 10, 140, 205, 247, 289], "tepidiphilu": [0, 10, 140, 205, 247, 289], "margaritif": [0, 10, 140, 205, 247, 289], "15129": [0, 10, 140, 205, 247, 289], "longispora": [0, 10, 140, 205, 247, 289], "44784": [0, 10, 140, 205, 247, 289], "melampsora": [0, 10, 140, 205, 247, 289], "larici": [0, 10, 140, 205, 247, 289], "populina": [0, 10, 140, 205, 247, 289], "98ag31": [0, 10, 140, 205, 247, 289], "dadantii": [0, 10, 140, 205, 247, 289], "3937": [0, 10, 140, 205, 247, 289], "ech586": [0, 10, 140, 205, 247, 289], "pomorum": [0, 10, 140, 205, 247, 289], "14955": [0, 10, 140, 205, 247, 289], "b84634": [0, 10, 140, 205, 247, 289], "timon": [0, 10, 140, 205, 247, 289], "84634": [0, 10, 140, 205, 247, 289], "17679": [0, 10, 140, 205, 247, 289], "13223": [0, 10, 140, 205, 247, 289], "roseomona": [0, 10, 140, 205, 247, 289], "cervicali": [0, 10, 140, 205, 247, 289], "49957": [0, 10, 140, 205, 247, 289], "herminiimona": [0, 10, 140, 205, 247, 289], "arsenicoxydan": [0, 10, 140, 205, 247, 289], "nitratireductor": [0, 10, 140, 205, 247, 289], "aquibiodomu": [0, 10, 140, 205, 247, 289], "nl21": [0, 10, 140, 205, 247, 289], "21793": [0, 10, 140, 205, 247, 289], "pentaromativoran": [0, 10, 140, 205, 247, 289], "us6": [0, 10, 140, 205, 247, 289], "gymnopu": [0, 10, 140, 205, 247, 289], "luxurian": [0, 10, 140, 205, 247, 289], "317": [0, 10, 140, 205, 247, 289], "sulfurovum": [0, 10, 140, 205, 247, 289], "lithotrophicum": [0, 10, 140, 205, 247, 289], "bermanella": [0, 10, 140, 205, 247, 289], "marisrubri": [0, 10, 140, 205, 247, 289], "neptuniibact": [0, 10, 140, 205, 247, 289], "caesariensi": [0, 10, 140, 205, 247, 289], "parvularcula": [0, 10, 140, 205, 247, 289], "bermudensi": [0, 10, 140, 205, 247, 289], "htcc2503": [0, 10, 140, 205, 247, 289], "metalliredigen": [0, 10, 140, 205, 247, 289], "qymf": [0, 10, 140, 205, 247, 289], "triticina": [0, 10, 140, 205, 247, 289], "bbbd": [0, 10, 140, 205, 247, 289], "race": [0, 10, 140, 205, 247, 289], "balhimycina": [0, 10, 140, 205, 247, 289], "fh": [0, 10, 140, 205, 247, 289], "1894": [0, 10, 140, 205, 247, 289], "vancoresmycina": [0, 10, 140, 205, 247, 289], "coatneyi": [0, 10, 140, 205, 247, 289], "fomitiporia": [0, 10, 140, 205, 247, 289], "albertii": [0, 10, 140, 205, 247, 289], "kf1": [0, 10, 140, 205, 247, 289], "niigatensi": [0, 10, 140, 205, 247, 289], "100131": [0, 10, 140, 205, 247, 289], "haemominutum": [0, 10, 140, 205, 247, 289], "birmingham": [0, 10, 140, 205, 247, 289], "sm19": [0, 10, 140, 205, 247, 289], "afifella": [0, 10, 140, 205, 247, 289], "pfennigii": [0, 10, 140, 205, 247, 289], "17143": [0, 10, 140, 205, 247, 289], "corchoru": [0, 10, 140, 205, 247, 289], "capsulari": [0, 10, 140, 205, 247, 289], "nymphaea": [0, 10, 140, 205, 247, 289], "colorata": [0, 10, 140, 205, 247, 289], "thiorhodococcu": [0, 10, 140, 205, 247, 289], "drewsii": [0, 10, 140, 205, 247, 289], "az1": [0, 10, 140, 205, 247, 289], "sandarakinorhabdu": [0, 10, 140, 205, 247, 289], "17366": [0, 10, 140, 205, 247, 289], "opuntia": [0, 10, 140, 205, 247, 289], "allokutzneria": [0, 10, 140, 205, 247, 289], "albata": [0, 10, 140, 205, 247, 289], "kuhnia": [0, 10, 140, 205, 247, 289], "17694": [0, 10, 140, 205, 247, 289], "637": [0, 10, 140, 205, 247, 289], "js623": [0, 10, 140, 205, 247, 289], "campaniensi": [0, 10, 140, 205, 247, 289], "waksmanii": [0, 10, 140, 205, 247, 289], "643": [0, 10, 140, 205, 247, 289], "subdoligranulum": [0, 10, 140, 205, 247, 289], "15176": [0, 10, 140, 205, 247, 289], "anaerofusti": [0, 10, 140, 205, 247, 289], "stercorihomini": [0, 10, 140, 205, 247, 289], "17244": [0, 10, 140, 205, 247, 289], "finegoldii": [0, 10, 140, 205, 247, 289], "17242": [0, 10, 140, 205, 247, 289], "rhaeticu": [0, 10, 140, 205, 247, 289], "af1": [0, 10, 140, 205, 247, 289], "oligosperma": [0, 10, 140, 205, 247, 289], "acaromyc": [0, 10, 140, 205, 247, 289], "ingoldii": [0, 10, 140, 205, 247, 289], "caldarium": [0, 10, 140, 205, 247, 289], "7334": [0, 10, 140, 205, 247, 289], "ejp617": [0, 10, 140, 205, 247, 289], "thermomona": [0, 10, 140, 205, 247, 289], "15424": [0, 10, 140, 205, 247, 289], "roseovariu": [0, 10, 140, 205, 247, 289], "17069": [0, 10, 140, 205, 247, 289], "enhygromyxa": [0, 10, 140, 205, 247, 289], "dinoroseobact": [0, 10, 140, 205, 247, 289], "shiba": [0, 10, 140, 205, 247, 289], "dfl": [0, 10, 140, 205, 247, 289], "16493": [0, 10, 140, 205, 247, 289], "rhizosphaera": [0, 10, 140, 205, 247, 289], "polaromona": [0, 10, 140, 205, 247, 289], "naphthalenivoran": [0, 10, 140, 205, 247, 289], "cj2": [0, 10, 140, 205, 247, 289], "ncc2705": [0, 10, 140, 205, 247, 289], "chrysopicola": [0, 10, 140, 205, 247, 289], "culicicola": [0, 10, 140, 205, 247, 289], "ae": [0, 10, 140, 205, 247, 289], "diminutum": [0, 10, 140, 205, 247, 289], "cua": [0, 10, 140, 205, 247, 289], "sabaudiens": [0, 10, 140, 205, 247, 289], "1343": [0, 10, 140, 205, 247, 289], "syrphidicola": [0, 10, 140, 205, 247, 289], "ea": [0, 10, 140, 205, 247, 289], "carboxidivoran": [0, 10, 140, 205, 247, 289], "microvirga": [0, 10, 140, 205, 247, 289], "817": [0, 10, 140, 205, 247, 289], "insular": [0, 10, 140, 205, 247, 289], "21763": [0, 10, 140, 205, 247, 289], "neomegalonema": [0, 10, 140, 205, 247, 289], "perideroed": [0, 10, 140, 205, 247, 289], "15528": [0, 10, 140, 205, 247, 289], "fulvimarina": [0, 10, 140, 205, 247, 289], "pelagi": [0, 10, 140, 205, 247, 289], "htcc2506": [0, 10, 140, 205, 247, 289], "anoplophora": [0, 10, 140, 205, 247, 289], "glabripenni": [0, 10, 140, 205, 247, 289], "psychraerophilum": [0, 10, 140, 205, 247, 289], "vietnamensi": [0, 10, 140, 205, 247, 289], "dialist": [0, 10, 140, 205, 247, 289], "invisu": [0, 10, 140, 205, 247, 289], "15470": [0, 10, 140, 205, 247, 289], "aquilegia": [0, 10, 140, 205, 247, 289], "coerulea": [0, 10, 140, 205, 247, 289], "ay4": [0, 10, 140, 205, 247, 289], "39149": [0, 10, 140, 205, 247, 289], "aeromicrobium": [0, 10, 140, 205, 247, 289], "15272": [0, 10, 140, 205, 247, 289], "rhodanobact": [0, 10, 140, 205, 247, 289], "jip2": [0, 10, 140, 205, 247, 289], "gemmobact": [0, 10, 140, 205, 247, 289], "nectariphilu": [0, 10, 140, 205, 247, 289], "15620": [0, 10, 140, 205, 247, 289], "bathymodiolu": [0, 10, 140, 205, 247, 289], "platifron": [0, 10, 140, 205, 247, 289], "bataviensi": [0, 10, 140, 205, 247, 289], "21833": [0, 10, 140, 205, 247, 289], "vireti": [0, 10, 140, 205, 247, 289], "21834": [0, 10, 140, 205, 247, 289], "thalassospira": [0, 10, 140, 205, 247, 289], "xiamenensi": [0, 10, 140, 205, 247, 289], "17429": [0, 10, 140, 205, 247, 289], "putidum": [0, 10, 140, 205, 247, 289], "kordia": [0, 10, 140, 205, 247, 289], "algicida": [0, 10, 140, 205, 247, 289], "roreri": [0, 10, 140, 205, 247, 289], "mastigocladopsi": [0, 10, 140, 205, 247, 289], "10914": [0, 10, 140, 205, 247, 289], "rs9916": [0, 10, 140, 205, 247, 289], "rs9917": [0, 10, 140, 205, 247, 289], "polytolypa": [0, 10, 140, 205, 247, 289], "hystrici": [0, 10, 140, 205, 247, 289], "uamh7299": [0, 10, 140, 205, 247, 289], "17395": [0, 10, 140, 205, 247, 289], "elaeagni": [0, 10, 140, 205, 247, 289], "altunens": [0, 10, 140, 205, 247, 289], "phaeoacremonium": [0, 10, 140, 205, 247, 289], "lc1": [0, 10, 140, 205, 247, 289], "hymenobact": [0, 10, 140, 205, 247, 289], "norwichensi": [0, 10, 140, 205, 247, 289], "15439": [0, 10, 140, 205, 247, 289], "oxidotoleran": [0, 10, 140, 205, 247, 289], "12280": [0, 10, 140, 205, 247, 289], "populi": [0, 10, 140, 205, 247, 289], "bj001": [0, 10, 140, 205, 247, 289], "abm4": [0, 10, 140, 205, 247, 289], "pyru": [0, 10, 140, 205, 247, 289], "bretschneideri": [0, 10, 140, 205, 247, 289], "lottia": [0, 10, 140, 205, 247, 289], "bemidjiensi": [0, 10, 140, 205, 247, 289], "bem": [0, 10, 140, 205, 247, 289], "geopsychrobact": [0, 10, 140, 205, 247, 289], "electrodiphilu": [0, 10, 140, 205, 247, 289], "16401": [0, 10, 140, 205, 247, 289], "enhydrobact": [0, 10, 140, 205, 247, 289], "aerosaccu": [0, 10, 140, 205, 247, 289], "sk60": [0, 10, 140, 205, 247, 289], "70093": [0, 10, 140, 205, 247, 289], "44683": [0, 10, 140, 205, 247, 289], "pulchra": [0, 10, 140, 205, 247, 289], "davidii": [0, 10, 140, 205, 247, 289], "indolifex": [0, 10, 140, 205, 247, 289], "hel": [0, 10, 140, 205, 247, 289], "yaniella": [0, 10, 140, 205, 247, 289], "15476": [0, 10, 140, 205, 247, 289], "2301083": [0, 10, 140, 205, 247, 289], "16941": [0, 10, 140, 205, 247, 289], "2301065": [0, 10, 140, 205, 247, 289], "16942": [0, 10, 140, 205, 247, 289], "fictibacillu": [0, 10, 140, 205, 247, 289], "gelatini": [0, 10, 140, 205, 247, 289], "15865": [0, 10, 140, 205, 247, 289], "aestuariibact": [0, 10, 140, 205, 247, 289], "15300": [0, 10, 140, 205, 247, 289], "salvia": [0, 10, 140, 205, 247, 289], "miltiorrhiza": [0, 10, 140, 205, 247, 289], "algoriphagu": [0, 10, 140, 205, 247, 289], "mannitolivoran": [0, 10, 140, 205, 247, 289], "15301": [0, 10, 140, 205, 247, 289], "heilongjiangensi": [0, 10, 140, 205, 247, 289], "054": [0, 10, 140, 205, 247, 289], "grosmannia": [0, 10, 140, 205, 247, 289], "clavigera": [0, 10, 140, 205, 247, 289], "kw1407": [0, 10, 140, 205, 247, 289], "bigelowiella": [0, 10, 140, 205, 247, 289], "ciconia": [0, 10, 140, 205, 247, 289], "44920": [0, 10, 140, 205, 247, 289], "antri": [0, 10, 140, 205, 247, 289], "16041": [0, 10, 140, 205, 247, 289], "ultunensi": [0, 10, 140, 205, 247, 289], "16047": [0, 10, 140, 205, 247, 289], "154": [0, 10, 140, 205, 247, 289], "higoensi": [0, 10, 140, 205, 247, 289], "100133": [0, 10, 140, 205, 247, 289], "100136": [0, 10, 140, 205, 247, 289], "15611": [0, 10, 140, 205, 247, 289], "12083": [0, 10, 140, 205, 247, 289], "saliva": [0, 10, 140, 205, 247, 289], "15606": [0, 10, 140, 205, 247, 289], "thermovibrio": [0, 10, 140, 205, 247, 289], "ammonifican": [0, 10, 140, 205, 247, 289], "hb": [0, 10, 140, 205, 247, 289], "certesii": [0, 10, 140, 205, 247, 289], "19833": [0, 10, 140, 205, 247, 289], "frigori": [0, 10, 140, 205, 247, 289], "ps1": [0, 10, 140, 205, 247, 289], "arsenicicoccu": [0, 10, 140, 205, 247, 289], "bolidensi": [0, 10, 140, 205, 247, 289], "15745": [0, 10, 140, 205, 247, 289], "aster": [0, 10, 140, 205, 247, 289], "aywb": [0, 10, 140, 205, 247, 289], "17118": [0, 10, 140, 205, 247, 289], "lacisalsi": [0, 10, 140, 205, 247, 289], "aj5": [0, 10, 140, 205, 247, 289], "camini": [0, 10, 140, 205, 247, 289], "sy1": [0, 10, 140, 205, 247, 289], "12091": [0, 10, 140, 205, 247, 289], "methylophaga": [0, 10, 140, 205, 247, 289], "aminisulfidivoran": [0, 10, 140, 205, 247, 289], "wiggsia": [0, 10, 140, 205, 247, 289], "f0424": [0, 10, 140, 205, 247, 289], "rossia": [0, 10, 140, 205, 247, 289], "15814": [0, 10, 140, 205, 247, 289], "saccharibact": [0, 10, 140, 205, 247, 289], "floricola": [0, 10, 140, 205, 247, 289], "15669": [0, 10, 140, 205, 247, 289], "devriesei": [0, 10, 140, 205, 247, 289], "19639": [0, 10, 140, 205, 247, 289], "18378": [0, 10, 140, 205, 247, 289], "dyella": [0, 10, 140, 205, 247, 289], "carnosa": [0, 10, 140, 205, 247, 289], "hhb": [0, 10, 140, 205, 247, 289], "10118": [0, 10, 140, 205, 247, 289], "belliella": [0, 10, 140, 205, 247, 289], "15883": [0, 10, 140, 205, 247, 289], "effusibacillu": [0, 10, 140, 205, 247, 289], "pohlia": [0, 10, 140, 205, 247, 289], "22757": [0, 10, 140, 205, 247, 289], "alkaliantarctica": [0, 10, 140, 205, 247, 289], "cb0101": [0, 10, 140, 205, 247, 289], "js42": [0, 10, 140, 205, 247, 289], "dichloroeliminan": [0, 10, 140, 205, 247, 289], "21439": [0, 10, 140, 205, 247, 289], "blastocrithidii": [0, 10, 140, 205, 247, 289], "ex": [0, 7, 9, 10, 140, 205, 247, 289], "midichloria": [0, 10, 140, 205, 247, 289], "mitochondrii": [0, 10, 140, 205, 247, 289], "iricva": [0, 10, 140, 205, 247, 289], "caspium": [0, 10, 140, 205, 247, 289], "44850": [0, 10, 140, 205, 247, 289], "sm9913": [0, 10, 140, 205, 247, 289], "thiersii": [0, 10, 140, 205, 247, 289], "skay4041": [0, 10, 140, 205, 247, 289], "jiangxiensi": [0, 10, 140, 205, 247, 289], "dg881": [0, 10, 140, 205, 247, 289], "dg893": [0, 10, 140, 205, 247, 289], "diplodia": [0, 10, 140, 205, 247, 289], "corticola": [0, 10, 140, 205, 247, 289], "formosens": [0, 10, 140, 205, 247, 289], "scalindua": [0, 10, 140, 205, 247, 289], "broda": [0, 10, 140, 205, 247, 289], "kitasatoni": [0, 10, 140, 205, 247, 289], "16761": [0, 10, 140, 205, 247, 289], "1039": [0, 10, 140, 205, 247, 289], "oribacterium": [0, 10, 140, 205, 247, 289], "f0268": [0, 10, 140, 205, 247, 289], "alkylphenolica": [0, 10, 140, 205, 247, 289], "psychrotoleran": [0, 10, 140, 205, 247, 289], "l19": [0, 10, 140, 205, 247, 289], "nap1": [0, 10, 140, 205, 247, 289], "vini": [0, 10, 140, 205, 247, 289], "20605": [0, 10, 140, 205, 247, 289], "akkermansia": [0, 10, 140, 205, 247, 289], "muciniphila": [0, 10, 140, 205, 247, 289], "835": [0, 10, 140, 205, 247, 289], "valliformi": [0, 10, 140, 205, 247, 289], "45023": [0, 10, 140, 205, 247, 289], "ganjiahuensi": [0, 10, 140, 205, 247, 289], "45031": [0, 10, 140, 205, 247, 289], "parascrofulaceum": [0, 10, 140, 205, 247, 289], "614": [0, 10, 140, 205, 247, 289], "pterocl": [0, 10, 140, 205, 247, 289], "gutturali": [0, 10, 140, 205, 247, 289], "woodsholea": [0, 10, 140, 205, 247, 289], "17123": [0, 10, 140, 205, 247, 289], "dabanensi": [0, 10, 140, 205, 247, 289], "dioxanivoran": [0, 10, 140, 205, 247, 289], "cb1190": [0, 10, 140, 205, 247, 289], "crinalium": [0, 10, 140, 205, 247, 289], "epipsammum": [0, 10, 140, 205, 247, 289], "9333": [0, 10, 140, 205, 247, 289], "sueciensi": [0, 10, 140, 205, 247, 289], "17243": [0, 10, 140, 205, 247, 289], "lucimarinu": [0, 10, 140, 205, 247, 289], "cce9901": [0, 10, 140, 205, 247, 289], "xenoturbella": [0, 10, 140, 205, 247, 289], "bocki": [0, 10, 140, 205, 247, 289], "acidilobu": [0, 10, 140, 205, 247, 289], "saccharovoran": [0, 10, 140, 205, 247, 289], "345": [0, 10, 140, 205, 247, 289], "bergensi": [0, 10, 140, 205, 247, 289], "17361": [0, 10, 140, 205, 247, 289], "thiocyanodenitrifican": [0, 10, 140, 205, 247, 289], "arhd": [0, 10, 140, 205, 247, 289], "lutea": [0, 10, 140, 205, 247, 289], "methylohalobiu": [0, 10, 140, 205, 247, 289], "crimeensi": [0, 10, 140, 205, 247, 289], "10ki": [0, 10, 140, 205, 247, 289], "variicola": [0, 10, 140, 205, 247, 289], "uci": [0, 10, 140, 205, 247, 289], "thiocapsa": [0, 10, 140, 205, 247, 289], "5811": [0, 10, 140, 205, 247, 289], "paracaedimona": [0, 10, 140, 205, 247, 289], "symbiosu": [0, 10, 140, 205, 247, 289], "hoeflea": [0, 10, 140, 205, 247, 289], "phototrophica": [0, 10, 140, 205, 247, 289], "43": [0, 9, 10, 140, 205, 247, 289], "nautilia": [0, 10, 140, 205, 247, 289], "profundicola": [0, 10, 140, 205, 247, 289], "amh": [0, 10, 140, 205, 247, 289], "macauensi": [0, 10, 140, 205, 247, 289], "zfhkf": [0, 10, 140, 205, 247, 289], "ichthyophaga": [0, 10, 140, 205, 247, 289], "yoonia": [0, 10, 140, 205, 247, 289], "vestfoldensi": [0, 10, 140, 205, 247, 289], "ska53": [0, 10, 140, 205, 247, 289], "acidomyc": [0, 10, 140, 205, 247, 289], "richmondensi": [0, 10, 140, 205, 247, 289], "15952": [0, 10, 140, 205, 247, 289], "bogoriensi": [0, 10, 140, 205, 247, 289], "922": [0, 10, 140, 205, 247, 289], "equorum": [0, 10, 140, 205, 247, 289], "mu2": [0, 10, 140, 205, 247, 289], "wh2": [0, 10, 140, 205, 247, 289], "am4": [0, 10, 140, 205, 247, 289], "serinicoccu": [0, 10, 140, 205, 247, 289], "15273": [0, 10, 140, 205, 247, 289], "jettenia": [0, 10, 140, 205, 247, 289], "caeni": [0, 10, 140, 205, 247, 289], "pinatubonensi": [0, 10, 140, 205, 247, 289], "jmp134": [0, 10, 140, 205, 247, 289], "mucispirillum": [0, 10, 140, 205, 247, 289], "schaedleri": [0, 10, 140, 205, 247, 289], "asf457": [0, 10, 140, 205, 247, 289], "testacea": [0, 10, 140, 205, 247, 289], "100365": [0, 10, 140, 205, 247, 289], "coccomyxa": [0, 10, 140, 205, 247, 289], "subellipsoidea": [0, 10, 140, 205, 247, 289], "cardinium": [0, 10, 140, 205, 247, 289], "ceper1": [0, 10, 140, 205, 247, 289], "encarsia": [0, 10, 140, 205, 247, 289], "pergandiella": [0, 10, 140, 205, 247, 289], "frigen": [0, 10, 140, 205, 247, 289], "12807": [0, 10, 140, 205, 247, 289], "marmori": [0, 10, 140, 205, 247, 289], "12784": [0, 10, 140, 205, 247, 289], "vafer": [0, 10, 140, 205, 247, 289], "bvaf": [0, 10, 140, 205, 247, 289], "chromaiod": [0, 10, 140, 205, 247, 289], "640": [0, 10, 140, 205, 247, 289], "tomato": [0, 10, 140, 205, 247, 289], "dc3000": [0, 10, 140, 205, 247, 289], "oceanicola": [0, 10, 140, 205, 247, 289], "granulosu": [0, 10, 140, 205, 247, 289], "htcc2516": [0, 10, 140, 205, 247, 289], "robiginitalea": [0, 10, 140, 205, 247, 289], "biformata": [0, 10, 140, 205, 247, 289], "htcc2501": [0, 10, 140, 205, 247, 289], "ezura": [0, 10, 140, 205, 247, 289], "102218": [0, 10, 140, 205, 247, 289], "boulardii": [0, 10, 140, 205, 247, 289], "nom": [0, 10, 140, 205, 247, 289], "inval": [0, 10, 140, 205, 247, 289], "clytia": [0, 10, 140, 205, 247, 289], "hemisphaerica": [0, 10, 140, 205, 247, 289], "mahella": [0, 10, 140, 205, 247, 289], "australiensi": [0, 10, 140, 205, 247, 289], "bon": [0, 10, 140, 205, 247, 289], "phenoliruptrix": [0, 10, 140, 205, 247, 289], "br3459a": [0, 10, 140, 205, 247, 289], "natronolimnohabitan": [0, 10, 140, 205, 247, 289], "innermongolicu": [0, 10, 140, 205, 247, 289], "12255": [0, 10, 140, 205, 247, 289], "ethanoligenen": [0, 10, 140, 205, 247, 289], "harbinens": [0, 10, 140, 205, 247, 289], "yuan": [0, 10, 140, 205, 247, 289], "owenweeksia": [0, 10, 140, 205, 247, 289], "17368": [0, 10, 140, 205, 247, 289], "verruconi": [0, 10, 140, 205, 247, 289], "gallopava": [0, 10, 140, 205, 247, 289], "monophora": [0, 10, 140, 205, 247, 289], "solimona": [0, 10, 140, 205, 247, 289], "variicolori": [0, 10, 140, 205, 247, 289], "15731": [0, 10, 140, 205, 247, 289], "fordii": [0, 10, 140, 205, 247, 289], "16014": [0, 10, 140, 205, 247, 289], "108821": [0, 10, 140, 205, 247, 289], "castoreu": [0, 10, 140, 205, 247, 289], "17536": [0, 10, 140, 205, 247, 289], "paeniglutamicibact": [0, 10, 140, 205, 247, 289], "gangotriensi": [0, 10, 140, 205, 247, 289], "lz1y": [0, 10, 140, 205, 247, 289], "21996": [0, 10, 140, 205, 247, 289], "glycomyc": [0, 10, 140, 205, 247, 289], "arizonensi": [0, 10, 140, 205, 247, 289], "44726": [0, 10, 140, 205, 247, 289], "parvibaculum": [0, 10, 140, 205, 247, 289], "lavamentivoran": [0, 10, 140, 205, 247, 289], "glutamicibact": [0, 10, 140, 205, 247, 289], "arilaitensi": [0, 10, 140, 205, 247, 289], "re117": [0, 10, 140, 205, 247, 289], "gulosibact": [0, 10, 140, 205, 247, 289], "molinativorax": [0, 10, 140, 205, 247, 289], "13485": [0, 10, 140, 205, 247, 289], "lentisphaera": [0, 10, 140, 205, 247, 289], "araneosa": [0, 10, 140, 205, 247, 289], "htcc2155": [0, 10, 140, 205, 247, 289], "phyllosphaera": [0, 10, 140, 205, 247, 289], "aobensi": [0, 10, 140, 205, 247, 289], "100429": [0, 10, 140, 205, 247, 289], "concava": [0, 10, 140, 205, 247, 289], "100430": [0, 10, 140, 205, 247, 289], "pleomorphomona": [0, 10, 140, 205, 247, 289], "23070": [0, 10, 140, 205, 247, 289], "gilardii": [0, 10, 140, 205, 247, 289], "rosea": [0, 10, 140, 205, 247, 289], "691": [0, 10, 140, 205, 247, 289], "pseudopneumonia": [0, 10, 140, 205, 247, 289], "is7493": [0, 10, 140, 205, 247, 289], "arboriphila": [0, 10, 140, 205, 247, 289], "resisten": [0, 10, 140, 205, 247, 289], "45100": [0, 10, 140, 205, 247, 289], "cosmeticum": [0, 10, 140, 205, 247, 289], "anticariensi": [0, 10, 140, 205, 247, 289], "fp35": [0, 10, 140, 205, 247, 289], "16096": [0, 10, 140, 205, 247, 289], "desulfatibacillum": [0, 10, 140, 205, 247, 289], "alkenivoran": [0, 10, 140, 205, 247, 289], "ak": [0, 10, 140, 205, 247, 289], "takedensi": [0, 10, 140, 205, 247, 289], "100417": [0, 10, 140, 205, 247, 289], "aromatica": [0, 10, 140, 205, 247, 289], "rcb": [0, 10, 140, 205, 247, 289], "microbulbif": [0, 10, 140, 205, 247, 289], "agarilyticu": [0, 10, 140, 205, 247, 289], "s89": [0, 10, 140, 205, 247, 289], "insulaenigra": [0, 10, 140, 205, 247, 289], "12927": [0, 10, 140, 205, 247, 289], "is79a3": [0, 10, 140, 205, 247, 289], "intestinibact": [0, 10, 140, 205, 247, 289], "bartlettii": [0, 10, 140, 205, 247, 289], "16795": [0, 10, 140, 205, 247, 289], "phytofirman": [0, 10, 140, 205, 247, 289], "psjn": [0, 10, 140, 205, 247, 289], "liflandii": [0, 10, 140, 205, 247, 289], "128fxt": [0, 10, 140, 205, 247, 289], "cavenderia": [0, 10, 140, 205, 247, 289], "fasciculata": [0, 10, 140, 205, 247, 289], "thermosinu": [0, 10, 140, 205, 247, 289], "carboxydivoran": [0, 10, 140, 205, 247, 289], "nor1": [0, 10, 140, 205, 247, 289], "16300": [0, 10, 140, 205, 247, 289], "kangiella": [0, 10, 140, 205, 247, 289], "16069": [0, 10, 140, 205, 247, 289], "aquimarina": [0, 10, 140, 205, 247, 289], "16071": [0, 10, 140, 205, 247, 289], "daepoensi": [0, 10, 140, 205, 247, 289], "16072": [0, 10, 140, 205, 247, 289], "concretioni": [0, 10, 140, 205, 247, 289], "ko07": [0, 10, 140, 205, 247, 289], "16239": [0, 10, 140, 205, 247, 289], "110307": [0, 10, 140, 205, 247, 289], "quinghaiensi": [0, 10, 140, 205, 247, 289], "15701": [0, 10, 140, 205, 247, 289], "salipig": [0, 10, 140, 205, 247, 289], "16094": [0, 10, 140, 205, 247, 289], "pel": [0, 10, 140, 205, 247, 289], "viridibacillu": [0, 10, 140, 205, 247, 289], "arenosi": [0, 10, 140, 205, 247, 289], "r5": [0, 10, 140, 205, 247, 289], "crocosphaera": [0, 10, 140, 205, 247, 289], "watsonii": [0, 10, 140, 205, 247, 289], "8501": [0, 10, 140, 205, 247, 289], "murina": [0, 10, 140, 205, 247, 289], "ushuaiensi": [0, 10, 140, 205, 247, 289], "15871": [0, 10, 140, 205, 247, 289], "effusa": [0, 10, 140, 205, 247, 289], "100432": [0, 10, 140, 205, 247, 289], "marincola": [0, 10, 140, 205, 247, 289], "16067": [0, 10, 140, 205, 247, 289], "botryobasidium": [0, 10, 140, 205, 247, 289], "botryosum": [0, 10, 140, 205, 247, 289], "grandiflora": [0, 10, 140, 205, 247, 289], "oceanimona": [0, 10, 140, 205, 247, 289], "smirnovii": [0, 10, 140, 205, 247, 289], "equifetal": [0, 10, 140, 205, 247, 289], "29724": [0, 10, 140, 205, 247, 289], "granularum": [0, 10, 140, 205, 247, 289], "19168": [0, 10, 140, 205, 247, 289], "hippikon": [0, 10, 140, 205, 247, 289], "29725": [0, 10, 140, 205, 247, 289], "trichormu": [0, 10, 140, 205, 247, 289], "29413": [0, 10, 140, 205, 247, 289], "byssochlami": [0, 10, 140, 205, 247, 289], "spectabili": [0, 10, 140, 205, 247, 289], "No": [0, 2, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 140, 205, 247, 289, 292], "salinimona": [0, 10, 140, 205, 247, 289], "chungwhensi": [0, 10, 140, 205, 247, 289], "16280": [0, 10, 140, 205, 247, 289], "pontibacillu": [0, 10, 140, 205, 247, 289], "bh030062": [0, 10, 140, 205, 247, 289], "silanimona": [0, 10, 140, 205, 247, 289], "16282": [0, 10, 140, 205, 247, 289], "desulfurispora": [0, 10, 140, 205, 247, 289], "16022": [0, 10, 140, 205, 247, 289], "alcoholivorax": [0, 10, 140, 205, 247, 289], "16058": [0, 10, 140, 205, 247, 289], "sh": [0, 10, 140, 205, 247, 289], "tepidaman": [0, 10, 140, 205, 247, 289], "ps2": [0, 10, 140, 205, 247, 289], "methylovoru": [0, 10, 140, 205, 247, 289], "glucosetrophu": [0, 10, 140, 205, 247, 289], "sip3": [0, 10, 140, 205, 247, 289], "pseudocohnilembu": [0, 10, 140, 205, 247, 289], "persalinu": [0, 10, 140, 205, 247, 289], "gingivicani": [0, 10, 140, 205, 247, 289], "chelativoran": [0, 10, 140, 205, 247, 289], "bnc1": [0, 10, 140, 205, 247, 289], "700307": [0, 10, 140, 205, 247, 289], "thalassobact": [0, 10, 140, 205, 247, 289], "stenotrophicu": [0, 10, 140, 205, 247, 289], "granulicoccu": [0, 10, 140, 205, 247, 289], "phenolivoran": [0, 10, 140, 205, 247, 289], "17626": [0, 10, 140, 205, 247, 289], "107789": [0, 10, 140, 205, 247, 289], "15570": [0, 10, 140, 205, 247, 289], "kefiranofacien": [0, 10, 140, 205, 247, 289], "zw3": [0, 10, 140, 205, 247, 289], "wynnii": [0, 10, 140, 205, 247, 289], "nitratifractor": [0, 10, 140, 205, 247, 289], "salsugini": [0, 10, 140, 205, 247, 289], "16511": [0, 10, 140, 205, 247, 289], "marimammalium": [0, 10, 140, 205, 247, 289], "18627": [0, 10, 140, 205, 247, 289], "11697": [0, 10, 140, 205, 247, 289], "atopococcu": [0, 10, 140, 205, 247, 289], "17538": [0, 10, 140, 205, 247, 289], "rattimassiliensi": [0, 10, 140, 205, 247, 289], "elb17": [0, 10, 140, 205, 247, 289], "fangia": [0, 10, 140, 205, 247, 289], "fsc776": [0, 10, 140, 205, 247, 289], "21703": [0, 10, 140, 205, 247, 289], "alcaliphilum": [0, 10, 140, 205, 247, 289], "20z": [0, 10, 140, 205, 247, 289], "sedimini": [0, 10, 140, 205, 247, 289], "haw": [0, 10, 140, 205, 247, 289], "eb3": [0, 10, 140, 205, 247, 289], "halifaxensi": [0, 10, 140, 205, 247, 289], "eb4": [0, 10, 140, 205, 247, 289], "19726": [0, 10, 140, 205, 247, 289], "castelli": [0, 10, 140, 205, 247, 289], "16402": [0, 10, 140, 205, 247, 289], "punctiform": [0, 10, 140, 205, 247, 289], "73102": [0, 10, 140, 205, 247, 289], "olleya": [0, 10, 140, 205, 247, 289], "marilimosa": [0, 10, 140, 205, 247, 289], "cam030": [0, 10, 140, 205, 247, 289], "19115": [0, 10, 140, 205, 247, 289], "hyaloperonospora": [0, 10, 140, 205, 247, 289], "arabidopsidi": [0, 10, 140, 205, 247, 289], "bh030004": [0, 10, 140, 205, 247, 289], "16465": [0, 10, 140, 205, 247, 289], "orthopsilosi": [0, 10, 140, 205, 247, 289], "co": [0, 10, 140, 205, 247, 289], "metapsilosi": [0, 10, 140, 205, 247, 289], "sphaerochaeta": [0, 10, 140, 205, 247, 289], "coccoid": [0, 10, 140, 205, 247, 289], "17374": [0, 10, 140, 205, 247, 289], "16307": [0, 10, 140, 205, 247, 289], "ncib": [0, 10, 140, 205, 247, 289], "8327": [0, 10, 140, 205, 247, 289], "limimaricola": [0, 10, 140, 205, 247, 289], "17492": [0, 10, 140, 205, 247, 289], "opitutacea": [0, 10, 140, 205, 247, 289], "tav1": [0, 10, 140, 205, 247, 289], "acidobacteriacea": [0, 10, 140, 205, 247, 289], "taa": [0, 10, 140, 205, 247, 289], "166": [0, 10, 140, 205, 247, 289], "arena": [0, 10, 140, 205, 247, 289], "19832": [0, 10, 140, 205, 247, 289], "gramella": [0, 10, 140, 205, 247, 289], "echinicola": [0, 10, 140, 205, 247, 289], "19838": [0, 10, 140, 205, 247, 289], "novosphingopyxi": [0, 10, 140, 205, 247, 289], "baekryungensi": [0, 10, 140, 205, 247, 289], "16222": [0, 10, 140, 205, 247, 289], "agromyc": [0, 10, 140, 205, 247, 289], "16388": [0, 10, 140, 205, 247, 289], "antrostomu": [0, 10, 140, 205, 247, 289], "baichengensi": [0, 10, 140, 205, 247, 289], "90130": [0, 10, 140, 205, 247, 289], "pochonia": [0, 10, 140, 205, 247, 289], "chlamydosporia": [0, 10, 140, 205, 247, 289], "170": [0, 10, 140, 167, 205, 247, 289], "doebereinera": [0, 10, 140, 205, 247, 289], "ufla1": [0, 10, 140, 205, 247, 289], "amoebophilu": [0, 10, 140, 205, 247, 289], "5a2": [0, 10, 140, 205, 247, 289], "rozella": [0, 10, 140, 205, 247, 289], "allomyci": [0, 10, 140, 205, 247, 289], "csf55": [0, 10, 140, 205, 247, 289], "uenoni": [0, 10, 140, 205, 247, 289], "16608": [0, 10, 140, 205, 247, 289], "101359": [0, 10, 140, 205, 247, 289], "kosakonia": [0, 10, 140, 205, 247, 289], "radicincitan": [0, 10, 140, 205, 247, 289], "16656": [0, 10, 140, 205, 247, 289], "bsw20308": [0, 10, 140, 205, 247, 289], "pseudintermediu": [0, 10, 140, 205, 247, 289], "ed99": [0, 10, 140, 205, 247, 289], "stackebrandtia": [0, 10, 140, 205, 247, 289], "nassauensi": [0, 10, 140, 205, 247, 289], "44728": [0, 10, 140, 205, 247, 289], "capitella": [0, 10, 140, 205, 247, 289], "teleta": [0, 10, 140, 205, 247, 289], "phenylobacterium": [0, 10, 140, 205, 247, 289], "zucineum": [0, 10, 140, 205, 247, 289], "hlk1": [0, 10, 140, 205, 247, 289], "flavovariabili": [0, 10, 140, 205, 247, 289], "dieselolei": [0, 10, 140, 205, 247, 289], "b5": [0, 10, 140, 205, 247, 289], "thioclava": [0, 10, 140, 205, 247, 289], "10166": [0, 10, 140, 205, 247, 289], "nitrogenifigen": [0, 10, 140, 205, 247, 289], "23921": [0, 10, 140, 205, 247, 289], "23498": [0, 10, 140, 205, 247, 289], "roseochromogenu": [0, 10, 140, 205, 247, 289], "oscitan": [0, 10, 140, 205, 247, 289], "976": [0, 10, 140, 205, 247, 289], "xylophagu": [0, 10, 140, 205, 247, 289], "sviceu": [0, 10, 140, 205, 247, 289], "29083": [0, 10, 140, 205, 247, 289], "fulvoviolaceu": [0, 10, 140, 205, 247, 289], "thermolilacinu": [0, 10, 140, 205, 247, 289], "spc6": [0, 10, 140, 205, 247, 289], "lupini": [0, 10, 140, 205, 247, 289], "lupac": [0, 10, 140, 205, 247, 289], "ganghwensi": [0, 10, 140, 205, 247, 289], "17046": [0, 10, 140, 205, 247, 289], "episyrphu": [0, 10, 140, 205, 247, 289], "balteatu": [0, 10, 140, 205, 247, 289], "alkaliflexu": [0, 10, 140, 205, 247, 289], "imshenetskii": [0, 10, 140, 205, 247, 289], "15055": [0, 10, 140, 205, 247, 289], "segniliparu": [0, 10, 140, 205, 247, 289], "rotundu": [0, 10, 140, 205, 247, 289], "44985": [0, 10, 140, 205, 247, 289], "rugosu": [0, 10, 140, 205, 247, 289], "974": [0, 10, 140, 205, 247, 289], "hellea": [0, 10, 140, 205, 247, 289], "balneolensi": [0, 10, 140, 205, 247, 289], "19091": [0, 10, 140, 205, 247, 289], "haliea": [0, 10, 140, 205, 247, 289], "19537": [0, 10, 140, 205, 247, 289], "balneola": [0, 10, 140, 205, 247, 289], "17893": [0, 10, 140, 205, 247, 289], "rifamycinica": [0, 10, 140, 205, 247, 289], "btai1": [0, 10, 140, 205, 247, 289], "kordiimona": [0, 10, 140, 205, 247, 289], "gwangyangensi": [0, 10, 140, 205, 247, 289], "19435": [0, 10, 140, 205, 247, 289], "12864": [0, 10, 140, 205, 247, 289], "lychnidi": [0, 10, 140, 205, 247, 289], "dioica": [0, 10, 140, 205, 247, 289], "p1a1": [0, 10, 140, 205, 247, 289], "lamol": [0, 10, 140, 205, 247, 289], "clariflavum": [0, 10, 140, 205, 247, 289], "19732": [0, 10, 140, 205, 247, 289], "aff": [0, 10, 140, 205, 247, 289], "tub": [0, 10, 140, 205, 247, 289], "011817": [0, 10, 140, 205, 247, 289], "helcogen": [0, 10, 140, 205, 247, 289], "108": [0, 10, 140, 205, 247, 289, 324, 325], "exalbida": [0, 10, 140, 205, 247, 289], "100660": [0, 10, 140, 205, 247, 289], "occitani": [0, 10, 140, 205, 247, 289], "granuli": [0, 10, 140, 205, 247, 289], "101663": [0, 10, 140, 205, 247, 289], "fb24": [0, 10, 140, 205, 247, 289], "jannaschia": [0, 10, 140, 205, 247, 289], "ccs1": [0, 10, 140, 205, 247, 289], "aminiphilu": [0, 10, 140, 205, 247, 289], "circumscriptu": [0, 10, 140, 205, 247, 289], "16581": [0, 10, 140, 205, 247, 289], "photorhabdu": [0, 10, 140, 205, 247, 289], "asymbiotica": [0, 10, 140, 205, 247, 289], "melophagi": [0, 10, 140, 205, 247, 289], "2c": [0, 10, 140, 205, 247, 289], "salyersia": [0, 10, 140, 205, 247, 289], "wal": [0, 10, 140, 205, 247, 289], "10018": [0, 10, 140, 205, 247, 289], "18765": [0, 10, 140, 205, 247, 289], "12988": [0, 10, 140, 205, 247, 289], "nordii": [0, 10, 140, 205, 247, 289], "cl02t12c05": [0, 10, 140, 205, 247, 289], "acaricom": [0, 10, 140, 205, 247, 289], "phytoseiuli": [0, 10, 140, 205, 247, 289], "14247": [0, 10, 140, 205, 247, 289], "thermosediminibact": [0, 10, 140, 205, 247, 289], "16646": [0, 10, 140, 205, 247, 289], "tm1040": [0, 10, 140, 205, 247, 289], "dactylococcopsi": [0, 10, 140, 205, 247, 289], "8305": [0, 10, 140, 205, 247, 289], "flavonifractor": [0, 10, 140, 205, 247, 289], "plautii": [0, 10, 140, 205, 247, 289], "1_3_50afaa": [0, 10, 140, 205, 247, 289], "4400831": [0, 10, 140, 205, 247, 289], "108448": [0, 10, 140, 205, 247, 289], "49529": [0, 10, 140, 205, 247, 289], "martelella": [0, 10, 140, 205, 247, 289], "17316": [0, 10, 140, 205, 247, 289], "haloquadratum": [0, 10, 140, 205, 247, 289], "walsbyi": [0, 10, 140, 205, 247, 289], "j07hqw2": [0, 10, 140, 205, 247, 289], "cyphellophora": [0, 10, 140, 205, 247, 289], "alkalitoleran": [0, 10, 140, 205, 247, 289], "16529": [0, 10, 140, 205, 247, 289], "subbeticu": [0, 10, 140, 205, 247, 289], "16689": [0, 10, 140, 205, 247, 289], "proteiniphilum": [0, 10, 140, 205, 247, 289], "acetatigen": [0, 10, 140, 205, 247, 289], "18083": [0, 10, 140, 205, 247, 289], "rubellimicrobium": [0, 10, 140, 205, 247, 289], "16684": [0, 10, 140, 205, 247, 289], "hepatoplasma": [0, 10, 140, 205, 247, 289], "crinochetorum": [0, 10, 140, 205, 247, 289], "av": [0, 10, 140, 205, 247, 289], "commoda": [0, 10, 140, 205, 247, 289], "js666": [0, 10, 140, 205, 247, 289], "caldalkalibacillu": [0, 10, 140, 205, 247, 289], "ta2": [0, 10, 140, 205, 247, 289], "patulibact": [0, 10, 140, 205, 247, 289], "minatonensi": [0, 10, 140, 205, 247, 289], "18081": [0, 10, 140, 205, 247, 289], "ean1pec": [0, 10, 140, 205, 247, 289], "inefficax": [0, 10, 140, 205, 247, 289], "saprophytica": [0, 10, 140, 205, 247, 289], "spongia": [0, 10, 140, 205, 247, 289], "ust010723": [0, 10, 140, 205, 247, 289], "006": [0, 10, 140, 205, 247, 289], "leptotrombidium": [0, 10, 140, 205, 247, 289], "deliens": [0, 10, 140, 205, 247, 289], "adhaeribact": [0, 10, 140, 205, 247, 289], "16391": [0, 10, 140, 205, 247, 289], "toba": [0, 10, 140, 205, 247, 289], "triatoma": [0, 10, 140, 205, 247, 289], "bk": [0, 10, 140, 205, 247, 289], "fr1064": [0, 10, 140, 205, 247, 289], "meyersii": [0, 10, 140, 205, 247, 289], "8951": [0, 10, 140, 205, 247, 289], "catellicoccu": [0, 10, 140, 205, 247, 289], "m35": [0, 10, 140, 205, 247, 289], "lehensi": [0, 10, 140, 205, 247, 289], "g1": [0, 10, 140, 205, 247, 289], "methanosaeta": [0, 10, 140, 205, 247, 289], "harundinacea": [0, 10, 140, 205, 247, 289], "6ac": [0, 10, 140, 205, 247, 289], "advenella": [0, 10, 140, 205, 247, 289], "mimigardefordensi": [0, 10, 140, 205, 247, 289], "dpn7": [0, 10, 140, 205, 247, 289], "tuscaniens": [0, 10, 140, 205, 247, 289], "dnf00037": [0, 10, 140, 205, 247, 289], "kuroshimensi": [0, 10, 140, 205, 247, 289], "18393": [0, 10, 140, 205, 247, 289], "harbinensi": [0, 10, 140, 205, 247, 289], "16991": [0, 10, 140, 205, 247, 289], "catenulispora": [0, 10, 140, 205, 247, 289], "44928": [0, 10, 140, 205, 247, 289], "actinospica": [0, 10, 140, 205, 247, 289], "robinia": [0, 10, 140, 205, 247, 289], "44927": [0, 10, 140, 205, 247, 289], "endozoicomona": [0, 10, 140, 205, 247, 289], "elysicola": [0, 10, 140, 205, 247, 289], "pusillimona": [0, 10, 140, 205, 247, 289], "noertemannii": [0, 10, 140, 205, 247, 289], "bs8": [0, 10, 140, 205, 247, 289], "marinimicrobium": [0, 10, 140, 205, 247, 289], "agarilyticum": [0, 10, 140, 205, 247, 289], "16975": [0, 10, 140, 205, 247, 289], "timidu": [0, 10, 140, 205, 247, 289], "17022": [0, 10, 140, 205, 247, 289], "apodemi": [0, 10, 140, 205, 247, 289], "16634": [0, 10, 140, 205, 247, 289], "16172": [0, 10, 140, 205, 247, 289], "vrystaatens": [0, 10, 140, 205, 247, 289], "gracilibacillu": [0, 10, 140, 205, 247, 289], "boraciitoleran": [0, 10, 140, 205, 247, 289], "21714": [0, 10, 140, 205, 247, 289], "boroniphilu": [0, 10, 140, 205, 247, 289], "21738": [0, 10, 140, 205, 247, 289], "microaerophilu": [0, 10, 140, 205, 247, 289], "upii": [0, 10, 140, 205, 247, 289], "chrysiogen": [0, 10, 140, 205, 247, 289], "arsenati": [0, 10, 140, 205, 247, 289], "11915": [0, 10, 140, 205, 247, 289], "persephonella": [0, 10, 140, 205, 247, 289], "h1": [0, 10, 140, 205, 247, 289], "azorens": [0, 10, 140, 205, 247, 289], "az": [0, 10, 140, 205, 247, 289], "fu1": [0, 10, 140, 205, 247, 289], "sao": [0, 10, 140, 205, 247, 289], "paulo": [0, 10, 140, 205, 247, 289], "apachensi": [0, 10, 140, 205, 247, 289], "19763": [0, 10, 140, 205, 247, 289], "maricopensi": [0, 10, 140, 205, 247, 289], "21211": [0, 10, 140, 205, 247, 289], "pimensi": [0, 10, 140, 205, 247, 289], "21231": [0, 10, 140, 205, 247, 289], "plebeiu": [0, 10, 140, 205, 247, 289], "17135": [0, 10, 140, 205, 247, 289], "coprocola": [0, 10, 140, 205, 247, 289], "17136": [0, 10, 140, 205, 247, 289], "10003": [0, 10, 140, 205, 247, 289], "neofusicoccum": [0, 10, 140, 205, 247, 289], "multisaccharivorax": [0, 10, 140, 205, 247, 289], "17128": [0, 10, 140, 205, 247, 289], "kashmirensi": [0, 10, 140, 205, 247, 289], "w13003": [0, 10, 140, 205, 247, 289], "deserti": [0, 10, 140, 205, 247, 289], "vcd115": [0, 10, 140, 205, 247, 289], "modiolu": [0, 10, 140, 205, 247, 289], "philippinarum": [0, 10, 140, 205, 247, 289], "linnemannia": [0, 10, 140, 205, 247, 289], "ag": [0, 9, 10, 140, 205, 247, 289], "77": [0, 10, 140, 205, 247, 289, 324, 325], "100964": [0, 10, 140, 205, 247, 289], "kodakarensi": [0, 10, 140, 205, 247, 289], "kod1": [0, 10, 140, 205, 247, 289], "mimosarum": [0, 10, 140, 205, 247, 289], "23256": [0, 10, 140, 205, 247, 289], "106338": [0, 10, 140, 205, 247, 289], "gptsa100": [0, 10, 140, 205, 247, 289], "17447": [0, 10, 140, 205, 247, 289], "emticicia": [0, 10, 140, 205, 247, 289], "oligotrophica": [0, 10, 140, 205, 247, 289], "17448": [0, 10, 140, 205, 247, 289], "entomophila": [0, 10, 140, 205, 247, 289], "l48": [0, 10, 140, 205, 247, 289], "18628": [0, 10, 140, 205, 247, 289], "croceibact": [0, 10, 140, 205, 247, 289], "atlanticu": [0, 10, 140, 205, 247, 289], "htcc2559": [0, 10, 140, 205, 247, 289], "janibact": [0, 10, 140, 205, 247, 289], "htcc2649": [0, 10, 140, 205, 247, 289], "dokdonia": [0, 10, 140, 205, 247, 289], "med134": [0, 10, 140, 205, 247, 289], "med152": [0, 10, 140, 205, 247, 289], "maribact": [0, 10, 140, 205, 247, 289], "htcc2170": [0, 10, 140, 205, 247, 289], "lyngbya": [0, 10, 140, 205, 247, 289], "8106": [0, 10, 140, 205, 247, 289], "bl107": [0, 10, 140, 205, 247, 289], "14911": [0, 10, 140, 205, 247, 289], "lovleyi": [0, 10, 140, 205, 247, 289], "sz": [0, 10, 140, 205, 247, 289], "drechslerella": [0, 10, 140, 205, 247, 289], "stenobrocha": [0, 10, 140, 205, 247, 289], "248": [0, 10, 140, 205, 247, 289], "311a": [0, 10, 140, 205, 247, 289], "htcc2633": [0, 10, 140, 205, 247, 289], "pseudooceanicola": [0, 10, 140, 205, 247, 289], "batsensi": [0, 10, 140, 205, 247, 289], "htcc2597": [0, 10, 140, 205, 247, 289], "med193": [0, 10, 140, 205, 247, 289], "nubinhiben": [0, 10, 140, 205, 247, 289], "ism": [0, 10, 140, 205, 247, 289], "217": [0, 10, 140, 205, 247, 289], "ska58": [0, 10, 140, 205, 247, 289], "rhodobacteracea": [0, 10, 140, 205, 247, 289], "htcc2083": [0, 10, 140, 205, 247, 289], "med121": [0, 10, 140, 205, 247, 289], "tunicata": [0, 10, 140, 205, 247, 289], "d2": [0, 10, 140, 205, 247, 289], "psychromona": [0, 10, 140, 205, 247, 289], "cnpt3": [0, 10, 140, 205, 247, 289], "med222": [0, 10, 140, 205, 247, 289], "prolixibact": [0, 10, 140, 205, 247, 289], "bellariivoran": [0, 10, 140, 205, 247, 289], "1284": [0, 10, 140, 205, 247, 289], "mariprofundu": [0, 10, 140, 205, 247, 289], "ferrooxydan": [0, 10, 140, 205, 247, 289], "pseudoxanthomona": [0, 10, 140, 205, 247, 289], "suwonensi": [0, 10, 140, 205, 247, 289], "gallolyticu": [0, 10, 140, 205, 247, 289], "2069": [0, 10, 140, 205, 247, 289], "belgica": [0, 10, 140, 205, 247, 289], "leadbetterella": [0, 10, 140, 205, 247, 289], "byssophila": [0, 10, 140, 205, 247, 289], "17132": [0, 10, 140, 205, 247, 289], "syntrophu": [0, 10, 140, 205, 247, 289], "aciditrophicu": [0, 10, 140, 205, 247, 289], "rcc307": [0, 10, 140, 205, 247, 289], "cc9902": [0, 10, 140, 205, 247, 289], "microbispora": [0, 10, 140, 205, 247, 289], "pta": [0, 10, 140, 205, 247, 289], "5024": [0, 10, 140, 205, 247, 289], "benzoatilyticu": [0, 10, 140, 205, 247, 289], "ja2": [0, 10, 140, 205, 247, 289], "35": [0, 10, 140, 205, 247, 289], "kuraishia": [0, 10, 140, 205, 247, 289], "1240": [0, 10, 140, 205, 247, 289], "7107": [0, 10, 140, 205, 247, 289], "rufum": [0, 10, 140, 205, 247, 289], "js19b1": [0, 10, 140, 205, 247, 289], "16368": [0, 10, 140, 205, 247, 289], "sulfidigen": [0, 10, 140, 205, 247, 289], "wsm1743": [0, 10, 140, 205, 247, 289], "wsm1253": [0, 10, 140, 205, 247, 289], "wsm471": [0, 10, 140, 205, 247, 289], "nonlaben": [0, 10, 140, 205, 247, 289], "lundens": [0, 10, 140, 205, 247, 289], "17049": [0, 10, 140, 205, 247, 289], "agariphila": [0, 10, 140, 205, 247, 289], "3901": [0, 10, 140, 205, 247, 289], "soli": [0, 10, 140, 205, 247, 289], "108243": [0, 10, 140, 205, 247, 289], "eumusa": [0, 10, 140, 205, 247, 289], "ja": [0, 10, 140, 205, 247, 289], "3ab": [0, 10, 140, 205, 247, 289], "3b": [0, 10, 140, 205, 247, 289], "r28": [0, 10, 140, 205, 247, 289], "simia": [0, 10, 140, 205, 247, 289], "wheat": [0, 10, 140, 205, 247, 289], "blue": [0, 2, 10, 140, 205, 221, 247, 289, 323], "dwarf": [0, 10, 140, 205, 247, 289], "23386": [0, 10, 140, 205, 247, 289], "sharpea": [0, 10, 140, 205, 247, 289], "azabuensi": [0, 10, 140, 205, 247, 289], "18934": [0, 10, 140, 205, 247, 289], "bhc": [0, 10, 140, 205, 247, 289], "valderiana": [0, 10, 140, 205, 247, 289], "bdu": [0, 10, 140, 205, 247, 289], "20041": [0, 10, 140, 205, 247, 289], "jdr": [0, 10, 140, 205, 247, 289], "kwoniella": [0, 10, 140, 205, 247, 289], "bestiola": [0, 10, 140, 205, 247, 289], "dejecticola": [0, 10, 140, 205, 247, 289], "10117": [0, 10, 140, 205, 247, 289], "moelleriella": [0, 10, 140, 205, 247, 289], "libera": [0, 10, 140, 205, 247, 289], "2490": [0, 10, 140, 205, 247, 289], "kernovia": [0, 10, 140, 205, 247, 289], "amblyomma": [0, 10, 140, 205, 247, 289], "pseudozyma": [0, 10, 140, 205, 247, 289], "hubeiensi": [0, 10, 140, 205, 247, 289], "accumulibact": [0, 10, 140, 205, 247, 289], "phosphati": [0, 10, 140, 205, 247, 289], "clade": [0, 10, 140, 205, 247, 289], "iia": [0, 10, 140, 205, 247, 289], "crudilacti": [0, 10, 140, 205, 247, 289], "syntrophorhabdu": [0, 10, 140, 205, 247, 289], "ui": [0, 10, 140, 205, 247, 289], "dokdonensi": [0, 10, 140, 205, 247, 289], "dsw": [0, 10, 140, 205, 247, 289], "goldsteinii": [0, 10, 140, 205, 247, 289], "dnlkv18": [0, 10, 140, 205, 247, 289], "onderdonkii": [0, 10, 140, 205, 247, 289], "8169": [0, 10, 140, 205, 247, 289], "19147": [0, 10, 140, 205, 247, 289], "8301": [0, 10, 140, 205, 247, 289], "rhizoclosmatium": [0, 10, 140, 205, 247, 289], "saliperosum": [0, 10, 140, 205, 247, 289], "s13": [0, 10, 140, 205, 247, 289], "17393": [0, 10, 140, 205, 247, 289], "jejuensi": [0, 10, 140, 205, 247, 289], "nitrospira": [0, 10, 140, 205, 247, 289], "cryohalolenti": [0, 10, 140, 205, 247, 289], "kamptonema": [0, 10, 140, 205, 247, 289], "formosum": [0, 10, 140, 205, 247, 289], "6407": [0, 10, 140, 205, 247, 289], "ut26": [0, 10, 140, 205, 247, 289], "drakei": [0, 10, 140, 205, 247, 289], "vin7": [0, 10, 140, 205, 247, 289], "solibact": [0, 10, 140, 205, 247, 289], "usitatu": [0, 10, 140, 205, 247, 289], "ellin6076": [0, 10, 140, 205, 247, 289], "hamelinensi": [0, 10, 140, 205, 247, 289], "100a6": [0, 10, 140, 205, 247, 289], "truepera": [0, 10, 140, 205, 247, 289], "radiovictrix": [0, 10, 140, 205, 247, 289], "17093": [0, 10, 140, 205, 247, 289], "sibiricum": [0, 10, 140, 205, 247, 289], "hirsutella": [0, 10, 140, 205, 247, 289], "minnesotensi": [0, 10, 140, 205, 247, 289], "3608": [0, 10, 140, 205, 247, 289], "alkalihalobacillu": [0, 10, 140, 205, 247, 289], "okhensi": [0, 10, 140, 205, 247, 289], "tamura": [0, 10, 140, 205, 247, 289], "ignisphaera": [0, 10, 140, 205, 247, 289], "17230": [0, 10, 140, 205, 247, 289], "cbmb20": [0, 10, 140, 205, 247, 289], "13552": [0, 10, 140, 205, 247, 289], "thermovirga": [0, 10, 140, 205, 247, 289], "lienii": [0, 10, 140, 205, 247, 289], "17291": [0, 10, 140, 205, 247, 289], "sulcia": [0, 10, 140, 205, 247, 289], "pspu": [0, 10, 140, 205, 247, 289], "rhodonellum": [0, 10, 140, 205, 247, 289], "gcm71": [0, 10, 140, 205, 247, 289], "17998": [0, 10, 140, 205, 247, 289], "kitahara": [0, 10, 140, 205, 247, 289], "17330": [0, 10, 140, 205, 247, 289], "pyronema": [0, 10, 140, 205, 247, 289], "omphalod": [0, 10, 140, 205, 247, 289], "chlorochromatii": [0, 10, 140, 205, 247, 289], "cad3": [0, 10, 140, 205, 247, 289], "ktr9": [0, 10, 140, 205, 247, 289], "ezzemoulens": [0, 10, 140, 205, 247, 289], "17463": [0, 10, 140, 205, 247, 289], "pseudodonghicola": [0, 10, 140, 205, 247, 289], "18339": [0, 10, 140, 205, 247, 289], "17565": [0, 10, 140, 205, 247, 289], "scm1": [0, 10, 140, 205, 247, 289], "tasmaniensi": [0, 10, 140, 205, 247, 289], "et1": [0, 10, 140, 205, 247, 289], "cect": [0, 10, 140, 205, 247, 289], "3035": [0, 10, 140, 205, 247, 289], "youngia": [0, 10, 140, 205, 247, 289], "17734": [0, 10, 140, 205, 247, 289], "criblamydia": [0, 10, 140, 205, 247, 289], "sequanensi": [0, 10, 140, 205, 247, 289], "crib": [0, 10, 140, 205, 247, 289], "thiophilu": [0, 10, 140, 205, 247, 289], "17215": [0, 10, 140, 205, 247, 289], "tuberibacillu": [0, 10, 140, 205, 247, 289], "calidu": [0, 10, 140, 205, 247, 289], "17572": [0, 10, 140, 205, 247, 289], "spathaspora": [0, 10, 140, 205, 247, 289], "passalidarum": [0, 10, 140, 205, 247, 289], "27907": [0, 10, 140, 205, 247, 289], "amorphu": [0, 10, 140, 205, 247, 289], "coral": [0, 10, 140, 205, 247, 289], "19760": [0, 10, 140, 205, 247, 289], "frigidu": [0, 10, 140, 205, 247, 289], "17176": [0, 10, 140, 205, 247, 289], "ascodesmi": [0, 10, 140, 205, 247, 289], "nigrican": [0, 10, 140, 205, 247, 289], "stomati": [0, 10, 140, 205, 247, 289], "17678": [0, 10, 140, 205, 247, 289], "agrococcu": [0, 10, 140, 205, 247, 289], "lahaulensi": [0, 10, 140, 205, 247, 289], "17612": [0, 10, 140, 205, 247, 289], "methylophilacea": [0, 10, 140, 205, 247, 289], "oklahomensi": [0, 10, 140, 205, 247, 289], "onnurineu": [0, 10, 140, 205, 247, 289], "na1": [0, 10, 140, 205, 247, 289], "na2": [0, 10, 140, 205, 247, 289], "barengoltzii": [0, 10, 140, 205, 247, 289], "g22": [0, 10, 140, 205, 247, 289], "htcc2601": [0, 10, 140, 205, 247, 289], "19725": [0, 10, 140, 205, 247, 289], "744": [0, 10, 140, 205, 247, 289], "podicep": [0, 10, 140, 205, 247, 289], "pickeringii": [0, 10, 140, 205, 247, 289], "benzoatilytica": [0, 10, 140, 205, 247, 289], "gh1": [0, 10, 140, 205, 247, 289], "19836": [0, 10, 140, 205, 247, 289], "boevrei": [0, 10, 140, 205, 247, 289], "14165": [0, 10, 140, 205, 247, 289], "benevestitu": [0, 10, 140, 205, 247, 289], "16100": [0, 10, 140, 205, 247, 289], "896": [0, 10, 140, 205, 247, 289], "spathiphylli": [0, 10, 140, 205, 247, 289], "b39": [0, 10, 140, 205, 247, 289], "davaonensi": [0, 10, 140, 205, 247, 289], "4913": [0, 10, 140, 205, 247, 289], "xenobiotica": [0, 10, 140, 205, 247, 289], "th49": [0, 10, 140, 205, 247, 289], "favelukesii": [0, 10, 140, 205, 247, 289], "spironucleu": [0, 10, 140, 205, 247, 289], "desulfovirgula": [0, 10, 140, 205, 247, 289], "thermocuniculi": [0, 10, 140, 205, 247, 289], "16036": [0, 10, 140, 205, 247, 289], "zeina": [0, 10, 140, 205, 247, 289], "prwf": [0, 10, 140, 205, 247, 289], "micavibrio": [0, 10, 140, 205, 247, 289], "aeruginosavoru": [0, 10, 140, 205, 247, 289], "arl": [0, 10, 140, 205, 247, 289], "44953": [0, 10, 140, 205, 247, 289], "daejeonens": [0, 10, 140, 205, 247, 289], "17708": [0, 10, 140, 205, 247, 289], "suncheonens": [0, 10, 140, 205, 247, 289], "gh29": [0, 10, 140, 205, 247, 289], "17707": [0, 10, 140, 205, 247, 289], "azwk": [0, 10, 140, 205, 247, 289], "alkalilimnicola": [0, 10, 140, 205, 247, 289], "ehrlichii": [0, 10, 140, 205, 247, 289], "mlhe": [0, 10, 140, 205, 247, 289], "oscillibact": [0, 10, 140, 205, 247, 289], "valericigen": [0, 10, 140, 205, 247, 289], "sjm18": [0, 10, 140, 205, 247, 289], "cnt003": [0, 10, 140, 205, 247, 289], "uraniireducen": [0, 10, 140, 205, 247, 289], "rf4": [0, 10, 140, 205, 247, 289], "doucetia": [0, 10, 140, 205, 247, 289], "w3": [0, 10, 140, 205, 247, 289], "halostagnicola": [0, 10, 140, 205, 247, 289], "larsenii": [0, 10, 140, 205, 247, 289], "xh": [0, 10, 140, 205, 247, 289], "arenimona": [0, 10, 140, 205, 247, 289], "maltha": [0, 10, 140, 205, 247, 289], "cc": [0, 10, 140, 205, 247, 289], "jy": [0, 10, 140, 205, 247, 289], "niastella": [0, 10, 140, 205, 247, 289], "gr20": [0, 10, 140, 205, 247, 289], "tu6071": [0, 10, 140, 205, 247, 289], "limnoperna": [0, 10, 140, 205, 247, 289], "fortunei": [0, 10, 140, 205, 247, 289], "alloscardovia": [0, 10, 140, 205, 247, 289], "17774": [0, 10, 140, 205, 247, 289], "tsurumiens": [0, 10, 140, 205, 247, 289], "chokoriensi": [0, 10, 140, 205, 247, 289], "phocaeicola": [0, 10, 140, 205, 247, 289], "dorei": [0, 10, 140, 205, 247, 289], "parabrevi": [0, 10, 140, 205, 247, 289], "53295": [0, 10, 140, 205, 247, 289], "berteroa": [0, 10, 140, 205, 247, 289], "ingrahamii": [0, 10, 140, 205, 247, 289], "19969": [0, 10, 140, 205, 247, 289], "kks102": [0, 10, 140, 205, 247, 289], "methanoregula": [0, 10, 140, 205, 247, 289], "boonei": [0, 10, 140, 205, 247, 289], "6a8": [0, 10, 140, 205, 247, 289], "olindensi": [0, 10, 140, 205, 247, 289], "extremaustrali": [0, 10, 140, 205, 247, 289], "loihica": [0, 10, 140, 205, 247, 289], "smaragdicoccu": [0, 10, 140, 205, 247, 289], "44881": [0, 10, 140, 205, 247, 289], "103563": [0, 10, 140, 205, 247, 289], "methylotenera": [0, 10, 140, 205, 247, 289], "bryobact": [0, 10, 140, 205, 247, 289], "aggregatu": [0, 10, 140, 205, 247, 289], "mpl3": [0, 10, 140, 205, 247, 289], "zavarzinella": [0, 10, 140, 205, 247, 289], "19928": [0, 10, 140, 205, 247, 289], "schlesneria": [0, 10, 140, 205, 247, 289], "paludicola": [0, 10, 140, 205, 247, 289], "18645": [0, 10, 140, 205, 247, 289], "leeuwenhoekiella": [0, 10, 140, 205, 247, 289], "blandensi": [0, 10, 140, 205, 247, 289], "med217": [0, 10, 140, 205, 247, 289], "inulinivoran": [0, 10, 140, 205, 247, 289], "16841": [0, 10, 140, 205, 247, 289], "at1b": [0, 10, 140, 205, 247, 289], "rubritalea": [0, 10, 140, 205, 247, 289], "17716": [0, 10, 140, 205, 247, 289], "tieghemostelium": [0, 10, 140, 205, 247, 289], "lacteum": [0, 10, 140, 205, 247, 289], "pseudoporcinu": [0, 10, 140, 205, 247, 289], "spin": [0, 10, 140, 205, 247, 289], "20026": [0, 10, 140, 205, 247, 289], "phenanthrenivoran": [0, 10, 140, 205, 247, 289], "sphe3": [0, 10, 140, 205, 247, 289], "reichenbachii": [0, 10, 140, 205, 247, 289], "protochlamydia": [0, 10, 140, 205, 247, 289], "amoebophila": [0, 10, 140, 205, 247, 289], "uwe25": [0, 10, 140, 205, 247, 289], "kaistia": [0, 10, 140, 205, 247, 289], "23481": [0, 10, 140, 205, 247, 289], "stercorea": [0, 10, 140, 205, 247, 289], "18206": [0, 10, 140, 205, 247, 289], "ktedonobact": [0, 10, 140, 205, 247, 289], "racemif": [0, 10, 140, 205, 247, 289], "44963": [0, 10, 140, 205, 247, 289], "ginsengisoli": [0, 10, 140, 205, 247, 289], "la": [0, 10, 140, 205, 247, 289], "hoylei": [0, 10, 140, 205, 247, 289], "pva": [0, 10, 140, 205, 247, 289], "verminephrobact": [0, 10, 140, 205, 247, 289], "eisenia": [0, 10, 140, 205, 247, 289], "ef01": [0, 10, 140, 205, 247, 289], "granulibact": [0, 10, 140, 205, 247, 289], "bethesdensi": [0, 10, 140, 205, 247, 289], "cgdnih1": [0, 10, 140, 205, 247, 289], "endocarpon": [0, 10, 140, 205, 247, 289], "pusillum": [0, 10, 140, 205, 247, 289], "z07020": [0, 10, 140, 205, 247, 289], "futtsuensi": [0, 10, 140, 205, 247, 289], "18154": [0, 10, 140, 205, 247, 289], "17710": [0, 10, 140, 205, 247, 289], "pelosinu": [0, 10, 140, 205, 247, 289], "17108": [0, 10, 140, 205, 247, 289], "discaria": [0, 10, 140, 205, 247, 289], "belnapia": [0, 10, 140, 205, 247, 289], "moabensi": [0, 10, 140, 205, 247, 289], "16746": [0, 10, 140, 205, 247, 289], "sabina": [0, 10, 140, 205, 247, 289], "t27": [0, 10, 140, 205, 247, 289], "ruania": [0, 10, 140, 205, 247, 289], "albidiflava": [0, 10, 140, 205, 247, 289], "18029": [0, 10, 140, 205, 247, 289], "k31": [0, 10, 140, 205, 247, 289], "haladaptatu": [0, 10, 140, 205, 247, 289], "paucihalophilu": [0, 10, 140, 205, 247, 289], "dx253": [0, 10, 140, 205, 247, 289], "simili": [0, 10, 140, 205, 247, 289], "phycicoccu": [0, 10, 140, 205, 247, 289], "rhodobacteral": [0, 10, 140, 205, 247, 289], "htcc2255": [0, 10, 140, 205, 247, 289], "periplaneta": [0, 10, 140, 205, 247, 289], "bplan": [0, 10, 140, 205, 247, 289], "tarazona": [0, 10, 140, 205, 247, 289], "perlucida": [0, 10, 140, 205, 247, 289], "18276": [0, 10, 140, 205, 247, 289], "terrigena": [0, 10, 140, 205, 247, 289], "21567": [0, 10, 140, 205, 247, 289], "mesonia": [0, 10, 140, 205, 247, 289], "19841": [0, 10, 140, 205, 247, 289], "13563": [0, 10, 140, 205, 247, 289], "gallionella": [0, 10, 140, 205, 247, 289], "capsiferriforman": [0, 10, 140, 205, 247, 289], "composti": [0, 10, 140, 205, 247, 289], "tr7": [0, 10, 140, 205, 247, 289], "09": [0, 6, 10, 140, 205, 247, 289], "18010": [0, 10, 140, 205, 247, 289], "filum": [0, 10, 140, 205, 247, 289], "17961": [0, 10, 140, 205, 247, 289], "aveniformi": [0, 10, 140, 205, 247, 289], "17977": [0, 10, 140, 205, 247, 289], "typographi": [0, 10, 140, 205, 247, 289], "xylanisolven": [0, 10, 140, 205, 247, 289], "xb1a": [0, 10, 140, 205, 247, 289], "sw2": [0, 10, 140, 205, 247, 289], "7521": [0, 10, 140, 205, 247, 289], "tamia": [0, 10, 140, 205, 247, 289], "th239": [0, 10, 140, 205, 247, 289], "rivularia": [0, 10, 140, 205, 247, 289], "7116": [0, 10, 140, 205, 247, 289], "cuniculorum": [0, 10, 140, 205, 247, 289], "23162": [0, 10, 140, 205, 247, 289], "24588": [0, 10, 140, 205, 247, 289], "reinekea": [0, 10, 140, 205, 247, 289], "med297": [0, 10, 140, 205, 247, 289], "marseil": [0, 10, 140, 205, 247, 289], "nanhaiensi": [0, 10, 140, 205, 247, 289], "18065": [0, 10, 140, 205, 247, 289], "natranaerobiu": [0, 10, 140, 205, 247, 289], "wn": [0, 10, 140, 205, 247, 289], "lf": [0, 10, 140, 205, 247, 289], "haloplanu": [0, 10, 140, 205, 247, 289], "17983": [0, 10, 140, 205, 247, 289], "shandongensi": [0, 10, 140, 205, 247, 289], "45094": [0, 10, 140, 205, 247, 289], "olivibact": [0, 10, 140, 205, 247, 289], "sitiensi": [0, 10, 140, 205, 247, 289], "17696": [0, 10, 140, 205, 247, 289], "zhouia": [0, 10, 140, 205, 247, 289], "ad3": [0, 10, 140, 205, 247, 289], "barnesia": [0, 10, 140, 205, 247, 289], "18169": [0, 10, 140, 205, 247, 289], "13652": [0, 10, 140, 205, 247, 289], "salanitroni": [0, 10, 140, 205, 247, 289], "18170": [0, 10, 140, 205, 247, 289], "thermobacillu": [0, 10, 140, 205, 247, 289], "kwc4": [0, 10, 140, 205, 247, 289], "methyloversatili": [0, 10, 140, 205, 247, 289], "universali": [0, 10, 140, 205, 247, 289], "fam5": [0, 10, 140, 205, 247, 289], "19370": [0, 10, 140, 205, 247, 289], "aponinum": [0, 10, 140, 205, 247, 289], "10605": [0, 10, 140, 205, 247, 289], "bingchenggensi": [0, 10, 140, 205, 247, 289], "bcw": [0, 10, 140, 205, 247, 289], "sinaloensi": [0, 10, 140, 205, 247, 289], "21326": [0, 10, 140, 205, 247, 289], "aciduliprofundum": [0, 10, 140, 205, 247, 289], "t469": [0, 10, 140, 205, 247, 289], "21315": [0, 10, 140, 205, 247, 289], "niabella": [0, 10, 140, 205, 247, 289], "17617": [0, 10, 140, 205, 247, 289], "protegen": [0, 10, 140, 205, 247, 289], "cha0": [0, 10, 140, 205, 247, 289], "cohnella": [0, 10, 140, 205, 247, 289], "laeviribosi": [0, 10, 140, 205, 247, 289], "21336": [0, 10, 140, 205, 247, 289], "namurensi": [0, 10, 140, 205, 247, 289], "chizuka": [0, 10, 140, 205, 247, 289], "707": [0, 10, 140, 205, 247, 289], "05": [0, 6, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 140, 143, 205, 247, 289, 292], "hydrogenobaculum": [0, 10, 140, 205, 247, 289], "y04aas1": [0, 10, 140, 205, 247, 289], "thermotoleran": [0, 10, 140, 205, 247, 289], "csc17ta": [0, 10, 140, 205, 247, 289], "algiphilu": [0, 10, 140, 205, 247, 289], "dg1253": [0, 10, 140, 205, 247, 289], "verrucomicrobia": [0, 10, 140, 205, 247, 289], "dg1235": [0, 10, 140, 205, 247, 289], "jl475": [0, 10, 140, 205, 247, 289], "ornithinimicrobium": [0, 10, 140, 205, 247, 289], "pekingens": [0, 10, 140, 205, 247, 289], "21552": [0, 10, 140, 205, 247, 289], "aidingensi": [0, 10, 140, 205, 247, 289], "18341": [0, 10, 140, 205, 247, 289], "cycloclasticu": [0, 10, 140, 205, 247, 289], "p1": [0, 10, 140, 205, 247, 289], "pseudophaeobact": [0, 10, 140, 205, 247, 289], "23566": [0, 10, 140, 205, 247, 289], "thermophagu": [0, 10, 140, 205, 247, 289], "ferraria": [0, 10, 140, 205, 247, 289], "106233": [0, 10, 140, 205, 247, 289], "timonensi": [0, 10, 140, 205, 247, 289], "4401737": [0, 10, 140, 205, 247, 289], "22865": [0, 10, 140, 205, 247, 289], "15640": [0, 10, 140, 205, 247, 289], "methanobacterium": [0, 10, 140, 205, 247, 289], "arcticum": [0, 10, 140, 205, 247, 289], "ruthia": [0, 10, 140, 205, 247, 289], "magnifica": [0, 10, 140, 205, 247, 289], "calyptogena": [0, 10, 140, 205, 247, 289], "coprophilu": [0, 10, 140, 205, 247, 289], "18228": [0, 10, 140, 205, 247, 289], "13818": [0, 10, 140, 205, 247, 289], "nitratiruptor": [0, 10, 140, 205, 247, 289], "sb155": [0, 10, 140, 205, 247, 289], "nbc37": [0, 10, 140, 205, 247, 289], "halovivax": [0, 10, 140, 205, 247, 289], "halopig": [0, 10, 140, 205, 247, 289], "xanaduensi": [0, 10, 140, 205, 247, 289], "cl02t12c29": [0, 10, 140, 205, 247, 289], "amp6": [0, 10, 140, 205, 247, 289], "sulfidifacien": [0, 10, 140, 205, 247, 289], "14089": [0, 10, 140, 205, 247, 289], "htcc2150": [0, 10, 140, 205, 247, 289], "machipongonensi": [0, 10, 140, 205, 247, 289], "aust": [0, 10, 140, 205, 247, 289], "nh1": [0, 10, 140, 205, 247, 289], "sk209": [0, 10, 140, 205, 247, 289], "hydnomeruliu": [0, 10, 140, 205, 247, 289], "pinastri": [0, 10, 140, 205, 247, 289], "312": [0, 10, 140, 205, 247, 289], "chlorohalonata": [0, 10, 140, 205, 247, 289], "40285": [0, 10, 140, 205, 247, 289], "wenxinia": [0, 10, 140, 205, 247, 289], "24838": [0, 10, 140, 205, 247, 289], "farragini": [0, 10, 140, 205, 247, 289], "18382": [0, 10, 140, 205, 247, 289], "14108": [0, 10, 140, 205, 247, 289], "parafarragini": [0, 10, 140, 205, 247, 289], "f0439": [0, 10, 140, 205, 247, 289], "17526": [0, 10, 140, 205, 247, 289], "actinocatenispora": [0, 10, 140, 205, 247, 289], "sera": [0, 10, 140, 205, 247, 289], "hf": [0, 10, 140, 205, 247, 289], "gai101": [0, 10, 140, 205, 247, 289], "ccs2": [0, 10, 140, 205, 247, 289], "bal39": [0, 10, 140, 205, 247, 289], "bal38": [0, 10, 140, 205, 247, 289], "bal3": [0, 10, 140, 205, 247, 289], "ska14": [0, 10, 140, 205, 247, 289], "flavobacterial": [0, 10, 140, 205, 247, 289], "alc": [0, 10, 140, 205, 247, 289], "tm1035": [0, 10, 140, 205, 247, 289], "immib": [0, 10, 140, 205, 247, 289], "apb": [0, 10, 140, 205, 247, 289], "18482": [0, 10, 140, 205, 247, 289], "macrosporangiidu": [0, 10, 140, 205, 247, 289], "cpp55": [0, 10, 140, 205, 247, 289], "contaminan": [0, 10, 140, 205, 247, 289], "17975": [0, 10, 140, 205, 247, 289], "nodosa": [0, 10, 140, 205, 247, 289], "21604": [0, 10, 140, 205, 247, 289], "jaspsi": [0, 10, 140, 205, 247, 289], "18422": [0, 10, 140, 205, 247, 289], "misasensi": [0, 10, 140, 205, 247, 289], "22328": [0, 10, 140, 205, 247, 289], "thiooxydan": [0, 10, 140, 205, 247, 289], "dms010": [0, 10, 140, 205, 247, 289], "perlucidibaca": [0, 10, 140, 205, 247, 289], "piscina": [0, 10, 140, 205, 247, 289], "21586": [0, 10, 140, 205, 247, 289], "terriglobu": [0, 10, 140, 205, 247, 289], "18391": [0, 10, 140, 205, 247, 289], "uliginosibacterium": [0, 10, 140, 205, 247, 289], "gangwonens": [0, 10, 140, 205, 247, 289], "18521": [0, 10, 140, 205, 247, 289], "halalkalibacillu": [0, 10, 140, 205, 247, 289], "18494": [0, 10, 140, 205, 247, 289], "mesoflavibact": [0, 10, 140, 205, 247, 289], "s86": [0, 10, 140, 205, 247, 289], "19029": [0, 10, 140, 205, 247, 289], "pestalotiopsi": [0, 10, 140, 205, 247, 289], "fici": [0, 10, 140, 205, 247, 289], "congregibact": [0, 10, 140, 205, 247, 289], "kt71": [0, 10, 140, 205, 247, 289], "crevioricani": [0, 10, 140, 205, 247, 289], "bhargavaea": [0, 10, 140, 205, 247, 289], "cecembensi": [0, 10, 140, 205, 247, 289], "dse10": [0, 10, 140, 205, 247, 289], "cylindrobasidium": [0, 10, 140, 205, 247, 289], "torrendii": [0, 10, 140, 205, 247, 289], "fp15055": [0, 10, 140, 205, 247, 289], "22408": [0, 10, 140, 205, 247, 289], "coraliomargarita": [0, 10, 140, 205, 247, 289], "akajimensi": [0, 10, 140, 205, 247, 289], "45221": [0, 10, 140, 205, 247, 289], "rochalima": [0, 10, 140, 205, 247, 289], "1498": [0, 10, 140, 205, 247, 289], "cyanothec": [0, 10, 140, 205, 247, 289], "7425": [0, 10, 140, 205, 247, 289], "gilvimarinu": [0, 10, 140, 205, 247, 289], "19667": [0, 10, 140, 205, 247, 289], "phenoliresisten": [0, 10, 140, 205, 247, 289], "135680": [0, 10, 140, 205, 247, 289], "brisouii": [0, 10, 140, 205, 247, 289], "4119": [0, 10, 140, 205, 247, 289], "aestuariimicrobium": [0, 10, 140, 205, 247, 289], "kwangyangens": [0, 10, 140, 205, 247, 289], "21549": [0, 10, 140, 205, 247, 289], "k90mix": [0, 10, 140, 205, 247, 289], "hayakitensi": [0, 10, 140, 205, 247, 289], "18933": [0, 10, 140, 205, 247, 289], "14209": [0, 10, 140, 205, 247, 289], "andreprevotia": [0, 10, 140, 205, 247, 289], "chitinilytica": [0, 10, 140, 205, 247, 289], "18519": [0, 10, 140, 205, 247, 289], "sanxanigenen": [0, 10, 140, 205, 247, 289], "19645": [0, 10, 140, 205, 247, 289], "nx02": [0, 10, 140, 205, 247, 289], "marmoricola": [0, 10, 140, 205, 247, 289], "aequoreu": [0, 10, 140, 205, 247, 289], "lachnospiracea": [0, 10, 140, 205, 247, 289], "barnesiella": [0, 10, 140, 205, 247, 289], "viscericola": [0, 10, 140, 205, 247, 289], "18177": [0, 10, 140, 205, 247, 289], "segetibact": [0, 10, 140, 205, 247, 289], "18137": [0, 10, 140, 205, 247, 289], "proteiniclasticum": [0, 10, 140, 205, 247, 289], "24773": [0, 10, 140, 205, 247, 289], "agrilactobacillu": [0, 10, 140, 205, 247, 289], "18527": [0, 10, 140, 205, 247, 289], "14202": [0, 10, 140, 205, 247, 289], "gamsii": [0, 10, 140, 205, 247, 289], "zunongwangia": [0, 10, 140, 205, 247, 289], "profunda": [0, 10, 140, 205, 247, 289], "sm": [0, 10, 140, 205, 247, 289], "a87": [0, 10, 140, 205, 247, 289], "desulfocurvu": [0, 10, 140, 205, 247, 289], "vexinensi": [0, 10, 140, 205, 247, 289], "17965": [0, 10, 140, 205, 247, 289], "x514": [0, 10, 140, 205, 247, 289], "638": [0, 10, 140, 205, 247, 289], "merioni": [0, 10, 140, 205, 247, 289], "19192": [0, 10, 140, 205, 247, 289], "pontibact": [0, 10, 140, 205, 247, 289], "korlensi": [0, 10, 140, 205, 247, 289], "mwyl1": [0, 10, 140, 205, 247, 289], "amphimedon": [0, 10, 140, 205, 247, 289], "queenslandica": [0, 10, 140, 205, 247, 289], "wohlfahrtiimona": [0, 10, 140, 205, 247, 289], "chitiniclastica": [0, 10, 140, 205, 247, 289], "18708": [0, 10, 140, 205, 247, 289], "ureicelerivoran": [0, 10, 140, 205, 247, 289], "aureimona": [0, 10, 140, 205, 247, 289], "ureilytica": [0, 10, 140, 205, 247, 289], "18598": [0, 10, 140, 205, 247, 289], "106430": [0, 10, 140, 205, 247, 289], "riesia": [0, 10, 140, 205, 247, 289], "pediculicola": [0, 10, 140, 205, 247, 289], "actinomycetospora": [0, 10, 140, 205, 247, 289], "chiangmaiensi": [0, 10, 140, 205, 247, 289], "45062": [0, 10, 140, 205, 247, 289], "mucosum": [0, 10, 140, 205, 247, 289], "1512": [0, 10, 140, 205, 247, 289], "pm2": [0, 10, 140, 205, 247, 289], "sk37": [0, 10, 140, 205, 247, 289], "piezotoleran": [0, 10, 140, 205, 247, 289], "wp3": [0, 10, 140, 205, 247, 289], "maritimibact": [0, 10, 140, 205, 247, 289], "htcc2654": [0, 10, 140, 205, 247, 289], "nonomuraea": [0, 10, 140, 205, 247, 289], "coxensi": [0, 10, 140, 205, 247, 289], "45129": [0, 10, 140, 205, 247, 289], "fw109": [0, 10, 140, 205, 247, 289], "23545": [0, 10, 140, 205, 247, 289], "geminicoccu": [0, 10, 140, 205, 247, 289], "18922": [0, 10, 140, 205, 247, 289], "tc": [0, 10, 140, 205, 247, 289], "daeponensi": [0, 10, 140, 205, 247, 289], "23529": [0, 10, 140, 205, 247, 289], "m3": [0, 10, 140, 205, 247, 289], "j7": [0, 10, 140, 205, 247, 289], "astaxanthinifacien": [0, 10, 140, 205, 247, 289], "22298": [0, 10, 140, 205, 247, 289], "stegodyphu": [0, 10, 140, 205, 247, 289], "pleuritidi": [0, 10, 140, 205, 247, 289], "14110": [0, 10, 140, 205, 247, 289], "coahuilensi": [0, 10, 140, 205, 247, 289], "m4": [0, 10, 140, 205, 247, 289], "nocardioidacea": [0, 10, 140, 205, 247, 289], "broad": [0, 10, 140, 205, 247, 289], "clostridiisalibact": [0, 10, 140, 205, 247, 289], "22131": [0, 10, 140, 205, 247, 289], "pedi": [0, 10, 140, 205, 247, 289], "blastobotri": [0, 10, 140, 205, 247, 289], "adeninivoran": [0, 10, 140, 205, 247, 289], "27758": [0, 10, 140, 205, 247, 289], "malaqua": [0, 10, 140, 205, 247, 289], "108250": [0, 10, 140, 205, 247, 289], "forsetii": [0, 10, 140, 205, 247, 289], "kt0803": [0, 10, 140, 205, 247, 289], "14848": [0, 10, 140, 205, 247, 289], "ss2": [0, 10, 140, 205, 247, 289], "m62": [0, 10, 140, 205, 247, 289], "daeguens": [0, 10, 140, 205, 247, 289], "19388": [0, 10, 140, 205, 247, 289], "nuttal": [0, 10, 140, 205, 247, 289], "p19": [0, 10, 140, 205, 247, 289], "trp": [0, 10, 140, 205, 247, 289], "24470": [0, 10, 140, 205, 247, 289], "hydrothermal": [0, 10, 140, 205, 247, 289], "lam5": [0, 10, 140, 205, 247, 289], "18033": [0, 10, 140, 205, 247, 289], "mycetohabitan": [0, 10, 140, 205, 247, 289], "rhizoxinica": [0, 10, 140, 205, 247, 289], "hki": [0, 10, 140, 205, 247, 289], "454": [0, 10, 140, 205, 247, 289], "vesicomyosociu": [0, 10, 140, 205, 247, 289], "okutanii": [0, 10, 140, 205, 247, 289], "21787": [0, 10, 140, 205, 247, 289], "z3032": [0, 10, 140, 205, 247, 289], "halalkalicoccu": [0, 10, 140, 205, 247, 289], "jeotgali": [0, 10, 140, 205, 247, 289], "b3": [0, 10, 140, 205, 247, 289], "halophilum": [0, 10, 140, 205, 247, 289], "kronotskyensi": [0, 10, 140, 205, 247, 289], "2002": [0, 10, 140, 205, 247, 289], "58": [0, 10, 140, 169, 205, 247, 289], "donghaensi": [0, 10, 140, 205, 247, 289], "mpa1u2": [0, 10, 140, 205, 247, 289], "spadix": [0, 10, 140, 205, 247, 289], "bd": [0, 10, 140, 205, 247, 289], "a59": [0, 10, 140, 205, 247, 289], "18980": [0, 10, 140, 205, 247, 289], "nodosilinea": [0, 10, 140, 205, 247, 289], "nodulosa": [0, 10, 140, 205, 247, 289], "7104": [0, 10, 140, 205, 247, 289], "lcs2": [0, 10, 140, 205, 247, 289], "moolapensi": [0, 10, 140, 205, 247, 289], "kj006": [0, 10, 140, 205, 247, 289], "23594": [0, 10, 140, 205, 247, 289], "notospermu": [0, 10, 140, 205, 247, 289], "geniculatu": [0, 10, 140, 205, 247, 289], "neptunomona": [0, 10, 140, 205, 247, 289], "18939": [0, 10, 140, 205, 247, 289], "horonobensi": [0, 10, 140, 205, 247, 289], "15518": [0, 10, 140, 205, 247, 289], "wexlera": [0, 10, 140, 205, 247, 289], "19850": [0, 10, 140, 205, 247, 289], "salinicoccu": [0, 10, 140, 205, 247, 289], "19776": [0, 10, 140, 205, 247, 289], "19509": [0, 10, 140, 205, 247, 289], "cri": [0, 10, 140, 205, 247, 289], "21a": [0, 10, 140, 205, 247, 289], "omnicolen": [0, 10, 140, 205, 247, 289], "21503": [0, 10, 140, 205, 247, 289], "53443": [0, 10, 140, 205, 247, 289], "equicursori": [0, 10, 140, 205, 247, 289], "19284": [0, 10, 140, 205, 247, 289], "110162": [0, 10, 140, 205, 247, 289], "seriata": [0, 10, 140, 205, 247, 289], "methanolobu": [0, 10, 140, 205, 247, 289], "r15": [0, 10, 140, 205, 247, 289], "bryophila": [0, 10, 140, 205, 247, 289], "376mfsha3": [0, 10, 140, 205, 247, 289], "ummariens": [0, 10, 140, 205, 247, 289], "rl": [0, 10, 140, 205, 247, 289], "donghicola": [0, 10, 140, 205, 247, 289], "14565": [0, 10, 140, 205, 247, 289], "oranimens": [0, 10, 140, 205, 247, 289], "halpernia": [0, 10, 140, 205, 247, 289], "luteum": [0, 10, 140, 205, 247, 289], "stenoxybact": [0, 10, 140, 205, 247, 289], "19021": [0, 10, 140, 205, 247, 289], "mucilaginibact": [0, 10, 140, 205, 247, 289], "paludi": [0, 10, 140, 205, 247, 289], "18603": [0, 10, 140, 205, 247, 289], "basidiobolu": [0, 10, 140, 205, 247, 289], "meristosporu": [0, 10, 140, 205, 247, 289], "931": [0, 10, 140, 205, 247, 289], "elusimicrobium": [0, 10, 140, 205, 247, 289], "pei191": [0, 10, 140, 205, 247, 289], "irbg74": [0, 10, 140, 205, 247, 289], "arsenitoxydan": [0, 10, 140, 205, 247, 289], "46": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "subsaxonicum": [0, 10, 140, 205, 247, 289], "wb": [0, 10, 140, 205, 247, 289], "42": [0, 10, 140, 205, 247, 289], "21790": [0, 10, 140, 205, 247, 289], "vanfongensi": [0, 10, 140, 205, 247, 289], "17529": [0, 10, 140, 205, 247, 289], "rhamnosiphila": [0, 10, 140, 205, 247, 289], "chagannorensi": [0, 10, 140, 205, 247, 289], "18086": [0, 10, 140, 205, 247, 289], "salsuginibacillu": [0, 10, 140, 205, 247, 289], "kocurii": [0, 10, 140, 205, 247, 289], "18087": [0, 10, 140, 205, 247, 289], "humibact": [0, 10, 140, 205, 247, 289], "18994": [0, 10, 140, 205, 247, 289], "desulfurivibrio": [0, 10, 140, 205, 247, 289], "aht": [0, 10, 140, 205, 247, 289], "dethiobact": [0, 10, 140, 205, 247, 289], "dasanensi": [0, 10, 140, 205, 247, 289], "arb": [0, 10, 140, 205, 247, 289], "0140": [0, 10, 140, 205, 247, 289], "pediculischaeffi": [0, 10, 140, 205, 247, 289], "ptsu": [0, 10, 140, 205, 247, 289], "jonquetella": [0, 10, 140, 205, 247, 289], "e3_33": [0, 10, 140, 205, 247, 289], "e1": [0, 10, 140, 205, 247, 289], "dactylellina": [0, 10, 140, 205, 247, 289], "haptotyla": [0, 10, 140, 205, 247, 289], "tiamatea": [0, 10, 140, 205, 247, 289], "sarl4b": [0, 10, 140, 205, 247, 289], "baudoinia": [0, 10, 140, 205, 247, 289], "compniacensi": [0, 10, 140, 205, 247, 289], "19990": [0, 10, 140, 205, 247, 289], "spitsbergens": [0, 10, 140, 205, 247, 289], "19989": [0, 10, 140, 205, 247, 289], "ginsengihumi": [0, 10, 140, 205, 247, 289], "21568": [0, 10, 140, 205, 247, 289], "kazachstania": [0, 10, 140, 205, 247, 289], "2517": [0, 10, 140, 205, 247, 289], "peraridilitori": [0, 10, 140, 205, 247, 289], "19664": [0, 10, 140, 205, 247, 289], "19273": [0, 10, 140, 205, 247, 289], "c150": [0, 10, 140, 205, 247, 289], "fibularhizoctonia": [0, 10, 140, 205, 247, 289], "109695": [0, 10, 140, 205, 247, 289], "yo3aop1": [0, 10, 140, 205, 247, 289], "jeojiens": [0, 10, 140, 205, 247, 289], "robiginitomaculum": [0, 10, 140, 205, 247, 289], "21748": [0, 10, 140, 205, 247, 289], "uk1": [0, 10, 140, 205, 247, 289], "f23": [0, 10, 140, 205, 247, 289], "f96": [0, 10, 140, 205, 247, 289], "uk40": [0, 10, 140, 205, 247, 289], "f8": [0, 10, 140, 205, 247, 289], "f5": [0, 10, 140, 205, 247, 289], "funiformi": [0, 10, 140, 205, 247, 289], "yit": [0, 10, 140, 205, 247, 289], "11815": [0, 10, 140, 205, 247, 289], "parvirubra": [0, 10, 140, 205, 247, 289], "11816": [0, 10, 140, 205, 247, 289], "gauvreauii": [0, 10, 140, 205, 247, 289], "19829": [0, 10, 140, 205, 247, 289], "henryi": [0, 10, 140, 205, 247, 289], "19005": [0, 10, 140, 205, 247, 289], "cabal": [0, 10, 140, 205, 247, 289], "19004": [0, 10, 140, 205, 247, 289], "htcc7211": [0, 10, 140, 205, 247, 289], "pseudovibrio": [0, 10, 140, 205, 247, 289], "je062": [0, 10, 140, 205, 247, 289], "y4i": [0, 10, 140, 205, 247, 289], "r11": [0, 10, 140, 205, 247, 289], "maculosa": [0, 10, 140, 205, 247, 289], "19339": [0, 10, 140, 205, 247, 289], "15638": [0, 10, 140, 205, 247, 289], "promicromonospora": [0, 10, 140, 205, 247, 289], "19349": [0, 10, 140, 205, 247, 289], "chol1": [0, 10, 140, 205, 247, 289], "timonens": [0, 10, 140, 205, 247, 289], "5401744": [0, 10, 140, 205, 247, 289], "45435": [0, 10, 140, 205, 247, 289], "hofstenia": [0, 10, 140, 205, 247, 289], "miamia": [0, 10, 140, 205, 247, 289], "aerolata": [0, 10, 140, 205, 247, 289], "18566": [0, 10, 140, 205, 247, 289], "m18": [0, 10, 140, 205, 247, 289], "m21": [0, 10, 140, 205, 247, 289], "cp5": [0, 10, 140, 205, 247, 289], "microti": [0, 10, 140, 205, 247, 289], "ccm": [0, 10, 140, 205, 247, 289], "4915": [0, 10, 140, 205, 247, 289], "vinea": [0, 10, 140, 205, 247, 289], "21990": [0, 10, 140, 205, 247, 289], "sl153": [0, 10, 140, 205, 247, 289], "18668": [0, 10, 140, 205, 247, 289], "gryllotalpicola": [0, 10, 140, 205, 247, 289], "22003": [0, 10, 140, 205, 247, 289], "ossibalaena": [0, 10, 140, 205, 247, 289], "1528": [0, 10, 140, 205, 247, 289], "reyranella": [0, 10, 140, 205, 247, 289], "adlercreutzia": [0, 10, 140, 205, 247, 289], "equolifacien": [0, 10, 140, 205, 247, 289], "19450": [0, 10, 140, 205, 247, 289], "eudoraea": [0, 10, 140, 205, 247, 289], "adriatica": [0, 10, 140, 205, 247, 289], "19308": [0, 10, 140, 205, 247, 289], "19437": [0, 10, 140, 205, 247, 289], "gansuensi": [0, 10, 140, 205, 247, 289], "simiduia": [0, 10, 140, 205, 247, 289], "sa1": [0, 10, 140, 205, 247, 289], "21679": [0, 10, 140, 205, 247, 289], "selenitireducen": [0, 10, 140, 205, 247, 289], "1503": [0, 10, 140, 205, 247, 289], "profundi": [0, 10, 140, 205, 247, 289], "5_u_42afaa": [0, 10, 140, 205, 247, 289], "6_1_27": [0, 10, 140, 205, 247, 289], "rudanella": [0, 10, 140, 205, 247, 289], "19387": [0, 10, 140, 205, 247, 289], "luticocti": [0, 10, 140, 205, 247, 289], "19459": [0, 10, 140, 205, 247, 289], "scopuliridi": [0, 10, 140, 205, 247, 289], "rb72": [0, 10, 140, 205, 247, 289], "pseudoclavibact": [0, 10, 140, 205, 247, 289], "23366": [0, 10, 140, 205, 247, 289], "amphritea": [0, 10, 140, 205, 247, 289], "1530": [0, 10, 140, 205, 247, 289], "aerilata": [0, 10, 140, 205, 247, 289], "19363": [0, 10, 140, 205, 247, 289], "desulfarculu": [0, 10, 140, 205, 247, 289], "baarsii": [0, 10, 140, 205, 247, 289], "2075": [0, 10, 140, 205, 247, 289], "pini": [0, 10, 140, 205, 247, 289], "10737": [0, 10, 140, 205, 247, 289], "exovoru": [0, 10, 140, 205, 247, 289], "jss": [0, 10, 140, 205, 247, 289], "d43": [0, 10, 140, 205, 247, 289], "henriciella": [0, 10, 140, 205, 247, 289], "19595": [0, 10, 140, 205, 247, 289], "joostella": [0, 10, 140, 205, 247, 289], "19592": [0, 10, 140, 205, 247, 289], "23508": [0, 10, 140, 205, 247, 289], "paraprevotella": [0, 10, 140, 205, 247, 289], "clara": [0, 10, 140, 205, 247, 289], "11840": [0, 10, 140, 205, 247, 289], "xylaniphila": [0, 10, 140, 205, 247, 289], "11841": [0, 10, 140, 205, 247, 289], "kiloniella": [0, 10, 140, 205, 247, 289], "laminaria": [0, 10, 140, 205, 247, 289], "19542": [0, 10, 140, 205, 247, 289], "chthonomona": [0, 10, 140, 205, 247, 289], "calidirosea": [0, 10, 140, 205, 247, 289], "t49": [0, 10, 140, 205, 247, 289], "gracilimona": [0, 10, 140, 205, 247, 289], "19535": [0, 10, 140, 205, 247, 289], "spongiibact": [0, 10, 140, 205, 247, 289], "19543": [0, 10, 140, 205, 247, 289], "htcc2999": [0, 10, 140, 205, 247, 289], "gregarium": [0, 10, 140, 205, 247, 289], "bizionia": [0, 10, 140, 205, 247, 289], "argentinensi": [0, 10, 140, 205, 247, 289], "jub59": [0, 10, 140, 205, 247, 289], "saccharibacillu": [0, 10, 140, 205, 247, 289], "19268": [0, 10, 140, 205, 247, 289], "cloacimona": [0, 10, 140, 205, 247, 289], "evri": [0, 10, 140, 205, 247, 289], "plurextorum": [0, 10, 140, 205, 247, 289], "22810": [0, 10, 140, 205, 247, 289], "rhizoctonia": [0, 10, 140, 205, 247, 289], "solani": [0, 10, 140, 205, 247, 289], "wac10335": [0, 10, 140, 205, 247, 289], "1_1_30": [0, 10, 140, 205, 247, 289], "3_1_23": [0, 10, 140, 205, 247, 289], "3_1_33faa": [0, 10, 140, 205, 247, 289], "3_2_5": [0, 10, 140, 205, 247, 289], "4_1_36": [0, 10, 140, 205, 247, 289], "4_3_47faa": [0, 10, 140, 205, 247, 289], "9_1_42faa": [0, 10, 140, 205, 247, 289], "7_2_43faa": [0, 10, 140, 205, 247, 289], "3_1_syn3": [0, 10, 140, 205, 247, 289], "1_1_43": [0, 10, 140, 205, 247, 289], "4_1_40b": [0, 10, 140, 205, 247, 289], "3_1_31": [0, 10, 140, 205, 247, 289], "m42": [0, 10, 140, 205, 247, 289], "5_1_39bfaa": [0, 10, 140, 205, 247, 289], "3_1_syn1": [0, 10, 140, 205, 247, 289], "3_1_44": [0, 10, 140, 205, 247, 289], "clostridial": [0, 10, 140, 205, 247, 289], "1_7_47faa": [0, 10, 140, 205, 247, 289], "erysipelotrichacea": [0, 10, 140, 205, 247, 289], "2_2_44a": [0, 10, 140, 205, 247, 289], "elioraea": [0, 10, 140, 205, 247, 289], "tepidiphila": [0, 10, 140, 205, 247, 289], "17972": [0, 10, 140, 205, 247, 289], "chloracidobacterium": [0, 10, 140, 205, 247, 289], "planomicrobium": [0, 10, 140, 205, 247, 289], "glaciei": [0, 10, 140, 205, 247, 289], "chr43": [0, 10, 140, 205, 247, 289], "kuerlensi": [0, 10, 140, 205, 247, 289], "22868": [0, 10, 140, 205, 247, 289], "catacumba": [0, 10, 140, 205, 247, 289], "19601": [0, 10, 140, 205, 247, 289], "gs115": [0, 10, 140, 205, 247, 289], "ogataea": [0, 10, 140, 205, 247, 289], "ncyc": [0, 10, 140, 205, 247, 289], "495": [0, 10, 140, 205, 247, 289], "leu1": [0, 10, 140, 205, 247, 289], "nodensi": [0, 10, 140, 205, 247, 289], "19682": [0, 10, 140, 205, 247, 289], "14932": [0, 10, 140, 205, 247, 289], "107160": [0, 10, 140, 205, 247, 289], "f0489": [0, 10, 140, 205, 247, 289], "oremlandii": [0, 10, 140, 205, 247, 289], "ohila": [0, 10, 140, 205, 247, 289], "xinjiang": [0, 10, 140, 205, 247, 289], "yanchengensi": [0, 10, 140, 205, 247, 289], "y32": [0, 10, 140, 205, 247, 289], "rubicundulu": [0, 10, 140, 205, 247, 289], "ve08": [0, 10, 140, 205, 247, 289], "2h10": [0, 10, 140, 205, 247, 289], "19857": [0, 10, 140, 205, 247, 289], "hemiselmi": [0, 10, 140, 205, 247, 289], "andersenii": [0, 10, 140, 205, 247, 289], "mg1": [0, 10, 140, 205, 247, 289], "spb074": [0, 10, 140, 205, 247, 289], "ver3": [0, 10, 140, 205, 247, 289], "singulisphaera": [0, 10, 140, 205, 247, 289], "18658": [0, 10, 140, 205, 247, 289], "ilumatobact": [0, 10, 140, 205, 247, 289], "coccineu": [0, 10, 140, 205, 247, 289], "ym16": [0, 10, 140, 205, 247, 289], "304": [0, 10, 140, 205, 247, 289], "lachnoanaerobaculum": [0, 10, 140, 205, 247, 289], "saburreum": [0, 10, 140, 205, 247, 289], "f0468": [0, 10, 140, 205, 247, 289], "klh11": [0, 10, 140, 205, 247, 289], "suecicum": [0, 10, 140, 205, 247, 289], "hhb10207": [0, 10, 140, 205, 247, 289], "1_1_14": [0, 10, 140, 205, 247, 289], "2_1_22": [0, 10, 140, 205, 247, 289], "2_1_33b": [0, 10, 140, 205, 247, 289], "2_2_4": [0, 10, 140, 205, 247, 289], "20_3": [0, 10, 140, 205, 247, 289], "3_1_19": [0, 10, 140, 205, 247, 289], "3_1_40a": [0, 10, 140, 205, 247, 289], "coprobacillu": [0, 10, 140, 205, 247, 289], "8_2_54bfaa": [0, 10, 140, 205, 247, 289], "2_1_36faa": [0, 10, 140, 205, 247, 289], "burkholderial": [0, 10, 140, 205, 247, 289], "1_1_47": [0, 10, 140, 205, 247, 289], "6_1_45": [0, 10, 140, 205, 247, 289], "histicola": [0, 10, 140, 205, 247, 289], "15637": [0, 10, 140, 205, 247, 289], "dnf00424": [0, 10, 140, 205, 247, 289], "yegresii": [0, 10, 140, 205, 247, 289], "c55": [0, 10, 140, 205, 247, 289], "salinimicrobium": [0, 10, 140, 205, 247, 289], "17865": [0, 10, 140, 205, 247, 289], "vagan": [0, 10, 140, 205, 247, 289], "c9": [0, 10, 140, 205, 247, 289], "gordonibact": [0, 10, 140, 205, 247, 289], "pamelaea": [0, 10, 140, 205, 247, 289], "wch70": [0, 10, 140, 205, 247, 289], "dasania": [0, 10, 140, 205, 247, 289], "21967": [0, 10, 140, 205, 247, 289], "bombi": [0, 10, 140, 205, 247, 289], "19703": [0, 10, 140, 205, 247, 289], "haloplasma": [0, 10, 140, 205, 247, 289], "contractil": [0, 10, 140, 205, 247, 289], "ssd": [0, 10, 140, 205, 247, 289], "17b": [0, 10, 140, 205, 247, 289], "desulforudi": [0, 10, 140, 205, 247, 289], "audaxvi": [0, 10, 140, 205, 247, 289], "mp104c": [0, 10, 140, 205, 247, 289], "basalti": [0, 10, 140, 205, 247, 289], "113": [0, 10, 140, 205, 247, 289], "gloeosporioid": [0, 10, 140, 205, 247, 289], "methanosphaerula": [0, 10, 140, 205, 247, 289], "9c": [0, 10, 140, 205, 247, 289], "19626": [0, 10, 140, 205, 247, 289], "pseudohaliea": [0, 10, 140, 205, 247, 289], "19751": [0, 10, 140, 205, 247, 289], "24565": [0, 10, 140, 205, 247, 289], "modestobact": [0, 10, 140, 205, 247, 289], "graminisolven": [0, 10, 140, 205, 247, 289], "19988": [0, 10, 140, 205, 247, 289], "15093": [0, 10, 140, 205, 247, 289], "aliiglaciecola": [0, 10, 140, 205, 247, 289], "e3": [0, 10, 140, 205, 247, 289], "calditerrivibrio": [0, 10, 140, 205, 247, 289], "19672": [0, 10, 140, 205, 247, 289], "lp2a": [0, 10, 140, 205, 247, 289], "haematomicrobium": [0, 10, 140, 205, 247, 289], "21259": [0, 10, 140, 205, 247, 289], "ravenspurgens": [0, 10, 140, 205, 247, 289], "5401308": [0, 10, 140, 205, 247, 289], "53855": [0, 10, 140, 205, 247, 289], "morbif": [0, 10, 140, 205, 247, 289], "g707": [0, 10, 140, 205, 247, 289], "commensalibact": [0, 10, 140, 205, 247, 289], "a911": [0, 10, 140, 205, 247, 289], "rattaustraliani": [0, 10, 140, 205, 247, 289], "nh4": [0, 10, 140, 205, 247, 289], "otakiensi": [0, 10, 140, 205, 247, 289], "19908": [0, 10, 140, 205, 247, 289], "15040": [0, 10, 140, 205, 247, 289], "kisonensi": [0, 10, 140, 205, 247, 289], "f0435": [0, 10, 140, 205, 247, 289], "y412mc10": [0, 10, 140, 205, 247, 289], "galeopteru": [0, 10, 140, 205, 247, 289], "nigro": [0, 10, 140, 205, 247, 289], "fabifermentan": [0, 10, 140, 205, 247, 289], "t30pcm01": [0, 10, 140, 205, 247, 289], "cystoisospora": [0, 10, 140, 205, 247, 289], "geoalkalibact": [0, 10, 140, 205, 247, 289], "riograndensi": [0, 10, 140, 205, 247, 289], "sbr5": [0, 10, 140, 205, 247, 289], "ybl2": [0, 10, 140, 205, 247, 289], "ufo1": [0, 10, 140, 205, 247, 289], "succinatiphilu": [0, 10, 140, 205, 247, 289], "11850": [0, 10, 140, 205, 247, 289], "intestinihomini": [0, 10, 140, 205, 247, 289], "11860": [0, 10, 140, 205, 247, 289], "parasutterella": [0, 10, 140, 205, 247, 289], "excrementihomini": [0, 10, 140, 205, 247, 289], "11859": [0, 10, 140, 205, 247, 289], "capsosiphoni": [0, 10, 140, 205, 247, 289], "23843": [0, 10, 140, 205, 247, 289], "15074": [0, 10, 140, 205, 247, 289], "ulceribovi": [0, 10, 140, 205, 247, 289], "45146": [0, 10, 140, 205, 247, 289], "ms024": [0, 10, 140, 205, 247, 289], "scbi": [0, 10, 140, 205, 247, 289], "peloridi": [0, 10, 140, 205, 247, 289], "23910": [0, 10, 140, 205, 247, 289], "desulfonatronospira": [0, 10, 140, 205, 247, 289], "thiodismutan": [0, 10, 140, 205, 247, 289], "aso3": [0, 10, 140, 205, 247, 289], "halarchaeum": [0, 10, 140, 205, 247, 289], "mh1": [0, 10, 140, 205, 247, 289], "stm": [0, 10, 140, 205, 247, 289], "2683": [0, 10, 140, 205, 247, 289], "45148": [0, 10, 140, 205, 247, 289], "bss20148": [0, 10, 140, 205, 247, 289], "litoreibact": [0, 10, 140, 205, 247, 289], "19593": [0, 10, 140, 205, 247, 289], "leucobact": [0, 10, 140, 205, 247, 289], "chironomi": [0, 10, 140, 205, 247, 289], "19883": [0, 10, 140, 205, 247, 289], "brachymona": [0, 10, 140, 205, 247, 289], "19884": [0, 10, 140, 205, 247, 289], "rupellensi": [0, 10, 140, 205, 247, 289], "19944": [0, 10, 140, 205, 247, 289], "velezensi": [0, 10, 140, 205, 247, 289], "fzb42": [0, 10, 140, 205, 247, 289], "23607": [0, 10, 140, 205, 247, 289], "alamii": [0, 10, 140, 205, 247, 289], "palustr": [0, 10, 140, 205, 247, 289], "21579": [0, 10, 140, 205, 247, 289], "tb15": [0, 10, 140, 205, 247, 289], "tb": [0, 10, 140, 205, 247, 289], "panaciterra": [0, 10, 140, 205, 247, 289], "21099": [0, 10, 140, 205, 247, 289], "pseudethanolicu": [0, 10, 140, 205, 247, 289], "33223": [0, 10, 140, 205, 247, 289], "subantarcticu": [0, 10, 140, 205, 247, 289], "24377": [0, 10, 140, 205, 247, 289], "nitrososphaera": [0, 10, 140, 205, 247, 289], "gargensi": [0, 10, 140, 205, 247, 289], "ga9": [0, 10, 140, 205, 247, 289], "panacihumi": [0, 10, 140, 205, 247, 289], "w25": [0, 10, 140, 205, 247, 289], "oryziterra": [0, 10, 140, 205, 247, 289], "21050": [0, 10, 140, 205, 247, 289], "yc6267": [0, 10, 140, 205, 247, 289], "rivuli": [0, 10, 140, 205, 247, 289], "21788": [0, 10, 140, 205, 247, 289], "finlandensi": [0, 10, 140, 205, 247, 289], "opf8": [0, 10, 140, 205, 247, 289], "tepidanaerobact": [0, 10, 140, 205, 247, 289], "acetatoxydan": [0, 10, 140, 205, 247, 289], "re1": [0, 10, 140, 205, 247, 289], "brunneum": [0, 10, 140, 205, 247, 289], "3297": [0, 10, 140, 205, 247, 289], "avicennia": [0, 10, 140, 205, 247, 289], "glaciibact": [0, 10, 140, 205, 247, 289], "superst": [0, 10, 140, 205, 247, 289], "21135": [0, 10, 140, 205, 247, 289], "citreicella": [0, 10, 140, 205, 247, 289], "se45": [0, 10, 140, 205, 247, 289], "bennoni": [0, 10, 140, 205, 247, 289], "23058": [0, 10, 140, 205, 247, 289], "16335": [0, 10, 140, 205, 247, 289], "21156": [0, 10, 140, 205, 247, 289], "butyricicoccu": [0, 10, 140, 205, 247, 289], "pullicaecorum": [0, 10, 140, 205, 247, 289], "profundimari": [0, 10, 140, 205, 247, 289], "wp0211": [0, 10, 140, 205, 247, 289], "gobiensi": [0, 10, 140, 205, 247, 289], "yy7918": [0, 10, 140, 205, 247, 289], "porci": [0, 10, 140, 205, 247, 289], "23759": [0, 10, 140, 205, 247, 289], "diversa": [0, 10, 140, 205, 247, 289], "2478": [0, 10, 140, 205, 247, 289], "salisaeta": [0, 10, 140, 205, 247, 289], "longa": [0, 10, 140, 205, 247, 289], "21114": [0, 10, 140, 205, 247, 289], "sasangens": [0, 10, 140, 205, 247, 289], "21067": [0, 10, 140, 205, 247, 289], "kushneria": [0, 10, 140, 205, 247, 289], "21353": [0, 10, 140, 205, 247, 289], "jejuia": [0, 10, 140, 205, 247, 289], "pallidilutea": [0, 10, 140, 205, 247, 289], "13891": [0, 10, 140, 205, 247, 289], "19966": [0, 10, 140, 205, 247, 289], "chromera": [0, 10, 140, 205, 247, 289], "velia": [0, 10, 140, 205, 247, 289], "ccmp2878": [0, 10, 140, 205, 247, 289], "a13l": [0, 10, 140, 205, 247, 289], "caerulea": [0, 10, 140, 205, 247, 289], "24564": [0, 10, 140, 205, 247, 289], "duerdenii": [0, 10, 140, 205, 247, 289], "1640": [0, 10, 140, 205, 247, 289], "cloacibacillu": [0, 10, 140, 205, 247, 289], "evryensi": [0, 10, 140, 205, 247, 289], "19522": [0, 10, 140, 205, 247, 289], "genosp": [0, 10, 140, 205, 247, 289], "cb756": [0, 10, 140, 205, 247, 289], "v48": [0, 10, 140, 205, 247, 289], "gk1": [0, 10, 140, 205, 247, 289], "azobacteroid": [0, 10, 140, 205, 247, 289], "pseudotrichonympha": [0, 10, 140, 205, 247, 289], "genomovar": [0, 10, 140, 205, 247, 289], "cfp2": [0, 10, 140, 205, 247, 289], "methylacidiphilum": [0, 10, 140, 205, 247, 289], "infernorum": [0, 10, 140, 205, 247, 289], "v4": [0, 10, 140, 205, 247, 289], "azureu": [0, 10, 140, 205, 247, 289], "104587": [0, 10, 140, 205, 247, 289], "6724": [0, 10, 140, 205, 247, 289], "caloram": [0, 10, 140, 205, 247, 289], "australicu": [0, 10, 140, 205, 247, 289], "rc3": [0, 10, 140, 205, 247, 289], "lacticigenium": [0, 10, 140, 205, 247, 289], "naphta": [0, 10, 140, 205, 247, 289], "19658": [0, 10, 140, 205, 247, 289], "22864": [0, 10, 140, 205, 247, 289], "15124": [0, 10, 140, 205, 247, 289], "nesterenkonia": [0, 10, 140, 205, 247, 289], "19423": [0, 10, 140, 205, 247, 289], "lutaonensi": [0, 10, 140, 205, 247, 289], "burhodogranariea": [0, 10, 140, 205, 247, 289], "19968": [0, 10, 140, 205, 247, 289], "sneebia": [0, 10, 140, 205, 247, 289], "19967": [0, 10, 140, 205, 247, 289], "19772": [0, 10, 140, 205, 247, 289], "jsm": [0, 10, 140, 205, 247, 289], "072002": [0, 10, 140, 205, 247, 289], "076056": [0, 10, 140, 205, 247, 289], "19796": [0, 10, 140, 205, 247, 289], "jlt1363": [0, 10, 140, 205, 247, 289], "mongoliens": [0, 10, 140, 205, 247, 289], "21395": [0, 10, 140, 205, 247, 289], "sucicola": [0, 10, 140, 205, 247, 289], "21376": [0, 10, 140, 205, 247, 289], "15457": [0, 10, 140, 205, 247, 289], "hongdengensi": [0, 10, 140, 205, 247, 289], "23025": [0, 10, 140, 205, 247, 289], "elaphomyc": [0, 10, 140, 205, 247, 289], "granulatu": [0, 10, 140, 205, 247, 289], "ectothiorhodospira": [0, 10, 140, 205, 247, 289], "ph": [0, 10, 140, 205, 247, 289], "nvsl": [0, 10, 140, 205, 247, 289], "07": [0, 6, 10, 140, 205, 247, 289], "0026": [0, 10, 140, 205, 247, 289], "83": [0, 10, 140, 205, 247, 289], "24390": [0, 10, 140, 205, 247, 289], "lactosuten": [0, 10, 140, 205, 247, 289], "ds20": [0, 10, 140, 205, 247, 289], "mentagrophyt": [0, 10, 140, 205, 247, 289], "santoriniensi": [0, 10, 140, 205, 247, 289], "nksg1": [0, 10, 140, 205, 247, 289], "27244": [0, 10, 140, 205, 247, 289], "21227": [0, 10, 140, 205, 247, 289], "haloglycomyc": [0, 10, 140, 205, 247, 289], "45210": [0, 10, 140, 205, 247, 289], "oceanibaculum": [0, 10, 140, 205, 247, 289], "p24": [0, 10, 140, 205, 247, 289], "marthii": [0, 10, 140, 205, 247, 289], "thecamona": [0, 10, 140, 205, 247, 289], "trahen": [0, 10, 140, 205, 247, 289], "rhodoluna": [0, 10, 140, 205, 247, 289], "lacicola": [0, 10, 140, 205, 247, 289], "pelagibacterium": [0, 10, 140, 205, 247, 289], "flavobacteriacea": [0, 10, 140, 205, 247, 289], "3519": [0, 9, 10, 140, 205, 247, 289], "actinopolymorpha": [0, 10, 140, 205, 247, 289], "45243": [0, 10, 140, 205, 247, 289], "australicum": [0, 10, 140, 205, 247, 289], "wsm2073": [0, 10, 140, 205, 247, 289], "lutiphoca": [0, 10, 140, 205, 247, 289], "21542": [0, 10, 140, 205, 247, 289], "rudaea": [0, 10, 140, 205, 247, 289], "22992": [0, 10, 140, 205, 247, 289], "21543": [0, 10, 140, 205, 247, 289], "lubricanti": [0, 10, 140, 205, 247, 289], "45231": [0, 10, 140, 205, 247, 289], "peronospora": [0, 10, 140, 205, 247, 289], "subtropicu": [0, 10, 140, 205, 247, 289], "y412mc61": [0, 10, 140, 205, 247, 289], "f0510": [0, 10, 140, 205, 247, 289], "butyricimona": [0, 10, 140, 205, 247, 289], "synergistica": [0, 10, 140, 205, 247, 289], "23225": [0, 10, 140, 205, 247, 289], "akl11": [0, 10, 140, 205, 247, 289], "alj24": [0, 10, 140, 205, 247, 289], "alishewanella": [0, 10, 140, 205, 247, 289], "22429": [0, 10, 140, 205, 247, 289], "paraoerskovia": [0, 10, 140, 205, 247, 289], "21750": [0, 10, 140, 205, 247, 289], "5110": [0, 10, 140, 205, 247, 289], "3684": [0, 10, 140, 205, 247, 289], "ho": [0, 10, 140, 205, 247, 289], "sn": [0, 10, 140, 205, 247, 289], "phycisphaera": [0, 10, 140, 205, 247, 289], "mikurensi": [0, 10, 140, 205, 247, 289], "102666": [0, 10, 140, 205, 247, 289], "pseudogulbenkiania": [0, 10, 140, 205, 247, 289], "y412mc52": [0, 10, 140, 205, 247, 289], "acacia": [0, 10, 140, 205, 247, 289], "45401": [0, 10, 140, 205, 247, 289], "aromatoleum": [0, 10, 140, 205, 247, 289], "aromaticum": [0, 10, 140, 205, 247, 289], "ebn1": [0, 10, 140, 205, 247, 289], "caldicoprobact": [0, 10, 140, 205, 247, 289], "21659": [0, 10, 140, 205, 247, 289], "sediminimona": [0, 10, 140, 205, 247, 289], "qiaohouensi": [0, 10, 140, 205, 247, 289], "21189": [0, 10, 140, 205, 247, 289], "salinarimona": [0, 10, 140, 205, 247, 289], "21201": [0, 10, 140, 205, 247, 289], "5_2_54faa": [0, 10, 140, 205, 247, 289], "ruminococcacea": [0, 10, 140, 205, 247, 289], "d16": [0, 10, 140, 205, 247, 289], "vgiii": [0, 10, 140, 205, 247, 289], "dehalogenimona": [0, 10, 140, 205, 247, 289], "lykanthroporepellen": [0, 10, 140, 205, 247, 289], "bl": [0, 10, 140, 205, 247, 289], "pelagia": [0, 10, 140, 205, 247, 289], "cl": [0, 10, 140, 205, 247, 289], "ap6": [0, 10, 140, 205, 247, 289], "breoganii": [0, 10, 140, 205, 247, 289], "1c10": [0, 10, 140, 205, 247, 289], "agri": [0, 10, 140, 205, 247, 289], "bl06": [0, 10, 140, 205, 247, 289], "crustatorum": [0, 10, 140, 205, 247, 289], "hwa": [0, 10, 140, 205, 247, 289], "leiognathi": [0, 10, 140, 205, 247, 289], "lrivu": [0, 10, 140, 205, 247, 289], "chlorella": [0, 10, 140, 205, 247, 289], "cb2": [0, 10, 140, 205, 247, 289], "chungangens": [0, 10, 140, 205, 247, 289], "26729": [0, 10, 140, 205, 247, 289], "galbibact": [0, 10, 140, 205, 247, 289], "s46": [0, 10, 140, 205, 247, 289], "rr": [0, 10, 140, 205, 247, 289], "d1": [0, 9, 10, 140, 205, 247, 289], "d5": [0, 10, 140, 205, 247, 289], "d7": [0, 10, 140, 205, 247, 289], "clso": [0, 10, 140, 205, 247, 289], "acidifacien": [0, 10, 140, 205, 247, 289], "21887": [0, 10, 140, 205, 247, 289], "freiburgens": [0, 10, 140, 205, 247, 289], "45254": [0, 10, 140, 205, 247, 289], "piperi": [0, 10, 140, 205, 247, 289], "lentibacillu": [0, 10, 140, 205, 247, 289], "carnicancri": [0, 10, 140, 205, 247, 289], "crm": [0, 10, 140, 205, 247, 289], "lacu": [0, 10, 140, 205, 247, 289], "namibia": [0, 10, 140, 205, 247, 289], "147": [0, 10, 140, 165, 205, 247, 289], "sinduriensi": [0, 10, 140, 205, 247, 289], "blb": [0, 10, 140, 205, 247, 289], "15800": [0, 10, 140, 205, 247, 289], "aliagarivoran": [0, 10, 140, 205, 247, 289], "22990": [0, 10, 140, 205, 247, 289], "c561": [0, 10, 140, 205, 247, 289], "c300": [0, 10, 140, 205, 247, 289], "m143": [0, 10, 140, 205, 247, 289], "m334": [0, 10, 140, 205, 247, 289], "acidianu": [0, 10, 140, 205, 247, 289], "c41b8": [0, 10, 140, 205, 247, 289], "d13": [0, 10, 140, 205, 247, 289], "scedosporium": [0, 10, 140, 205, 247, 289], "apiospermum": [0, 10, 140, 205, 247, 289], "saccharomycetacea": [0, 10, 140, 205, 247, 289], "aceri": [0, 10, 140, 205, 247, 289], "robertsii": [0, 10, 140, 205, 247, 289], "poaceiphila": [0, 10, 140, 205, 247, 289], "immunda": [0, 10, 140, 205, 247, 289], "scsio": [0, 10, 140, 205, 247, 289], "04301": [0, 10, 140, 205, 247, 289], "methanocella": [0, 10, 140, 205, 247, 289], "sana": [0, 10, 140, 205, 247, 289], "sjy1": [0, 10, 140, 205, 247, 289], "romalea": [0, 10, 140, 205, 247, 289], "idahoensi": [0, 10, 140, 205, 247, 289], "x513": [0, 10, 140, 205, 247, 289], "hodgkinia": [0, 10, 140, 205, 247, 289], "cicadicola": [0, 10, 140, 205, 247, 289], "dsem": [0, 10, 140, 205, 247, 289], "oxalativoran": [0, 10, 140, 205, 247, 289], "gaemokensi": [0, 10, 140, 205, 247, 289], "manliponensi": [0, 10, 140, 205, 247, 289], "23371": [0, 10, 140, 205, 247, 289], "taeanensi": [0, 10, 140, 205, 247, 289], "45190": [0, 10, 140, 205, 247, 289], "subalpina": [0, 10, 140, 205, 247, 289], "polynucleobact": [0, 10, 140, 205, 247, 289], "necessariu": [0, 10, 140, 205, 247, 289], "stir1": [0, 10, 140, 205, 247, 289], "asymbioticu": [0, 10, 140, 205, 247, 289], "qlw": [0, 10, 140, 205, 247, 289], "p1dmwa": [0, 10, 140, 205, 247, 289], "iranensi": [0, 10, 140, 205, 247, 289], "indibact": [0, 10, 140, 205, 247, 289], "lw1": [0, 10, 140, 205, 247, 289], "enterorhabdu": [0, 10, 140, 205, 247, 289], "mucosicola": [0, 10, 140, 205, 247, 289], "19490": [0, 10, 140, 205, 247, 289], "cytotoxicu": [0, 10, 140, 205, 247, 289], "nvh": [0, 10, 140, 205, 247, 289], "391": [0, 10, 140, 205, 247, 289], "y4": [0, 10, 140, 205, 247, 289], "1mc1": [0, 10, 140, 205, 247, 289], "paralvinella": [0, 10, 140, 205, 247, 289], "rubidibact": [0, 10, 140, 205, 247, 289], "lacuna": [0, 10, 140, 205, 247, 289], "kordi": [0, 10, 140, 205, 247, 289], "51": [0, 9, 10, 140, 169, 205, 247, 289], "mathranii": [0, 10, 140, 205, 247, 289], "49": [0, 10, 140, 165, 205, 247, 289], "d20": [0, 10, 140, 205, 247, 289], "d22": [0, 10, 140, 205, 247, 289], "nematocida": [0, 10, 140, 205, 247, 289], "parisii": [0, 10, 140, 205, 247, 289], "manasiensi": [0, 10, 140, 205, 247, 289], "terribacillu": [0, 10, 140, 205, 247, 289], "chlororaphi": [0, 10, 140, 205, 247, 289], "16676": [0, 10, 140, 205, 247, 289], "naganishii": [0, 10, 140, 205, 247, 289], "naejangsanensi": [0, 10, 140, 205, 247, 289], "17724": [0, 10, 140, 205, 247, 289], "scopo": [0, 10, 140, 205, 247, 289], "17725": [0, 10, 140, 205, 247, 289], "australica": [0, 10, 140, 205, 247, 289], "fumariolicum": [0, 10, 140, 205, 247, 289], "solv": [0, 2, 10, 140, 205, 247, 289], "spb78": [0, 10, 140, 205, 247, 289], "aa4": [0, 10, 140, 205, 247, 289], "ignavibacterium": [0, 10, 140, 205, 247, 289], "isopora": [0, 10, 140, 205, 247, 289], "25204": [0, 10, 140, 205, 247, 289], "9b": [0, 10, 140, 205, 247, 289], "sc1": [0, 10, 140, 205, 247, 289], "opportunistum": [0, 10, 140, 205, 247, 289], "wsm2075": [0, 10, 140, 205, 247, 289], "allofrancisella": [0, 10, 140, 205, 247, 289], "guangzhouensi": [0, 10, 140, 205, 247, 289], "swk7": [0, 10, 140, 205, 247, 289], "15754": [0, 10, 140, 205, 247, 289], "u5l": [0, 10, 140, 205, 247, 289], "brenneria": [0, 10, 140, 205, 247, 289], "enid312": [0, 10, 140, 205, 247, 289], "pyruviciproducen": [0, 10, 140, 205, 247, 289], "1742": [0, 10, 140, 205, 247, 289], "fibroporia": [0, 10, 140, 205, 247, 289], "radiculosa": [0, 10, 140, 205, 247, 289], "rufu": [0, 10, 140, 205, 247, 289], "22234": [0, 10, 140, 205, 247, 289], "wadsworthii": [0, 10, 140, 205, 247, 289], "9715": [0, 10, 140, 205, 247, 289], "shayeganii": [0, 10, 140, 205, 247, 289], "871": [0, 10, 140, 205, 247, 289], "dinoponera": [0, 10, 140, 205, 247, 289], "quadricep": [0, 10, 140, 205, 247, 289], "asaia": [0, 10, 140, 205, 247, 289], "platycodi": [0, 10, 140, 205, 247, 289], "sf2": [0, 10, 140, 205, 247, 289], "harpegnatho": [0, 10, 140, 205, 247, 289], "saltat": [0, 10, 140, 205, 247, 289], "polycyclovoran": [0, 10, 140, 205, 247, 289], "tg408": [0, 10, 140, 205, 247, 289], "49242": [0, 10, 140, 205, 247, 289], "bge": [0, 10, 140, 205, 247, 289], "12056": [0, 10, 140, 205, 247, 289], "fluxu": [0, 10, 140, 205, 247, 289], "12057": [0, 10, 140, 205, 247, 289], "oleiciplenu": [0, 10, 140, 205, 247, 289], "12058": [0, 10, 140, 205, 247, 289], "indistinctu": [0, 10, 140, 205, 247, 289], "12060": [0, 10, 140, 205, 247, 289], "laneu": [0, 10, 140, 205, 247, 289], "12061": [0, 10, 140, 205, 247, 289], "piriformi": [0, 10, 140, 205, 247, 289], "12062": [0, 10, 140, 205, 247, 289], "tanakaei": [0, 10, 140, 205, 247, 289], "12063": [0, 10, 140, 205, 247, 289], "succinatimona": [0, 10, 140, 205, 247, 289], "hippei": [0, 10, 140, 205, 247, 289], "12066": [0, 10, 140, 205, 247, 289], "phascolarctobacterium": [0, 10, 140, 205, 247, 289], "succinatuten": [0, 10, 140, 205, 247, 289], "12067": [0, 10, 140, 205, 247, 289], "syk": [0, 10, 140, 205, 247, 289], "mn802worker": [0, 10, 140, 205, 247, 289], "tomitella": [0, 10, 140, 205, 247, 289], "ahu": [0, 10, 140, 205, 247, 289], "1821": [0, 10, 140, 205, 247, 289], "thiorhodovibrio": [0, 10, 140, 205, 247, 289], "xmu15": [0, 10, 140, 205, 247, 289], "rudi": [0, 10, 140, 205, 247, 289], "110305": [0, 10, 140, 205, 247, 289], "thalassobium": [0, 10, 140, 205, 247, 289], "r2a62": [0, 10, 140, 205, 247, 289], "saccharolytica": [0, 10, 140, 205, 247, 289], "f0055": [0, 10, 140, 205, 247, 289], "bohemicum": [0, 10, 140, 205, 247, 289], "22767": [0, 10, 140, 205, 247, 289], "actinocoloniiform": [0, 10, 140, 205, 247, 289], "22766": [0, 10, 140, 205, 247, 289], "pyramidobact": [0, 10, 140, 205, 247, 289], "piscolen": [0, 10, 140, 205, 247, 289], "w5455": [0, 10, 140, 205, 247, 289], "kb": [0, 10, 140, 205, 247, 289], "hoyosella": [0, 10, 140, 205, 247, 289], "dqs3": [0, 10, 140, 205, 247, 289], "9a1": [0, 10, 140, 205, 247, 289], "2f": [0, 10, 140, 205, 247, 289], "ccge1001": [0, 10, 140, 205, 247, 289], "ccge1003": [0, 10, 140, 205, 247, 289], "dl": [0, 10, 140, 205, 247, 289], "viii": [0, 10, 140, 205, 247, 289], "oral": [0, 10, 140, 205, 247, 289], "014": [0, 9, 10, 140, 205, 247, 289], "f0314": [0, 10, 140, 205, 247, 289], "morbirosei": [0, 10, 140, 205, 247, 289], "silicibact": [0, 10, 140, 205, 247, 289], "trichch4b": [0, 10, 140, 205, 247, 289], "fs406": [0, 10, 140, 205, 247, 289], "e14": [0, 10, 140, 205, 247, 289], "hepatopenaei": [0, 10, 140, 205, 247, 289], "gaboni": [0, 10, 140, 205, 247, 289], "mb200": [0, 10, 140, 205, 247, 289], "l5": [0, 10, 140, 205, 247, 289], "cesiribact": [0, 10, 140, 205, 247, 289], "andamanensi": [0, 10, 140, 205, 247, 289], "amv16": [0, 10, 140, 205, 247, 289], "848": [0, 10, 140, 205, 247, 289], "f0332": [0, 10, 140, 205, 247, 289], "hydrogeniforman": [0, 10, 140, 205, 247, 289], "1850": [0, 10, 140, 205, 247, 289], "hadru": [0, 10, 140, 205, 247, 289], "3319": [0, 10, 140, 205, 247, 289], "n902": [0, 10, 140, 205, 247, 289], "109": [0, 10, 140, 205, 247, 289], "sulfuricella": [0, 10, 140, 205, 247, 289], "skb26": [0, 10, 140, 205, 247, 289], "fibrella": [0, 10, 140, 205, 247, 289], "aestuarina": [0, 10, 140, 205, 247, 289], "buz": [0, 10, 140, 205, 247, 289], "aurantimona": [0, 10, 140, 205, 247, 289], "manganoxydan": [0, 10, 140, 205, 247, 289], "si85": [0, 10, 140, 205, 247, 289], "kosmotoga": [0, 10, 140, 205, 247, 289], "olearia": [0, 10, 140, 205, 247, 289], "tbf": [0, 10, 140, 205, 247, 289], "f0310": [0, 10, 140, 205, 247, 289], "fretibacterium": [0, 10, 140, 205, 247, 289], "fastidiosum": [0, 10, 140, 205, 247, 289], "078": [0, 10, 140, 205, 247, 289], "f0262": [0, 10, 140, 205, 247, 289], "bacteroidet": [0, 10, 140, 205, 247, 289], "274": [0, 10, 140, 205, 247, 289], "f0058": [0, 10, 140, 205, 247, 289], "386": [0, 10, 140, 205, 247, 289], "f0131": [0, 10, 140, 205, 247, 289], "786": [0, 10, 140, 205, 247, 289], "d14": [0, 10, 140, 205, 247, 289], "299": [0, 10, 140, 205, 247, 289], "f0039": [0, 10, 140, 205, 247, 289], "f0108": [0, 10, 140, 205, 247, 289], "849": [0, 10, 140, 205, 247, 289], "f0330": [0, 10, 140, 205, 247, 289], "albugo": [0, 10, 140, 205, 247, 289], "laibachii": [0, 10, 140, 205, 247, 289], "472": [0, 10, 140, 205, 247, 289], "f0295": [0, 10, 140, 205, 247, 289], "pseudogymnoascu": [0, 10, 140, 205, 247, 289], "destructan": [0, 10, 140, 205, 247, 289], "20631": [0, 10, 140, 205, 247, 289], "vervacti": [0, 10, 140, 205, 247, 289], "sr1": [0, 10, 140, 205, 247, 289], "beibuens": [0, 10, 140, 205, 247, 289], "f44": [0, 10, 140, 205, 247, 289], "koribact": [0, 10, 140, 205, 247, 289], "versatili": [0, 10, 140, 205, 247, 289], "ellin345": [0, 10, 140, 205, 247, 289], "5_2_56faa": [0, 10, 140, 205, 247, 289], "1_1_57faa": [0, 10, 140, 205, 247, 289], "2_1_58faa": [0, 10, 140, 205, 247, 289], "6_1_63faa": [0, 10, 140, 205, 247, 289], "5_1_57faa": [0, 10, 140, 205, 247, 289], "3_1_57faa_ct1": [0, 10, 140, 205, 247, 289], "7_1_58faa": [0, 10, 140, 205, 247, 289], "9_1_43bfaa": [0, 10, 140, 205, 247, 289], "5_1_63faa": [0, 10, 140, 205, 247, 289], "h2": [0, 10, 140, 205, 247, 289], "1_4_56faa": [0, 10, 140, 205, 247, 289], "6_1_37faa": [0, 10, 140, 205, 247, 289], "21_3": [0, 10, 140, 205, 247, 289], "3_1_53": [0, 10, 140, 205, 247, 289], "d25": [0, 10, 140, 205, 247, 289], "31_2": [0, 10, 140, 205, 247, 289], "acidipaludi": [0, 10, 140, 205, 247, 289], "101816": [0, 10, 140, 205, 247, 289], "809": [0, 10, 140, 205, 247, 289], "f0356": [0, 10, 140, 205, 247, 289], "squillarum": [0, 10, 140, 205, 247, 289], "parvarchaeum": [0, 10, 140, 205, 247, 289], "arman": [0, 10, 140, 205, 247, 289], "4_": [0, 10, 140, 205, 247, 289], "wai": [0, 1, 2, 5, 6, 9, 10, 140, 205, 247, 289, 323, 324, 325], "5_": [0, 10, 140, 205, 247, 289], "fibrisoma": [0, 10, 140, 205, 247, 289], "limi": [0, 10, 140, 205, 247, 289], "aurea": [0, 10, 140, 205, 247, 289], "salsiciu": [0, 10, 140, 205, 247, 289], "bavariensi": [0, 10, 140, 205, 247, 289], "pbi": [0, 10, 140, 205, 247, 289], "oceanisedimini": [0, 10, 140, 205, 247, 289], "2691": [0, 10, 140, 205, 247, 289], "dietzia": [0, 10, 140, 205, 247, 289], "alimentaria": [0, 10, 140, 205, 247, 289], "72": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "10_1_50": [0, 10, 140, 205, 247, 289], "7_3_54faa": [0, 10, 140, 205, 247, 289], "3_3_56faa": [0, 10, 140, 205, 247, 289], "6_1_46afaa": [0, 10, 140, 205, 247, 289], "1_3_56faa": [0, 10, 140, 205, 247, 289], "4_1_44faa": [0, 10, 140, 205, 247, 289], "gt4a_ct1": [0, 10, 140, 205, 247, 289], "6_1_58faa_ct1": [0, 10, 140, 205, 247, 289], "3_1_46faa": [0, 10, 140, 205, 247, 289], "8_1_57faa": [0, 10, 140, 205, 247, 289], "4_3_54a2faa": [0, 10, 140, 205, 247, 289], "7_6_55cfaa_ct2": [0, 10, 140, 205, 247, 289], "bt1b_ct2": [0, 10, 140, 205, 247, 289], "2_a_57_ct2": [0, 10, 140, 205, 247, 289], "macrocephali": [0, 10, 140, 205, 247, 289], "jamb": [0, 10, 140, 205, 247, 289], "n27": [0, 10, 140, 205, 247, 289], "1nls2": [0, 10, 140, 205, 247, 289], "1nla3e": [0, 10, 140, 205, 247, 289], "raphidiopsi": [0, 10, 140, 205, 247, 289], "brookii": [0, 10, 140, 205, 247, 289], "d9": [0, 10, 140, 205, 247, 289], "thelohanellu": [0, 10, 140, 205, 247, 289], "kitauei": [0, 10, 140, 205, 247, 289], "geminocysti": [0, 10, 140, 205, 247, 289], "herdmanii": [0, 10, 140, 205, 247, 289], "6308": [0, 10, 140, 205, 247, 289], "16418": [0, 10, 140, 205, 247, 289], "profftella": [0, 10, 140, 205, 247, 289], "armatura": [0, 10, 140, 205, 247, 289], "uzinura": [0, 10, 140, 205, 247, 289], "diaspidicola": [0, 10, 140, 205, 247, 289], "asner": [0, 10, 140, 205, 247, 289], "methylomirabili": [0, 10, 140, 205, 247, 289], "oxyfera": [0, 10, 140, 205, 247, 289], "f0581": [0, 10, 140, 205, 247, 289], "rava": [0, 10, 140, 205, 247, 289], "f0323": [0, 10, 140, 205, 247, 289], "192": [0, 10, 140, 205, 247, 289], "f0372": [0, 10, 140, 205, 247, 289], "artemidi": [0, 10, 140, 205, 247, 289], "f0399": [0, 10, 140, 205, 247, 289], "158": [0, 10, 140, 166, 205, 247, 289], "f0412": [0, 10, 140, 205, 247, 289], "780": [0, 10, 140, 205, 247, 289], "f0422": [0, 10, 140, 205, 247, 289], "caecimuri": [0, 10, 140, 205, 247, 289], "sartorii": [0, 10, 140, 205, 247, 289], "dnlkv3": [0, 10, 140, 205, 247, 289], "yannicii": [0, 10, 140, 205, 247, 289], "ps01": [0, 10, 140, 205, 247, 289], "cbtq1": [0, 10, 140, 205, 247, 289], "mar08": [0, 10, 140, 205, 247, 289], "babela": [0, 10, 140, 205, 247, 289], "faeci": [0, 10, 140, 205, 247, 289], "maj27": [0, 10, 140, 205, 247, 289], "rc586": [0, 10, 140, 205, 247, 289], "nothofagi": [0, 10, 140, 205, 247, 289], "fervidicoccu": [0, 10, 140, 205, 247, 289], "fonti": [0, 10, 140, 205, 247, 289], "kam940": [0, 10, 140, 205, 247, 289], "pr090111": [0, 10, 140, 205, 247, 289], "t3t": [0, 10, 140, 205, 247, 289], "s9": [0, 10, 140, 205, 247, 289], "nk2b42": [0, 10, 140, 205, 247, 289], "fructicola": [0, 10, 140, 205, 247, 289], "nara": [0, 10, 140, 205, 247, 289], "gc5": [0, 10, 140, 205, 247, 289], "t3": [0, 10, 140, 205, 247, 289], "fonticula": [0, 10, 140, 205, 247, 289], "caldisericum": [0, 10, 140, 205, 247, 289], "exil": [0, 10, 140, 205, 247, 289], "azm16c01": [0, 10, 140, 205, 247, 289], "lgp32": [0, 10, 140, 205, 247, 289], "enterobacteriacea": [0, 10, 140, 205, 247, 289], "fgi": [0, 10, 140, 205, 247, 289], "halogranum": [0, 10, 140, 205, 247, 289], "salarium": [0, 10, 140, 205, 247, 289], "4_1_30": [0, 10, 140, 205, 247, 289], "marssonina": [0, 10, 140, 205, 247, 289], "brunnea": [0, 10, 140, 205, 247, 289], "multigermtubi": [0, 10, 140, 205, 247, 289], "mb_m1": [0, 10, 140, 205, 247, 289], "alimentariu": [0, 10, 140, 205, 247, 289], "type_1": [0, 10, 140, 205, 247, 289], "28l": [0, 10, 140, 205, 247, 289], "caribbeanicu": [0, 10, 140, 205, 247, 289], "2122": [0, 10, 140, 165, 166, 205, 247, 289], "n418": [0, 10, 140, 205, 247, 289], "pp1y": [0, 10, 140, 205, 247, 289], "329": [0, 10, 140, 205, 247, 289], "f0087": [0, 10, 140, 205, 247, 289], "f0337": [0, 10, 140, 205, 247, 289], "chlorophyti": [0, 10, 140, 205, 247, 289], "tofieldia": [0, 10, 140, 205, 247, 289], "bradyrhizobiacea": [0, 10, 140, 205, 247, 289], "sg": [0, 10, 140, 205, 247, 289], "6c": [0, 10, 140, 205, 247, 289], "qa3": [0, 10, 140, 205, 247, 289], "178": [0, 10, 140, 205, 247, 289], "f0338": [0, 10, 140, 205, 247, 289], "338": [0, 10, 140, 205, 247, 289], "f0234": [0, 10, 140, 205, 247, 289], "fiorinia": [0, 10, 140, 205, 247, 289], "gxt6": [0, 10, 140, 205, 247, 289], "f0386": [0, 10, 140, 205, 247, 289], "172": [0, 10, 140, 205, 247, 289], "f0311": [0, 10, 140, 205, 247, 289], "175": [0, 10, 140, 171, 205, 216, 247, 257, 289, 301, 324, 325], "f0384": [0, 10, 140, 205, 247, 289], "f0379": [0, 10, 140, 205, 247, 289], "448": [0, 10, 140, 205, 247, 289], "f0400": [0, 10, 140, 205, 247, 289], "458": [0, 10, 140, 205, 247, 289], "w10330": [0, 10, 140, 205, 247, 289], "199": [0, 10, 140, 205, 247, 289], "f0494": [0, 10, 140, 205, 247, 289], "810": [0, 10, 140, 205, 247, 289], "f0209": [0, 10, 140, 205, 247, 289], "324": [0, 10, 140, 205, 247, 289], "f0483": [0, 10, 140, 205, 247, 289], "326": [0, 10, 140, 205, 247, 289], "f0382": [0, 10, 140, 205, 247, 289], "332": [0, 10, 140, 205, 247, 289], "f0381": [0, 10, 140, 205, 247, 289], "336": [0, 10, 140, 205, 247, 289], "f0502": [0, 10, 140, 205, 247, 289], "380": [0, 10, 140, 205, 247, 289], "f0488": [0, 10, 140, 205, 247, 289], "370": [0, 10, 140, 205, 247, 289], "f0437": [0, 10, 140, 205, 247, 289], "215": [0, 10, 140, 205, 247, 289], "w9775": [0, 10, 140, 205, 247, 289], "186": [0, 10, 140, 205, 247, 289, 324, 325], "f0373": [0, 10, 140, 205, 247, 289], "f0370": [0, 10, 140, 205, 247, 289], "f0425": [0, 10, 140, 205, 247, 289], "375": [0, 10, 140, 205, 247, 289], "f0436": [0, 10, 140, 205, 247, 289], "w7784": [0, 10, 140, 205, 247, 289], "f0472": [0, 10, 140, 205, 247, 289], "473": [0, 10, 140, 205, 247, 289], "f0040": [0, 10, 140, 205, 247, 289], "137": [0, 10, 140, 205, 247, 289], "f0430": [0, 10, 140, 205, 247, 289], "138": [0, 10, 140, 205, 247, 289], "f0429": [0, 10, 140, 205, 247, 289], "67h29bp": [0, 10, 140, 205, 247, 289], "056": [0, 10, 140, 205, 247, 289], "f0418": [0, 10, 140, 205, 247, 289], "058": [0, 10, 140, 205, 247, 289], "f0407": [0, 10, 140, 205, 247, 289], "071": [0, 10, 140, 205, 247, 289], "73h25ap": [0, 10, 140, 205, 247, 289], "f0552": [0, 10, 140, 205, 247, 289], "082": [0, 10, 140, 205, 247, 289], "f0431": [0, 10, 140, 205, 247, 289], "107": [0, 10, 140, 168, 205, 247, 289], "f0167": [0, 10, 140, 205, 247, 289], "f0440": [0, 10, 140, 205, 247, 289], "atelocyanobacterium": [0, 10, 140, 205, 247, 289], "thalassa": [0, 10, 140, 205, 247, 289], "sio64986": [0, 10, 140, 205, 247, 289], "ccbau": [0, 10, 140, 205, 247, 289], "05684": [0, 10, 140, 205, 247, 289], "obsidiansi": [0, 10, 140, 205, 247, 289], "ob47": [0, 10, 140, 205, 247, 289], "hyphopichia": [0, 10, 140, 205, 247, 289], "1933": [0, 10, 140, 205, 247, 289], "mc1": [0, 10, 140, 205, 247, 289], "drc": [0, 10, 140, 205, 247, 289], "itaito": [0, 10, 140, 205, 247, 289], "c115": [0, 10, 140, 205, 247, 289], "ebreu": [0, 10, 140, 205, 247, 289], "tpsy": [0, 10, 140, 205, 247, 289], "f10": [0, 10, 140, 205, 247, 289], "zf": [0, 10, 140, 205, 247, 289], "129": [0, 10, 140, 205, 247, 289], "anncaliia": [0, 10, 140, 205, 247, 289], "algera": [0, 10, 140, 205, 247, 289], "pra109": [0, 10, 140, 205, 247, 289], "y9602": [0, 10, 140, 205, 247, 289], "cs1": [0, 10, 140, 205, 247, 289], "melanaphi": [0, 10, 140, 205, 247, 289], "4_8_47faa": [0, 10, 140, 205, 247, 289], "2_1_46faa": [0, 10, 140, 205, 247, 289], "sb2": [0, 10, 140, 205, 247, 289], "ahrensia": [0, 10, 140, 205, 247, 289], "r2a130": [0, 10, 140, 205, 247, 289], "roseibium": [0, 10, 140, 205, 247, 289], "trichskd4": [0, 10, 140, 205, 247, 289], "vcsm12": [0, 10, 140, 205, 247, 289], "mobilicoccu": [0, 10, 140, 205, 247, 289], "pelagiu": [0, 10, 140, 205, 247, 289], "104925": [0, 10, 140, 205, 247, 289], "fumigatu": [0, 10, 140, 205, 247, 289], "af293": [0, 10, 140, 205, 247, 289], "x50": [0, 10, 140, 205, 247, 289], "azoarcu": [0, 10, 140, 205, 247, 289], "kh32c": [0, 10, 140, 205, 247, 289], "nh8b": [0, 10, 140, 205, 247, 289], "alsr1": [0, 10, 140, 205, 247, 289], "sulfuritalea": [0, 10, 140, 205, 247, 289], "hydrogenivoran": [0, 10, 140, 205, 247, 289], "sk43h": [0, 10, 140, 205, 247, 289], "art55": [0, 10, 140, 205, 247, 289], "dl1": [0, 10, 140, 205, 247, 289], "tw09308": [0, 10, 140, 205, 247, 289], "winogradskyella": [0, 10, 140, 205, 247, 289], "aphoticum": [0, 10, 140, 205, 247, 289], "nitratireducenticrescen": [0, 10, 140, 205, 247, 289], "frappieri": [0, 10, 140, 205, 247, 289], "bnl1100": [0, 10, 140, 205, 247, 289], "wp8": [0, 10, 140, 205, 247, 289], "110367": [0, 10, 140, 205, 247, 289], "rpe67": [0, 10, 140, 205, 247, 289], "newyorkensi": [0, 10, 140, 205, 247, 289], "2681": [0, 10, 140, 205, 247, 289], "consociata": [0, 10, 140, 205, 247, 289], "callitricho": [0, 10, 140, 205, 247, 289], "23973": [0, 10, 140, 205, 247, 289], "stellenboschens": [0, 10, 140, 205, 247, 289], "biavatii": [0, 10, 140, 205, 247, 289], "23969": [0, 10, 140, 205, 247, 289], "siansivirga": [0, 10, 140, 205, 247, 289], "samt": [0, 10, 140, 205, 247, 289], "851": [0, 10, 140, 205, 247, 289], "f0397": [0, 10, 140, 205, 247, 289], "bannensi": [0, 10, 140, 205, 247, 289], "103871": [0, 10, 140, 205, 247, 289], "0408225": [0, 10, 140, 205, 247, 289], "pyrenochaeta": [0, 10, 140, 205, 247, 289], "ds3say3a": [0, 10, 140, 205, 247, 289], "stagonospora": [0, 10, 140, 205, 247, 289], "src1lsm3a": [0, 10, 140, 205, 247, 289], "jasicida": [0, 10, 140, 205, 247, 289], "mwb": [0, 10, 140, 205, 247, 289], "357": [0, 9, 10, 140, 205, 247, 289], "puniceispirillum": [0, 10, 140, 205, 247, 289], "imcc1322": [0, 10, 140, 205, 247, 289], "as12": [0, 10, 140, 205, 247, 289], "as13": [0, 10, 140, 205, 247, 289], "05631": [0, 10, 140, 205, 247, 289], "tav5": [0, 10, 140, 205, 247, 289], "burkholderiacea": [0, 10, 140, 205, 247, 289], "pba": [0, 10, 140, 205, 247, 289], "sugiyamaella": [0, 10, 140, 205, 247, 289], "lignohabitan": [0, 10, 140, 205, 247, 289], "peptoanaerobact": [0, 10, 140, 205, 247, 289], "stomatobaculum": [0, 10, 140, 205, 247, 289], "kipferlia": [0, 10, 140, 205, 247, 289], "bialata": [0, 10, 140, 205, 247, 289], "nubica": [0, 10, 140, 205, 247, 289], "ubiquitum": [0, 10, 140, 205, 247, 289], "parareesei": [0, 10, 140, 205, 247, 289], "caenispirillum": [0, 10, 140, 205, 247, 289], "ak4": [0, 10, 140, 205, 247, 289], "h13": [0, 10, 140, 205, 247, 289], "gemmatirosa": [0, 10, 140, 205, 247, 289], "kalamazoonesi": [0, 10, 140, 205, 247, 289], "sirexaa": [0, 10, 140, 205, 247, 289], "thermincola": [0, 10, 140, 205, 247, 289], "poten": [0, 10, 140, 205, 247, 289], "jr": [0, 10, 140, 205, 247, 289], "joshi_001": [0, 10, 140, 205, 247, 289], "lotononidi": [0, 10, 140, 205, 247, 289], "oscillatorial": [0, 10, 140, 205, 247, 289], "c42_a2020_001": [0, 10, 140, 205, 247, 289], "cryophilu": [0, 10, 140, 205, 247, 289], "cat2": [0, 10, 140, 205, 247, 289], "396": [0, 10, 140, 205, 247, 289], "angusta": [0, 10, 140, 205, 247, 289], "saanensi": [0, 10, 140, 205, 247, 289], "sp1pr4": [0, 10, 140, 205, 247, 289], "stercorirosori": [0, 10, 140, 205, 247, 289], "17103": [0, 10, 140, 205, 247, 289], "pasteurii": [0, 10, 140, 205, 247, 289], "23907": [0, 10, 140, 205, 247, 289], "crbip": [0, 10, 140, 205, 247, 289], "76": [0, 10, 140, 168, 205, 247, 289], "celeribact": [0, 10, 140, 205, 247, 289], "baekdonensi": [0, 10, 140, 205, 247, 289], "b30": [0, 10, 140, 205, 247, 289], "mycolicibact": [0, 10, 140, 205, 247, 289], "methyloferula": [0, 10, 140, 205, 247, 289], "ar4": [0, 10, 140, 205, 247, 289], "nk3a76": [0, 10, 140, 205, 247, 289], "nk3b98": [0, 10, 140, 205, 247, 289], "nk3d112": [0, 10, 140, 205, 247, 289], "nk4a136": [0, 10, 140, 205, 247, 289], "nk4a144": [0, 10, 140, 205, 247, 289], "nk4a179": [0, 10, 140, 205, 247, 289], "strb126": [0, 10, 140, 205, 247, 289], "piezophilu": [0, 10, 140, 205, 247, 289], "c1tlv30": [0, 10, 140, 205, 247, 289], "cutaneotrichosporon": [0, 10, 140, 205, 247, 289], "oleaginosum": [0, 10, 140, 205, 247, 289], "g2": [0, 10, 140, 205, 247, 289], "fulvivirga": [0, 10, 140, 205, 247, 289], "imtechensi": [0, 10, 140, 205, 247, 289], "ak7": [0, 10, 140, 205, 247, 289], "formicica": [0, 10, 140, 205, 247, 289], "smsp": [0, 10, 140, 205, 247, 289], "schleiferia": [0, 10, 140, 205, 247, 289], "yellowston": [0, 10, 140, 205, 247, 289], "zinderia": [0, 10, 140, 205, 247, 289], "mageeibacillu": [0, 10, 140, 205, 247, 289], "upii9": [0, 10, 140, 205, 247, 289], "acidiphilu": [0, 10, 140, 205, 247, 289], "sj4": [0, 10, 140, 205, 247, 289], "mp688": [0, 10, 140, 205, 247, 289], "nanosalina": [0, 10, 140, 205, 247, 289], "j07ab43": [0, 10, 140, 205, 247, 289], "nanosalinarum": [0, 10, 140, 205, 247, 289], "j07ab56": [0, 10, 140, 205, 247, 289], "plautia": [0, 10, 140, 205, 247, 289], "stali": [0, 10, 140, 205, 247, 289], "ulvanivoran": [0, 10, 140, 205, 247, 289], "phytopythium": [0, 10, 140, 205, 247, 289], "vexan": [0, 10, 140, 205, 247, 289], "br484": [0, 10, 140, 205, 247, 289], "hgf2": [0, 10, 140, 205, 247, 289], "hgb5": [0, 10, 140, 205, 247, 289], "fosc": [0, 10, 140, 205, 247, 289], "spheciospongia": [0, 10, 140, 205, 247, 289], "sar116": [0, 10, 140, 205, 247, 289], "alpha": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 140, 194, 205, 221, 247, 289, 292, 325], "proteobacterium": [0, 10, 140, 205, 247, 289], "himb100": [0, 10, 140, 205, 247, 289], "fo": [0, 10, 140, 205, 247, 289], "beg1": [0, 10, 140, 205, 247, 289], "caldanaerobact": [0, 10, 140, 205, 247, 289], "tengcongensi": [0, 10, 140, 205, 247, 289], "mb4": [0, 10, 140, 205, 247, 289], "iranicum": [0, 10, 140, 205, 247, 289], "um_tjl": [0, 10, 140, 205, 247, 289], "tl1": [0, 10, 140, 205, 247, 289], "geojedonensi": [0, 10, 140, 205, 247, 289], "agropyri": [0, 10, 140, 205, 247, 289], "asinibacterium": [0, 10, 140, 205, 247, 289], "or53": [0, 10, 140, 205, 247, 289], "regulorum": [0, 10, 140, 205, 247, 289], "7509": [0, 10, 140, 205, 247, 289], "florenca": [0, 10, 140, 205, 247, 289], "brassicacearum": [0, 10, 140, 205, 247, 289], "s1": [0, 10, 140, 205, 247, 289], "m24t3": [0, 10, 140, 205, 247, 289], "desulfosarcina": [0, 10, 140, 205, 247, 289], "bus5": [0, 10, 140, 205, 247, 289], "aminobact": [0, 10, 140, 205, 247, 289], "j41": [0, 10, 140, 205, 247, 289], "j33": [0, 10, 140, 205, 247, 289], "j37": [0, 10, 140, 205, 247, 289], "j32": [0, 10, 140, 205, 247, 289], "j14": [0, 10, 140, 205, 247, 289], "j39": [0, 10, 140, 205, 247, 289], "luteimona": [0, 10, 140, 205, 247, 289], "j29": [0, 10, 140, 205, 247, 289], "j54": [0, 10, 140, 205, 247, 289], "delemar": [0, 10, 140, 205, 247, 289], "mogibacterium": [0, 10, 140, 205, 247, 289], "cm50": [0, 10, 140, 205, 247, 289], "desulfurispirillum": [0, 10, 140, 205, 247, 289], "s5": [0, 10, 140, 205, 247, 289], "posidonica": [0, 10, 140, 205, 247, 289], "ivia": [0, 10, 140, 205, 247, 289], "po": [0, 10, 140, 191, 205, 214, 247, 276, 289], "icm47": [0, 10, 140, 205, 247, 289], "bs2": [0, 10, 140, 205, 247, 289], "fobrc6": [0, 10, 140, 205, 247, 289], "fobrc9": [0, 10, 140, 205, 247, 289], "msx8b": [0, 10, 140, 205, 247, 289], "cm6": [0, 10, 140, 205, 247, 289], "as16": [0, 10, 140, 205, 247, 289], "obrc5": [0, 10, 140, 205, 247, 289], "msx33": [0, 10, 140, 205, 247, 289], "casaltella": [0, 10, 140, 205, 247, 289], "fenollaria": [0, 10, 140, 205, 247, 289], "levyella": [0, 10, 140, 205, 247, 289], "provencensi": [0, 10, 140, 205, 247, 289], "scgc": [0, 10, 140, 205, 247, 289], "aaa027": [0, 10, 140, 205, 247, 289], "n21": [0, 10, 140, 205, 247, 289], "granulicella": [0, 10, 140, 205, 247, 289], "mallensi": [0, 10, 140, 205, 247, 289], "mp5actx8": [0, 10, 140, 205, 247, 289], "tundricola": [0, 10, 140, 205, 247, 289], "mp5actx9": [0, 10, 140, 205, 247, 289], "x2": [0, 10, 140, 205, 247, 289], "wsm2230": [0, 10, 140, 205, 247, 289], "jasonia": [0, 10, 140, 205, 247, 289], "km1": [0, 10, 140, 205, 247, 289], "neofelifaeci": [0, 10, 140, 205, 247, 289], "59395": [0, 10, 140, 205, 247, 289], "diplocarpon": [0, 10, 140, 205, 247, 289], "salpingoeca": [0, 10, 140, 205, 247, 289], "rosetta": [0, 10, 140, 205, 247, 289], "metal": [0, 10, 140, 205, 247, 289], "cf5": [0, 10, 140, 205, 247, 289], "dilworthii": [0, 10, 140, 205, 247, 289], "proliferatum": [0, 10, 140, 205, 247, 289], "palaeococcu": [0, 10, 140, 205, 247, 289], "dy20341": [0, 10, 140, 205, 247, 289], "17376": [0, 10, 140, 205, 247, 289], "multimorphosa": [0, 10, 140, 205, 247, 289], "102226": [0, 10, 140, 205, 247, 289], "wulumuqiensi": [0, 10, 140, 205, 247, 289], "r12": [0, 10, 140, 205, 247, 289], "moru": [0, 10, 140, 205, 247, 289], "concha": [0, 10, 140, 205, 247, 289], "lacinutrix": [0, 10, 140, 205, 247, 289], "5h": [0, 10, 140, 205, 247, 289], "4h": [0, 10, 140, 205, 247, 289], "ye": [0, 2, 10, 140, 205, 247, 289, 323], "23975": [0, 10, 140, 205, 247, 289], "heterobasidion": [0, 10, 140, 205, 247, 289], "indiana": [0, 10, 140, 205, 247, 289], "argenteu": [0, 10, 140, 205, 247, 289], "m21126": [0, 10, 140, 205, 247, 289], "moutnovskia": [0, 10, 140, 205, 247, 289], "cal575": [0, 10, 140, 205, 247, 289], "agneti": [0, 10, 140, 205, 247, 289], "lebetimona": [0, 10, 140, 205, 247, 289], "js170": [0, 10, 140, 205, 247, 289], "polymorphum": [0, 10, 140, 205, 247, 289], "sl003b": [0, 10, 140, 205, 247, 289], "26a1": [0, 10, 140, 205, 247, 289], "henc": [0, 10, 140, 205, 247, 289], "03": [0, 6, 10, 140, 205, 247, 289], "erosia": [0, 10, 140, 205, 247, 289], "biolep03": [0, 10, 140, 205, 247, 289], "desouzaii": [0, 10, 140, 205, 247, 289], "tcc079e": [0, 10, 140, 205, 247, 289], "galatii": [0, 10, 140, 205, 247, 289], "tcc219": [0, 10, 140, 205, 247, 289], "oncopeltii": [0, 10, 140, 205, 247, 289], "tcc290e": [0, 10, 140, 205, 247, 289], "desmospora": [0, 10, 140, 205, 247, 289], "8437": [0, 10, 140, 205, 247, 289], "kle": [0, 10, 140, 205, 247, 289], "1280": [0, 10, 140, 205, 247, 289], "himastatinicu": [0, 10, 140, 205, 247, 289], "53653": [0, 10, 140, 205, 247, 289], "td01": [0, 10, 140, 205, 247, 289], "lonarensi": [0, 10, 140, 205, 247, 289], "mpl": [0, 10, 140, 205, 247, 289], "f0473": [0, 10, 140, 205, 247, 289], "f0441": [0, 10, 140, 205, 247, 289], "f0442": [0, 10, 140, 205, 247, 289], "sedimentitalea": [0, 10, 140, 205, 247, 289], "24252": [0, 10, 140, 205, 247, 289], "135": [0, 10, 140, 167, 205, 247, 289], "cryobacterium": [0, 10, 140, 205, 247, 289], "roopkundens": [0, 10, 140, 205, 247, 289], "daldinia": [0, 10, 140, 205, 247, 289], "ec12": [0, 10, 140, 205, 247, 289], "ci": [0, 10, 140, 205, 247, 289], "4a": [0, 10, 140, 205, 247, 289], "1501": [0, 10, 140, 205, 247, 289], "ang1": [0, 10, 140, 205, 247, 289], "imcc9063": [0, 10, 140, 205, 247, 289], "verrucosispora": [0, 10, 140, 205, 247, 289], "fimbriimona": [0, 10, 140, 205, 247, 289], "gsoil": [0, 10, 140, 205, 247, 289], "348": [0, 10, 140, 205, 247, 289], "parapolymorpha": [0, 10, 140, 205, 247, 289], "weihenstephanensi": [0, 10, 140, 205, 247, 289], "r9": [0, 10, 140, 205, 247, 289], "0317": [0, 10, 140, 205, 247, 289], "defluviitoga": [0, 10, 140, 205, 247, 289], "tunisiensi": [0, 10, 140, 205, 247, 289], "nitrosarchaeum": [0, 10, 140, 205, 247, 289], "limnium": [0, 10, 140, 205, 247, 289], "sfb1": [0, 10, 140, 205, 247, 289], "s17": [0, 10, 140, 205, 247, 289], "t7": [0, 10, 140, 205, 247, 289], "yayanosii": [0, 10, 140, 205, 247, 289], "phenacola": [0, 10, 140, 205, 247, 289], "pave": [0, 10, 140, 205, 247, 289], "sideri": [0, 10, 140, 205, 247, 289], "montipora": [0, 10, 140, 205, 247, 289], "stflb209": [0, 10, 140, 205, 247, 289], "p8": [0, 10, 140, 205, 247, 289], "kc8": [0, 10, 140, 205, 247, 289], "ald01": [0, 10, 140, 205, 247, 289], "volucri": [0, 10, 140, 205, 247, 289], "24379": [0, 10, 140, 205, 247, 289], "nuruki": [0, 10, 140, 205, 247, 289], "s6": [0, 10, 140, 205, 247, 289], "senegalens": [0, 10, 140, 205, 247, 289], "kurthia": [0, 10, 140, 205, 247, 289], "dielmo": [0, 10, 140, 205, 247, 289], "senegalensi": [0, 10, 140, 205, 247, 289], "aquamarina": [0, 10, 140, 205, 247, 289], "119918": [0, 10, 140, 205, 247, 289], "hp15": [0, 10, 140, 205, 247, 289], "sulfidiphilu": [0, 10, 140, 205, 247, 289], "hl": [0, 10, 140, 205, 247, 289], "ebgr7": [0, 10, 140, 205, 247, 289], "viennensi": [0, 10, 140, 205, 247, 289], "en76": [0, 10, 140, 205, 247, 289], "hw567": [0, 10, 140, 205, 247, 289], "deferrisoma": [0, 10, 140, 205, 247, 289], "s3r1": [0, 10, 140, 205, 247, 289], "fth1": [0, 10, 140, 205, 247, 289], "a28l": [0, 10, 140, 205, 247, 289], "wsm2793": [0, 10, 140, 205, 247, 289], "wsm3983": [0, 10, 140, 205, 247, 289], "wsm3224": [0, 10, 140, 205, 247, 289], "wsm3626": [0, 10, 140, 205, 247, 289], "arr65": [0, 10, 140, 205, 247, 289], "rhopaloa": [0, 10, 140, 205, 247, 289], "wsm1721": [0, 10, 140, 205, 247, 289], "rat": [0, 10, 140, 205, 247, 289], "subglacial": [0, 10, 140, 205, 247, 289], "2481": [0, 10, 140, 205, 247, 289], "sy8519": [0, 10, 140, 205, 247, 289], "ibun": [0, 10, 140, 205, 247, 289], "ochrovirga": [0, 10, 140, 205, 247, 289], "4557": [0, 10, 140, 205, 247, 289], "pm": [0, 10, 140, 205, 247, 289], "demequina": [0, 10, 140, 205, 247, 289], "mangrovi": [0, 10, 140, 205, 247, 289], "citricoccu": [0, 10, 140, 205, 247, 289], "ch26a": [0, 10, 140, 205, 247, 289], "oceaniovalibu": [0, 10, 140, 205, 247, 289], "guishaninsula": [0, 10, 140, 205, 247, 289], "jlt2003": [0, 10, 140, 205, 247, 289], "aminicenant": [0, 10, 140, 205, 247, 289], "aaa252": [0, 10, 140, 205, 247, 289], "a02": [0, 10, 140, 205, 247, 289], "zymoseptoria": [0, 10, 140, 205, 247, 289], "moranella": [0, 10, 140, 205, 247, 289], "endobia": [0, 10, 140, 205, 247, 289], "lutzii": [0, 10, 140, 205, 247, 289], "anditalea": [0, 10, 140, 205, 247, 289], "andensi": [0, 10, 140, 205, 247, 289], "alo": [0, 10, 140, 205, 247, 289], "alfalfa": [0, 10, 140, 205, 247, 289], "vam": [0, 10, 140, 205, 247, 289], "acetobacteracea": [0, 10, 140, 205, 247, 289], "5844": [0, 10, 140, 205, 247, 289], "thermoplasmatal": [0, 10, 140, 205, 247, 289], "archaeon": [0, 10, 140, 205, 247, 289], "brna1": [0, 10, 140, 205, 247, 289], "tb67": [0, 10, 140, 205, 247, 289], "bmg51109": [0, 10, 140, 205, 247, 289], "br816": [0, 10, 140, 205, 247, 289], "baldaniorum": [0, 10, 140, 205, 247, 289], "93223": [0, 10, 140, 205, 247, 289], "luchuensi": [0, 10, 140, 205, 247, 289], "4308": [0, 10, 140, 205, 247, 289], "halonotiu": [0, 10, 140, 205, 247, 289], "j07hn4": [0, 10, 140, 205, 247, 289], "nsp22": [0, 10, 140, 205, 247, 289], "grimmia": [0, 10, 140, 205, 247, 289], "dasiensi": [0, 10, 140, 205, 247, 289], "10888": [0, 10, 140, 205, 247, 289], "porticoccu": [0, 10, 140, 205, 247, 289], "mctg13d": [0, 10, 140, 205, 247, 289], "solidip": [0, 10, 140, 205, 247, 289], "rwandensi": [0, 10, 140, 205, 247, 289], "thiolapillu": [0, 10, 140, 205, 247, 289], "brandeum": [0, 10, 140, 205, 247, 289], "25146": [0, 10, 140, 205, 247, 289], "hgb0015": [0, 10, 140, 205, 247, 289], "paenisporosarcina": [0, 10, 140, 205, 247, 289], "hgh0030": [0, 10, 140, 205, 247, 289], "hgb0020": [0, 10, 140, 205, 247, 289], "hgs0025": [0, 10, 140, 205, 247, 289], "hps0048": [0, 10, 140, 205, 247, 289], "hpp0074": [0, 10, 140, 205, 247, 289], "hpp0048": [0, 10, 140, 205, 247, 289], "mccc": [0, 10, 140, 205, 247, 289], "1a05965": [0, 10, 140, 205, 247, 289], "13788": [0, 10, 140, 205, 247, 289], "hgh0039": [0, 10, 140, 205, 247, 289], "hfh0082": [0, 10, 140, 205, 247, 289], "mesoamericanum": [0, 10, 140, 205, 247, 289], "stm3625": [0, 10, 140, 205, 247, 289], "chromiiresisten": [0, 10, 140, 205, 247, 289], "jg": [0, 10, 140, 205, 247, 289], "eubayanu": [0, 10, 140, 205, 247, 289], "aquiluna": [0, 10, 140, 205, 247, 289], "imcc13023": [0, 10, 140, 205, 247, 289], "hepatospora": [0, 10, 140, 205, 247, 289], "eriocheir": [0, 10, 140, 205, 247, 289], "enterospora": [0, 10, 140, 205, 247, 289], "canceri": [0, 10, 140, 205, 247, 289], "agarilytica": [0, 10, 140, 205, 247, 289], "db5": [0, 10, 140, 205, 247, 289], "sk140": [0, 10, 140, 205, 247, 289], "sk643": [0, 10, 140, 205, 247, 289], "gxf4": [0, 10, 140, 205, 247, 289], "pao19": [0, 10, 140, 205, 247, 289], "yi23": [0, 10, 140, 205, 247, 289], "coprobact": [0, 10, 140, 205, 247, 289], "fastidiosu": [0, 10, 140, 205, 247, 289], "nsb1": [0, 10, 140, 205, 247, 289], "limnohabitan": [0, 10, 140, 205, 247, 289], "rim28": [0, 10, 140, 205, 247, 289], "rim47": [0, 10, 140, 205, 247, 289], "n2": [0, 10, 140, 205, 247, 289], "n5": [0, 10, 140, 205, 247, 289], "methylopila": [0, 10, 140, 205, 247, 289], "m107": [0, 10, 140, 205, 247, 289], "icm39": [0, 10, 140, 205, 247, 289], "mste9": [0, 10, 140, 205, 247, 289], "philipii": [0, 10, 140, 205, 247, 289], "364d": [0, 10, 140, 205, 247, 289], "paenirhodobact": [0, 10, 140, 205, 247, 289], "enshiensi": [0, 10, 140, 205, 247, 289], "ruben": [0, 10, 140, 205, 247, 289], "ccb_us3_uf1": [0, 10, 140, 205, 247, 289], "yellowstonensi": [0, 10, 140, 205, 247, 289], "mk1": [0, 10, 140, 205, 247, 289], "bv3ac4": [0, 10, 140, 205, 247, 289], "bv2f7": [0, 10, 140, 205, 247, 289], "bv3c26": [0, 10, 140, 205, 247, 289], "coriobacteriacea": [0, 10, 140, 205, 247, 289], "bv3ac1": [0, 10, 140, 205, 247, 289], "bv3c16": [0, 10, 140, 205, 247, 289], "pamc": [0, 10, 140, 205, 247, 289], "21119": [0, 10, 140, 205, 247, 289], "26605": [0, 10, 140, 205, 247, 289], "26617": [0, 10, 140, 205, 247, 289], "31y": [0, 10, 140, 205, 247, 289], "ejy3": [0, 10, 140, 205, 247, 289], "anoph": [0, 10, 140, 205, 247, 289], "nuhp1": [0, 10, 140, 205, 247, 289], "ph3": [0, 10, 140, 205, 247, 289], "gfaj": [0, 10, 140, 205, 247, 289], "rue61a": [0, 10, 140, 205, 247, 289], "ccge": [0, 10, 140, 205, 247, 289], "502": [0, 10, 140, 205, 247, 289], "lc363": [0, 10, 140, 205, 247, 289], "73b": [0, 10, 140, 205, 247, 289], "141": [0, 10, 140, 166, 168, 205, 247, 289], "flavalba": [0, 10, 140, 205, 247, 289], "45200": [0, 10, 140, 205, 247, 289], "doosanens": [0, 10, 140, 205, 247, 289], "cau": [0, 10, 140, 205, 247, 289], "212": [0, 10, 140, 205, 247, 289], "45436": [0, 10, 140, 205, 247, 289], "45133": [0, 10, 140, 205, 247, 289], "fodinicurvata": [0, 10, 140, 205, 247, 289], "fenggangensi": [0, 10, 140, 205, 247, 289], "21160": [0, 10, 140, 205, 247, 289], "21159": [0, 10, 140, 205, 247, 289], "zhanjiangensi": [0, 10, 140, 205, 247, 289], "21076": [0, 10, 140, 205, 247, 289], "19733": [0, 10, 140, 205, 247, 289], "19973": [0, 10, 140, 205, 247, 289], "ponticauli": [0, 10, 140, 205, 247, 289], "19734": [0, 10, 140, 205, 247, 289], "mesophilum": [0, 10, 140, 205, 247, 289], "19309": [0, 10, 140, 205, 247, 289], "kp2": [0, 10, 140, 205, 247, 289], "gonapodya": [0, 10, 140, 205, 247, 289], "prolifera": [0, 10, 140, 205, 247, 289], "jel478": [0, 10, 140, 205, 247, 289], "sar86": [0, 10, 140, 205, 247, 289], "sar86a": [0, 10, 140, 205, 247, 289], "sar86b": [0, 10, 140, 205, 247, 289], "magnetococcu": [0, 10, 140, 205, 247, 289], "jc4": [0, 10, 140, 205, 247, 289], "p179": [0, 10, 140, 205, 247, 289], "cinnabarinu": [0, 10, 140, 205, 247, 289], "ll": [0, 10, 140, 205, 247, 289, 323], "bosea": [0, 10, 140, 205, 247, 289], "117": [0, 10, 140, 205, 247, 289], "doa9": [0, 10, 140, 205, 247, 289], "beijingensi": [0, 10, 140, 205, 247, 289], "bss20135": [0, 10, 140, 205, 247, 289], "sg25": [0, 10, 140, 205, 247, 289], "marin": [0, 10, 140, 205, 247, 289], "thaumarchaeot": [0, 10, 140, 205, 247, 289], "629": [0, 10, 140, 205, 247, 289], "i23": [0, 10, 140, 205, 247, 289], "b18": [0, 10, 140, 205, 247, 289], "buddi": [0, 10, 140, 205, 247, 289], "pleomorpha": [0, 10, 140, 205, 247, 289], "grape": [0, 10, 140, 205, 247, 289], "88a": [0, 10, 140, 205, 247, 289], "35w": [0, 10, 140, 205, 247, 289], "37ma": [0, 10, 140, 205, 247, 289], "510": [0, 10, 140, 205, 247, 289], "melioribact": [0, 10, 140, 205, 247, 289], "p3m": [0, 10, 140, 205, 247, 289], "ligniniphilu": [0, 10, 140, 205, 247, 289], "e718": [0, 10, 140, 205, 247, 289], "cnt312": [0, 10, 140, 205, 247, 289], "cnh099": [0, 10, 140, 205, 247, 289], "cnq490": [0, 10, 140, 205, 247, 289], "xanthomarina": [0, 10, 140, 205, 247, 289], "gelatinilytica": [0, 10, 140, 205, 247, 289], "numazuensi": [0, 10, 140, 205, 247, 289], "arbusti": [0, 10, 140, 205, 247, 289], "sl206": [0, 10, 140, 205, 247, 289], "paraintracellular": [0, 10, 140, 205, 247, 289], "curiea": [0, 10, 140, 205, 247, 289], "pseudomassariella": [0, 10, 140, 205, 247, 289], "vexata": [0, 10, 140, 205, 247, 289], "homolaphlycti": [0, 10, 140, 205, 247, 289], "polyrhiza": [0, 10, 140, 205, 247, 289], "ap12": [0, 10, 140, 205, 247, 289], "ap49": [0, 10, 140, 205, 247, 289], "cf080": [0, 10, 140, 205, 247, 289], "cf122": [0, 10, 140, 205, 247, 289], "cf136": [0, 10, 140, 205, 247, 289], "cf444": [0, 10, 140, 205, 247, 289], "gm21": [0, 10, 140, 205, 247, 289], "yr522": [0, 10, 140, 205, 247, 289], "phyllobacterium": [0, 10, 140, 205, 247, 289], "yr531": [0, 10, 140, 205, 247, 289], "tritrichomona": [0, 10, 140, 205, 247, 289], "foetu": [0, 10, 140, 205, 247, 289], "101934": [0, 10, 140, 205, 247, 289], "101966": [0, 10, 140, 205, 247, 289], "102082": [0, 10, 140, 205, 247, 289], "102129": [0, 10, 140, 205, 247, 289], "102136": [0, 10, 140, 205, 247, 289], "102143": [0, 10, 140, 205, 247, 289], "102159": [0, 10, 140, 205, 247, 289], "102529": [0, 10, 140, 205, 247, 289], "102637": [0, 10, 140, 205, 247, 289], "a162": [0, 10, 140, 205, 247, 289], "varian": [0, 10, 140, 205, 247, 289], "dca": [0, 10, 140, 205, 247, 289], "ornithinibacillu": [0, 10, 140, 205, 247, 289], "scapharca": [0, 10, 140, 205, 247, 289], "tw25": [0, 10, 140, 205, 247, 289], "sy8": [0, 10, 140, 205, 247, 289], "dr1": [0, 10, 140, 205, 247, 289], "geminisphaera": [0, 10, 140, 205, 247, 289], "colitermitum": [0, 10, 140, 205, 247, 289], "tav2": [0, 10, 140, 205, 247, 289], "furukawaii": [0, 10, 140, 205, 247, 289], "9mfcol3": [0, 10, 140, 205, 247, 289], "161mfsha2": [0, 10, 140, 205, 247, 289], "162mfsha1": [0, 10, 140, 205, 247, 289], "292mf": [0, 10, 140, 205, 247, 289], "ertm2": [0, 10, 140, 205, 247, 289], "lappah": [0, 10, 140, 205, 247, 289], "mspmp": [0, 10, 140, 205, 247, 289], "m5": [0, 10, 140, 205, 247, 289], "moorea": [0, 10, 140, 205, 247, 289], "producen": [0, 10, 140, 205, 247, 289], "3l": [0, 10, 140, 205, 247, 289], "p16": [0, 10, 140, 205, 247, 289], "hmica12": [0, 10, 140, 205, 247, 289], "tumebacillu": [0, 10, 140, 205, 247, 289], "amel2xe9": [0, 10, 140, 205, 247, 289], "atexab": [0, 10, 140, 205, 247, 289], "d23": [0, 10, 140, 205, 247, 289], "bolea5": [0, 10, 140, 205, 247, 289], "pstaah": [0, 10, 140, 205, 247, 289], "124": [0, 10, 140, 205, 247, 289], "fxanac1": [0, 10, 140, 205, 247, 289], "cell2": [0, 10, 140, 205, 247, 289], "2812b": [0, 10, 140, 205, 247, 289], "135mfcol5": [0, 10, 140, 205, 247, 289], "aljt": [0, 10, 140, 205, 247, 289], "ald1": [0, 10, 140, 205, 247, 289], "almg11": [0, 10, 140, 205, 247, 289], "ale31": [0, 10, 140, 205, 247, 289], "fb": [0, 10, 140, 205, 247, 289], "tc5": [0, 10, 140, 205, 247, 289], "if05": [0, 10, 140, 205, 247, 289], "l8": [0, 10, 140, 205, 247, 289], "km09": [0, 10, 140, 205, 247, 289], "lau": [0, 10, 140, 205, 247, 289], "alj7": [0, 10, 140, 205, 247, 289], "alj11": [0, 10, 140, 205, 247, 289], "alj16": [0, 10, 140, 205, 247, 289], "c75": [0, 10, 140, 205, 247, 289], "ustilaginoidea": [0, 10, 140, 205, 247, 289], "bmg111209": [0, 10, 140, 205, 247, 289], "311": [0, 10, 140, 205, 247, 289], "bicirculan": [0, 10, 140, 205, 247, 289], "nasuia": [0, 10, 140, 205, 247, 289], "deltocephalinicola": [0, 10, 140, 205, 247, 289], "alf": [0, 10, 140, 205, 247, 289], "euryhalocauli": [0, 10, 140, 205, 247, 289], "caribicu": [0, 10, 140, 205, 247, 289], "acc21": [0, 10, 140, 205, 247, 289], "champanellensi": [0, 10, 140, 205, 247, 289], "18p13": [0, 10, 140, 205, 247, 289], "17042": [0, 10, 140, 205, 247, 289], "donghuensi": [0, 10, 140, 205, 247, 289], "condimenti": [0, 10, 140, 205, 247, 289], "richelia": [0, 10, 140, 205, 247, 289], "hh01": [0, 10, 140, 205, 247, 289], "imtechella": [0, 10, 140, 205, 247, 289], "r4": [0, 10, 140, 205, 247, 289], "368": [0, 10, 140, 205, 247, 289], "draconibacterium": [0, 10, 140, 205, 247, 289], "oriental": [0, 10, 140, 205, 247, 289], "xanthobacteracea": [0, 10, 140, 205, 247, 289], "501b": [0, 10, 140, 205, 247, 289], "mott36i": [0, 10, 140, 205, 247, 289], "h4y": [0, 10, 140, 205, 247, 289], "pratensi": [0, 10, 140, 205, 247, 289], "33331": [0, 10, 140, 205, 247, 289], "123mfchir2": [0, 10, 140, 205, 247, 289], "cny236": [0, 10, 140, 205, 247, 289], "cnt372": [0, 10, 140, 205, 247, 289], "cny243": [0, 10, 140, 205, 247, 289], "kte30": [0, 10, 140, 205, 247, 289], "kte114": [0, 10, 140, 205, 247, 289], "kte151": [0, 10, 140, 205, 247, 289], "kte11": [0, 10, 140, 205, 247, 289], "kte31": [0, 10, 140, 205, 247, 289], "kte32": [0, 10, 140, 205, 247, 289], "vitrella": [0, 10, 140, 205, 247, 289], "brassicaformi": [0, 10, 140, 205, 247, 289], "ccmp3155": [0, 10, 140, 205, 247, 289], "142mfcol3": [0, 10, 140, 205, 247, 289], "351mftsu5": [0, 10, 140, 205, 247, 289], "303mfcol5": [0, 10, 140, 205, 247, 289], "348mftsu5": [0, 10, 140, 205, 247, 289], "360mftsu5": [0, 10, 140, 205, 247, 289], "terracoccu": [0, 10, 140, 205, 247, 289], "273mftsu3": [0, 10, 140, 205, 247, 289], "oxytricha": [0, 10, 140, 205, 247, 289], "trifallax": [0, 10, 140, 205, 247, 289], "catenovulum": [0, 10, 140, 205, 247, 289], "9431": [0, 10, 140, 205, 247, 289], "9605": [0, 10, 140, 205, 247, 289], "geitlerinema": [0, 10, 140, 205, 247, 289], "7407": [0, 10, 140, 205, 247, 289], "7428": [0, 10, 140, 205, 247, 289], "7113": [0, 10, 140, 205, 247, 289], "10802": [0, 10, 140, 205, 247, 289], "chamaesiphon": [0, 10, 140, 205, 247, 289], "minutu": [0, 10, 140, 205, 247, 289], "6605": [0, 10, 140, 205, 247, 289], "7502": [0, 10, 140, 205, 247, 289], "6406": [0, 10, 140, 205, 247, 289], "sublineola": [0, 10, 140, 205, 247, 289], "9339": [0, 10, 140, 205, 247, 289], "gw103": [0, 10, 140, 205, 247, 289], "conradii": [0, 10, 140, 205, 247, 289], "hz254": [0, 10, 140, 205, 247, 289], "arvoryza": [0, 10, 140, 205, 247, 289], "mre50": [0, 10, 140, 205, 247, 289], "rhinitidi": [0, 10, 140, 205, 247, 289], "gotlandica": [0, 10, 140, 205, 247, 289], "gd1": [0, 10, 140, 205, 247, 289], "fabrum": [0, 10, 140, 205, 247, 289], "c58": [0, 10, 140, 205, 247, 289], "nanhaiticu": [0, 10, 140, 205, 247, 289], "c448": [0, 10, 140, 205, 247, 289], "medellinensi": [0, 10, 140, 205, 247, 289], "3288": [0, 10, 140, 205, 247, 289], "huangheensi": [0, 10, 140, 205, 247, 289], "zhangzhouensi": [0, 10, 140, 205, 247, 289], "arenitalea": [0, 10, 140, 205, 247, 289], "blepharu": [0, 10, 140, 205, 247, 289], "feriruminatori": [0, 10, 140, 205, 247, 289], "m47t1": [0, 10, 140, 205, 247, 289], "psammophila": [0, 10, 140, 205, 247, 289], "swuensi": [0, 10, 140, 205, 247, 289], "kte52": [0, 10, 140, 205, 247, 289], "kte92": [0, 10, 140, 205, 247, 289], "kte96": [0, 10, 140, 205, 247, 289], "kte159": [0, 10, 140, 205, 247, 289], "injenensi": [0, 10, 140, 205, 247, 289], "m09": [0, 10, 140, 205, 247, 289], "0166": [0, 10, 140, 205, 247, 289], "st04": [0, 10, 140, 205, 247, 289], "mesotoga": [0, 10, 140, 205, 247, 289], "prima": [0, 10, 140, 205, 247, 289], "mesg1": [0, 10, 140, 205, 247, 289], "dalianensi": [0, 10, 140, 205, 247, 289], "blaberu": [0, 10, 140, 205, 247, 289], "giganteu": [0, 10, 140, 205, 247, 289], "ph10": [0, 10, 140, 205, 247, 289], "123": [0, 10, 140, 205, 247, 289, 323], "lig30": [0, 10, 140, 205, 247, 289], "hokkaidonensi": [0, 10, 140, 205, 247, 289], "18461": [0, 10, 140, 205, 247, 289], "snodgrassella": [0, 10, 140, 205, 247, 289], "alvi": [0, 10, 140, 205, 247, 289], "gilliamella": [0, 10, 140, 205, 247, 289], "apicola": [0, 10, 140, 205, 247, 289], "maddinglei": [0, 10, 140, 205, 247, 289], "mbc34": [0, 10, 140, 205, 247, 289], "osi": [0, 10, 140, 205, 247, 289], "mangrovimona": [0, 10, 140, 205, 247, 289], "yunxiaonensi": [0, 10, 140, 205, 247, 289], "m2012083": [0, 10, 140, 205, 247, 289], "thermogladiu": [0, 10, 140, 205, 247, 289], "caldera": [0, 10, 140, 205, 247, 289], "1633": [0, 10, 140, 205, 247, 289], "rm50": [0, 10, 140, 205, 247, 289], "ruminobact": [0, 10, 140, 205, 247, 289], "rm87": [0, 10, 140, 205, 247, 289], "bacteriovorax": [0, 10, 140, 205, 247, 289], "seq25_v": [0, 10, 140, 205, 247, 289], "bal6_x": [0, 10, 140, 205, 247, 289], "f52": [0, 10, 140, 205, 247, 289], "18671": [0, 10, 140, 205, 247, 289], "salifodina": [0, 10, 140, 205, 247, 289], "achlya": [0, 10, 140, 205, 247, 289], "hypogyna": [0, 10, 140, 205, 247, 289], "179": [0, 10, 140, 205, 247, 289], "daltonii": [0, 10, 140, 205, 247, 289], "frc": [0, 10, 140, 205, 247, 289], "hpa0509": [0, 10, 140, 205, 247, 289], "hpa0247": [0, 10, 140, 205, 247, 289], "kpl1814": [0, 10, 140, 205, 247, 289], "kpl1817": [0, 10, 140, 205, 247, 289], "kpl1818": [0, 10, 140, 205, 247, 289], "kpl1821": [0, 10, 140, 205, 247, 289], "kpl1824": [0, 10, 140, 205, 247, 289], "kpl1855": [0, 10, 140, 205, 247, 289], "kpl1856": [0, 10, 140, 205, 247, 289], "kpl1857": [0, 10, 140, 205, 247, 289], "kpl1859": [0, 10, 140, 205, 247, 289], "kpl1860": [0, 10, 140, 205, 247, 289], "hfh0086": [0, 10, 140, 205, 247, 289], "hgh0353": [0, 10, 140, 205, 247, 289], "kpl1838": [0, 10, 140, 205, 247, 289], "kpl1844": [0, 10, 140, 205, 247, 289], "kpl1852": [0, 10, 140, 205, 247, 289], "hpb0071": [0, 10, 140, 205, 247, 289], "hph0090": [0, 10, 140, 205, 247, 289], "hph0547": [0, 10, 140, 205, 247, 289], "hpa0037": [0, 10, 140, 205, 247, 289], "kpl1986": [0, 10, 140, 205, 247, 289], "kpl1989": [0, 10, 140, 205, 247, 289], "kpl1995": [0, 10, 140, 205, 247, 289], "kpl1996": [0, 10, 140, 205, 247, 289], "kpl1998": [0, 10, 140, 205, 247, 289], "kpl2004": [0, 10, 140, 205, 247, 289], "kpl2005": [0, 10, 140, 205, 247, 289], "kpl2009": [0, 10, 140, 205, 247, 289], "cnr698": [0, 10, 140, 205, 247, 289], "mbes04": [0, 10, 140, 205, 247, 289], "lz4w": [0, 10, 140, 205, 247, 289], "gallaecimona": [0, 10, 140, 205, 247, 289], "c100": [0, 10, 140, 205, 247, 289], "uw4": [0, 10, 140, 205, 247, 289], "mx01": [0, 10, 140, 205, 247, 289], "orchidophilum": [0, 10, 140, 205, 247, 289], "aa0539": [0, 10, 140, 205, 247, 289], "gemmata": [0, 10, 140, 205, 247, 289], "massiliana": [0, 10, 140, 205, 247, 289], "gw2": [0, 10, 140, 205, 247, 289], "chelatococcu": [0, 10, 140, 205, 247, 289], "gw1": [0, 10, 140, 205, 247, 289], "tibetensi": [0, 10, 140, 205, 247, 289], "y620": [0, 10, 140, 205, 247, 289], "b14": [0, 10, 140, 205, 247, 289], "mx": [0, 10, 140, 205, 247, 289], "az02": [0, 10, 140, 205, 247, 289], "ampelina": [0, 10, 140, 205, 247, 289], "tengchongensi": [0, 10, 140, 205, 247, 289], "77401": [0, 10, 140, 205, 247, 289], "jilinensi": [0, 10, 140, 205, 247, 289], "y1": [0, 10, 140, 205, 247, 289], "bornimens": [0, 10, 140, 205, 247, 289], "542": [0, 10, 140, 205, 247, 289], "1847": [0, 10, 140, 205, 247, 289], "3623": [0, 10, 140, 205, 247, 289], "110321": [0, 10, 140, 205, 247, 289], "3880": [0, 10, 140, 205, 247, 289], "1867": [0, 10, 140, 205, 247, 289], "4105": [0, 10, 140, 205, 247, 289], "284": [0, 10, 140, 205, 247, 289], "3862": [0, 10, 140, 205, 247, 289], "2168": [0, 10, 140, 166, 205, 247, 289], "3929": [0, 10, 140, 205, 247, 289], "2100": [0, 10, 140, 205, 247, 289], "713": [0, 10, 140, 205, 247, 289], "236": [0, 10, 140, 205, 247, 289], "758": [0, 10, 140, 205, 247, 289], "3789": [0, 10, 140, 205, 247, 289], "bis7": [0, 10, 140, 205, 247, 289], "xylona": [0, 10, 140, 205, 247, 289], "hevea": [0, 10, 140, 205, 247, 289], "tc161": [0, 10, 140, 205, 247, 289], "307": [0, 10, 140, 166, 205, 247, 289], "gba": [0, 10, 140, 205, 247, 289], "bo1": [0, 10, 140, 205, 247, 289], "mellif": [0, 10, 140, 205, 247, 289], "kullabergensi": [0, 10, 140, 205, 247, 289], "helsingborgensi": [0, 10, 140, 205, 247, 289], "kimbladii": [0, 10, 140, 205, 247, 289], "melliventri": [0, 10, 140, 205, 247, 289], "melli": [0, 10, 140, 205, 247, 289], "nectari": [0, 10, 140, 205, 247, 289], "110549": [0, 10, 140, 205, 247, 289], "s3pf19": [0, 10, 140, 205, 247, 289], "mv1": [0, 10, 140, 205, 247, 289], "altibact": [0, 10, 140, 205, 247, 289], "humireducen": [0, 10, 140, 205, 247, 289], "106098": [0, 10, 140, 205, 247, 289], "45392": [0, 10, 140, 205, 247, 289], "lsjc7": [0, 10, 140, 205, 247, 289], "mangrovibact": [0, 10, 140, 205, 247, 289], "mfb070": [0, 10, 140, 205, 247, 289], "dw": [0, 10, 140, 205, 247, 289], "0440": [0, 10, 140, 205, 247, 289], "1745": [0, 10, 140, 205, 247, 289], "1732": [0, 10, 140, 205, 247, 289], "1755": [0, 10, 140, 205, 247, 289], "rapamycinicu": [0, 10, 140, 205, 247, 289], "877": [0, 10, 140, 205, 247, 289], "f0543": [0, 10, 140, 205, 247, 289], "863": [0, 10, 140, 205, 247, 289], "f0517": [0, 10, 140, 205, 247, 289], "879": [0, 10, 140, 205, 247, 289], "f0557": [0, 10, 140, 205, 247, 289], "f0091": [0, 10, 140, 205, 247, 289], "689": [0, 10, 140, 205, 247, 289], "r7": [0, 10, 140, 205, 247, 289], "277": [0, 10, 140, 205, 247, 289], "kiost": [0, 10, 140, 205, 247, 289], "wg21": [0, 10, 140, 205, 247, 289], "ga3": [0, 10, 140, 205, 247, 289], "alkalibacterium": [0, 10, 140, 205, 247, 289], "ak22": [0, 10, 140, 205, 247, 289], "salimicrobium": [0, 10, 140, 205, 247, 289], "dfci": [0, 10, 140, 205, 247, 289], "flaviramulu": [0, 10, 140, 205, 247, 289], "ichthyoenteri": [0, 10, 140, 205, 247, 289], "th78": [0, 10, 140, 205, 247, 289], "6924": [0, 10, 140, 205, 247, 289], "mirantina": [0, 10, 140, 205, 247, 289], "tg": [0, 10, 140, 205, 247, 289], "pht": [0, 10, 140, 205, 247, 289], "mc24": [0, 10, 140, 205, 247, 289], "shenzhenensi": [0, 10, 140, 205, 247, 289], "clohesyomyc": [0, 10, 140, 205, 247, 289], "desulfuromona": [0, 10, 140, 205, 247, 289], "tf": [0, 10, 140, 205, 247, 289], "ihumii": [0, 10, 140, 205, 247, 289], "nosocomiicoccu": [0, 10, 140, 205, 247, 289], "enorma": [0, 10, 140, 205, 247, 289], "ve202": [0, 10, 140, 205, 247, 289], "ak27": [0, 10, 140, 205, 247, 289], "ghh01": [0, 10, 140, 205, 247, 289], "jm1": [0, 10, 140, 205, 247, 289], "fh1": [0, 10, 140, 205, 247, 289], "e463": [0, 10, 140, 205, 247, 289], "pacificimona": [0, 10, 140, 205, 247, 289], "gayadomona": [0, 10, 140, 205, 247, 289], "joobinieg": [0, 10, 140, 205, 247, 289], "g7": [0, 10, 140, 205, 247, 289], "au12": [0, 10, 140, 205, 247, 289], "md335": [0, 10, 140, 205, 247, 289], "firmicut": [0, 10, 140, 205, 247, 289], "m10": [0, 10, 140, 205, 247, 289], "md308": [0, 10, 140, 205, 247, 289], "asf519": [0, 10, 140, 205, 247, 289], "g3": [0, 10, 140, 205, 247, 289], "2012": [0, 5, 9, 10, 140, 165, 205, 247, 289], "carbekii": [0, 10, 140, 205, 247, 289], "j07hqx50": [0, 10, 140, 205, 247, 289], "j07hn6": [0, 10, 140, 205, 247, 289], "j07hr59": [0, 10, 140, 205, 247, 289], "praecaptivu": [0, 10, 140, 205, 247, 289], "pro95": [0, 10, 140, 205, 247, 289], "massiliogorilla": [0, 10, 140, 205, 247, 289], "huabeiensi": [0, 10, 140, 205, 247, 289], "hb2": [0, 10, 140, 205, 247, 289], "iguaniorum": [0, 10, 140, 205, 247, 289], "caucaseum": [0, 10, 140, 205, 247, 289], "mariniradiu": [0, 10, 140, 205, 247, 289], "ak6": [0, 10, 140, 205, 247, 289], "lanzarotensi": [0, 10, 140, 205, 247, 289], "chilensi": [0, 10, 140, 205, 247, 289], "45234": [0, 10, 140, 205, 247, 289], "2mfcol3": [0, 10, 140, 205, 247, 289], "bab": [0, 10, 140, 205, 247, 289], "paramicrosporidium": [0, 10, 140, 205, 247, 289], "saccamoeba": [0, 10, 140, 205, 247, 289], "arsenophonu": [0, 10, 140, 205, 247, 289], "hangzhou": [0, 10, 140, 205, 247, 289], "nilaparvata": [0, 10, 140, 205, 247, 289], "lugen": [0, 10, 140, 205, 247, 289], "tdu": [0, 10, 140, 205, 247, 289], "blastomona": [0, 10, 140, 205, 247, 289], "aap53": [0, 10, 140, 205, 247, 289], "aap62": [0, 10, 140, 205, 247, 289], "aap82": [0, 10, 140, 205, 247, 289], "rifrc": [0, 10, 140, 205, 247, 289], "imhoffiella": [0, 10, 140, 205, 247, 289], "hel_i_29": [0, 10, 140, 205, 247, 289], "hel_i_7": [0, 10, 140, 205, 247, 289], "hel1_85": [0, 10, 140, 205, 247, 289], "hel_i_88": [0, 10, 140, 205, 247, 289], "mar_2010_75": [0, 10, 140, 205, 247, 289], "salegentibact": [0, 10, 140, 205, 247, 289], "hel_i_6": [0, 10, 140, 205, 247, 289], "fgi182": [0, 10, 140, 205, 247, 289], "iv": [0, 10, 140, 205, 247, 289], "uba": [0, 10, 140, 205, 247, 289], "769": [0, 10, 140, 205, 247, 289], "cag": [0, 10, 140, 205, 247, 289], "207": [0, 10, 140, 205, 247, 289], "piscicida": [0, 10, 140, 205, 247, 289], "c07": [0, 10, 140, 205, 247, 289], "087": [0, 10, 140, 205, 247, 289], "endolissoclinum": [0, 10, 140, 205, 247, 289], "faulkneri": [0, 10, 140, 205, 247, 289], "urmo17wk12": [0, 10, 140, 205, 247, 289], "i8": [0, 10, 140, 205, 247, 289], "26508": [0, 10, 140, 205, 247, 289], "nafulsella": [0, 10, 140, 205, 247, 289], "turpanensi": [0, 10, 140, 205, 247, 289], "zlm": [0, 10, 140, 205, 247, 289], "manganicu": [0, 10, 140, 205, 247, 289], "26584": [0, 10, 140, 205, 247, 289], "ale6": [0, 10, 140, 205, 247, 289], "ale19": [0, 10, 140, 205, 247, 289], "akl19": [0, 10, 140, 205, 247, 289], "frischella": [0, 10, 140, 205, 247, 289], "perrara": [0, 10, 140, 205, 247, 289], "sediminibacterium": [0, 10, 140, 205, 247, 289], "c3": [0, 10, 140, 205, 247, 289], "89": [0, 10, 140, 205, 247, 289, 324, 325], "imh": [0, 10, 140, 205, 247, 289], "g5": [0, 10, 140, 205, 247, 289], "jc401": [0, 10, 140, 205, 247, 289], "aw25m09": [0, 10, 140, 205, 247, 289], "s7": [0, 10, 140, 205, 247, 289], "alr17": [0, 10, 140, 205, 247, 289], "kjj": [0, 10, 140, 205, 247, 289], "r20": [0, 10, 140, 205, 247, 289], "nm10": [0, 10, 140, 205, 247, 289], "1817d": [0, 10, 140, 205, 247, 289], "antibioticophila": [0, 10, 140, 205, 247, 289], "hepatobact": [0, 10, 140, 205, 247, 289], "penaei": [0, 10, 140, 205, 247, 289], "jhl": [0, 10, 140, 205, 247, 289], "kte172": [0, 10, 140, 205, 247, 289], "alvinia": [0, 10, 140, 205, 247, 289], "ep5": [0, 10, 140, 205, 247, 289], "gorillibacterium": [0, 10, 140, 205, 247, 289], "ae2015": [0, 10, 140, 205, 247, 289], "vcd2006": [0, 10, 140, 205, 247, 289], "ae3009": [0, 10, 140, 205, 247, 289], "xpd2006": [0, 10, 140, 205, 247, 289], "fc2001": [0, 10, 140, 205, 247, 289], "ae3006": [0, 10, 140, 205, 247, 289], "agr2160": [0, 10, 140, 205, 247, 289], "wcd3002": [0, 10, 140, 205, 247, 289], "vcb2006": [0, 10, 140, 205, 247, 289], "lc3010": [0, 10, 140, 205, 247, 289], "wcd2001": [0, 10, 140, 205, 247, 289], "xbb1001": [0, 10, 140, 205, 247, 289], "nc3005": [0, 10, 140, 205, 247, 289], "mc2013": [0, 10, 140, 205, 247, 289], "meira": [0, 10, 140, 205, 247, 289], "miltonrushii": [0, 10, 140, 205, 247, 289], "cy54": [0, 10, 140, 205, 247, 289], "beringensi": [0, 10, 140, 205, 247, 289], "chukchiensi": [0, 10, 140, 205, 247, 289], "ac460": [0, 10, 140, 205, 247, 289], "ac402": [0, 10, 140, 205, 247, 289], "ac466": [0, 10, 140, 205, 247, 289], "iso899": [0, 10, 140, 205, 247, 289], "lignilytica": [0, 10, 140, 205, 247, 289], "iso805n": [0, 10, 140, 205, 247, 289], "a9": [0, 10, 140, 205, 247, 289], "planktomarina": [0, 10, 140, 205, 247, 289], "temperata": [0, 10, 140, 205, 247, 289], "rca23": [0, 10, 140, 205, 247, 289], "spd3": [0, 10, 140, 205, 247, 289], "tissierellia": [0, 10, 140, 205, 247, 289], "sd6": [0, 10, 140, 205, 247, 289], "hampsonii": [0, 10, 140, 205, 247, 289], "30446": [0, 10, 140, 205, 247, 289], "l2c084a000": [0, 10, 140, 205, 247, 289], "lnjc398b00": [0, 10, 140, 205, 247, 289], "massiliosenegalensi": [0, 10, 140, 205, 247, 289], "jc6": [0, 10, 140, 205, 247, 289], "insuavi": [0, 10, 140, 205, 247, 289], "axx": [0, 10, 140, 205, 247, 289], "arcticibact": [0, 10, 140, 205, 247, 289], "svalbardensi": [0, 10, 140, 205, 247, 289], "mn12": [0, 10, 140, 205, 247, 289], "cnt318": [0, 10, 140, 205, 247, 289], "taa040": [0, 10, 140, 205, 247, 289], "jc48": [0, 10, 140, 205, 247, 289], "jc50": [0, 10, 140, 205, 247, 289], "23838": [0, 10, 140, 205, 247, 289], "magnetospira": [0, 10, 140, 205, 247, 289], "qh": [0, 10, 140, 205, 247, 289], "taa204": [0, 10, 140, 205, 247, 289], "methanomethylophilu": [0, 10, 140, 205, 247, 289], "alvu": [0, 10, 140, 205, 247, 289], "mx1201": [0, 10, 140, 205, 247, 289], "thp": [0, 10, 140, 205, 247, 289], "otcp": [0, 10, 140, 205, 247, 289], "thu": [0, 10, 140, 205, 247, 289], "djelfimassiliensi": [0, 10, 140, 205, 247, 289], "goleimassiliensi": [0, 10, 140, 205, 247, 289], "13867": [0, 10, 140, 205, 247, 289], "gaetbulicola": [0, 10, 140, 205, 247, 289], "gung47": [0, 10, 140, 205, 247, 289], "geofonti": [0, 10, 140, 205, 247, 289], "opf15": [0, 10, 140, 205, 247, 289], "4661": [0, 10, 140, 205, 247, 289], "intestinimona": [0, 10, 140, 205, 247, 289], "butyriciproducen": [0, 10, 140, 205, 247, 289], "hansupu": [0, 10, 140, 205, 247, 289], "ohsu_i": [0, 10, 140, 205, 247, 289], "c4": [0, 10, 140, 205, 247, 289], "ohsu_iii": [0, 10, 140, 205, 247, 289], "18900": [0, 10, 140, 205, 247, 289], "urha0056": [0, 10, 140, 205, 247, 289], "urha0036": [0, 10, 140, 205, 247, 289], "urhb0036": [0, 10, 140, 205, 247, 289], "urhd0025": [0, 10, 140, 205, 247, 289], "alt199": [0, 10, 140, 205, 247, 289], "urha0002": [0, 10, 140, 205, 247, 289], "taa486": [0, 10, 140, 205, 247, 289], "bathoardescen": [0, 10, 140, 205, 247, 289], "caldisalinibact": [0, 10, 140, 205, 247, 289], "kiritimatiensi": [0, 10, 140, 205, 247, 289], "krmcy2": [0, 10, 140, 205, 247, 289], "asbs410": [0, 10, 140, 205, 247, 289], "geovibrio": [0, 10, 140, 205, 247, 289], "l21": [0, 10, 140, 205, 247, 289], "BES": [0, 10, 140, 205, 247, 289], "krocy2": [0, 10, 140, 205, 247, 289], "d15": [0, 10, 140, 205, 247, 289], "8w": [0, 10, 140, 205, 247, 289], "eur3": [0, 10, 140, 205, 247, 289], "w11": [0, 10, 140, 205, 247, 289], "termitomyc": [0, 10, 140, 205, 247, 289], "j132": [0, 10, 140, 205, 247, 289], "hokutonensi": [0, 10, 140, 205, 247, 289], "desulfohalovibrio": [0, 10, 140, 205, 247, 289], "reitneri": [0, 10, 140, 205, 247, 289], "salinispira": [0, 10, 140, 205, 247, 289], "br18": [0, 10, 140, 205, 247, 289], "h14": [0, 10, 140, 205, 247, 289], "gb": [0, 9, 10, 140, 205, 247, 289], "aureispira": [0, 10, 140, 205, 247, 289], "ccb": [0, 10, 140, 205, 247, 289], "qb1": [0, 10, 140, 205, 247, 289], "peniophora": [0, 10, 140, 205, 247, 289], "cont": [0, 10, 140, 205, 247, 289], "perkinsela": [0, 10, 140, 205, 247, 289], "ccap": [0, 10, 140, 205, 247, 289], "1560": [0, 10, 140, 205, 247, 289], "hsism1": [0, 10, 140, 205, 247, 289], "hsisb1": [0, 10, 140, 205, 247, 289], "hsiss1": [0, 10, 140, 205, 247, 289], "hsiss2": [0, 10, 140, 205, 247, 289], "hsiss3": [0, 10, 140, 205, 247, 289], "hsieg1": [0, 10, 140, 205, 247, 289], "nauphoeta": [0, 10, 140, 205, 247, 289], "sulfaticallidu": [0, 10, 140, 205, 247, 289], "pm70": [0, 10, 140, 205, 247, 289], "girerdii": [0, 10, 140, 205, 247, 289], "nbimc_p2": [0, 10, 140, 205, 247, 289], "876": [0, 10, 140, 205, 247, 289], "f0540": [0, 10, 140, 205, 247, 289], "131": [0, 10, 140, 167, 205, 247, 289], "w9106": [0, 10, 140, 205, 247, 289], "peptostreptococcacea": [0, 10, 140, 205, 247, 289], "w5053": [0, 10, 140, 205, 247, 289], "892": [0, 10, 140, 205, 247, 289], "f0426": [0, 10, 140, 205, 247, 289], "tkk": [0, 10, 140, 205, 247, 289], "0059": [0, 10, 140, 205, 247, 289], "fs14": [0, 10, 140, 205, 247, 289], "thermoactinomyc": [0, 10, 140, 205, 247, 289], "daqu": [0, 10, 140, 205, 247, 289], "38": [0, 10, 140, 205, 247, 289], "bwh": [0, 10, 140, 205, 247, 289], "bidmc": [0, 10, 140, 205, 247, 289], "lindaniclasticum": [0, 10, 140, 205, 247, 289], "le124": [0, 10, 140, 205, 247, 289], "zancl": [0, 10, 140, 205, 247, 289], "caliditerra": [0, 10, 140, 205, 247, 289], "subglabra": [0, 10, 140, 205, 247, 289], "tfb": [0, 10, 140, 205, 247, 289], "10046": [0, 10, 140, 205, 247, 289], "ss5": [0, 10, 140, 205, 247, 289], "baderi": [0, 10, 140, 205, 247, 289], "ll03": [0, 10, 140, 205, 247, 289], "saccharimona": [0, 10, 140, 205, 247, 289], "aalborgensi": [0, 10, 140, 205, 247, 289], "salinarchaeum": [0, 10, 140, 205, 247, 289], "harcht": [0, 10, 140, 205, 247, 289], "bsk1": [0, 10, 140, 205, 247, 289], "moukalabens": [0, 10, 140, 205, 247, 289], "27321": [0, 10, 140, 205, 247, 289], "tepidicauli": [0, 10, 140, 205, 247, 289], "spiribact": [0, 10, 140, 205, 247, 289], "salinu": [0, 10, 140, 205, 247, 289], "m19": [0, 10, 140, 205, 247, 289], "bisphenolivoran": [0, 10, 140, 205, 247, 289], "hel1_33_49": [0, 10, 140, 205, 247, 289], "unc438cl73tsus30": [0, 10, 140, 205, 247, 289], "luminiphilu": [0, 10, 140, 205, 247, 289], "syltensi": [0, 10, 140, 205, 247, 289], "nor5": [0, 10, 140, 205, 247, 289], "1b": [0, 10, 140, 205, 247, 289], "enshiens": [0, 10, 140, 205, 247, 289], "dk69": [0, 10, 140, 205, 247, 289], "5288": [0, 10, 140, 205, 247, 289], "geojensi": [0, 10, 140, 205, 247, 289], "noctilucicola": [0, 10, 140, 205, 247, 289], "noctiluca": [0, 10, 140, 205, 247, 289], "am169": [0, 10, 140, 205, 247, 289], "molli": [0, 10, 140, 205, 247, 289], "a3h3": [0, 10, 140, 205, 247, 289], "eb01": [0, 10, 140, 205, 247, 289], "paucisalibacillu": [0, 10, 140, 205, 247, 289], "eb02": [0, 10, 140, 205, 247, 289], "ndiopicu": [0, 10, 140, 205, 247, 289], "dielmoensi": [0, 10, 140, 205, 247, 289], "anaerosalibact": [0, 10, 140, 205, 247, 289], "neonati": [0, 10, 140, 205, 247, 289], "piratica": [0, 10, 140, 205, 247, 289], "yn10": [0, 10, 140, 205, 247, 289], "qasimii": [0, 10, 140, 205, 247, 289], "m12": [0, 10, 140, 205, 247, 289], "utex": [0, 10, 140, 205, 247, 289], "2973": [0, 10, 140, 205, 247, 289], "bsw11_iv": [0, 10, 140, 205, 247, 289], "mikwangii": [0, 10, 140, 205, 247, 289], "mctg156": [0, 10, 140, 205, 247, 289], "af1028": [0, 10, 140, 205, 247, 289], "lanthieri": [0, 10, 140, 205, 247, 289], "pml026": [0, 10, 140, 205, 247, 289], "apr13": [0, 10, 140, 205, 247, 289], "salamandrivoran": [0, 10, 140, 205, 247, 289], "lutibaculum": [0, 10, 140, 205, 247, 289], "baratangens": [0, 10, 140, 205, 247, 289], "amv1": [0, 10, 140, 205, 247, 289], "adornatum": [0, 10, 140, 205, 247, 289], "parabailii": [0, 10, 140, 205, 247, 289], "himb11": [0, 10, 140, 205, 247, 289], "um_wgj": [0, 10, 140, 205, 247, 289], "um_wwi": [0, 10, 140, 205, 247, 289], "asf500": [0, 10, 140, 205, 247, 289], "jiangningensi": [0, 10, 140, 205, 247, 289], "desulfonauticu": [0, 10, 140, 205, 247, 289], "a7a": [0, 10, 140, 205, 247, 289], "fukuswis1": [0, 10, 140, 205, 247, 289], "mb1": [0, 10, 140, 205, 247, 289], "urha0041": [0, 10, 140, 205, 247, 289], "geodermatophilacea": [0, 10, 140, 205, 247, 289], "urhb0048": [0, 10, 140, 205, 247, 289], "urhc0008": [0, 10, 140, 205, 247, 289], "urhe0023": [0, 10, 140, 205, 247, 289], "urhd0069": [0, 10, 140, 205, 247, 289], "urhd0036": [0, 10, 140, 205, 247, 289], "23_gom": [0, 10, 140, 205, 247, 289], "1509m": [0, 10, 140, 205, 247, 289], "20_gpm": [0, 10, 140, 205, 247, 289], "intrasporangiacea": [0, 10, 140, 205, 247, 289], "urhb0013": [0, 10, 140, 205, 247, 289], "13_gom": [0, 10, 140, 205, 247, 289], "1096m": [0, 10, 140, 205, 247, 289], "47a_gom": [0, 10, 140, 205, 247, 289], "205m": [0, 10, 140, 205, 247, 289], "urhb0044": [0, 10, 140, 205, 247, 289], "43b_gom": [0, 10, 140, 205, 247, 289], "46m": [0, 10, 140, 205, 247, 289], "solirubrobacteral": [0, 10, 140, 205, 247, 289], "urhd0059": [0, 10, 140, 205, 247, 289], "dongia": [0, 10, 140, 205, 247, 289], "urhe0060": [0, 10, 140, 205, 247, 289], "urha0031": [0, 10, 140, 205, 247, 289], "rhodospirillal": [0, 10, 140, 205, 247, 289], "urhd0088": [0, 10, 140, 205, 247, 289], "darwinianu": [0, 10, 140, 205, 247, 289], "streptomycetacea": [0, 10, 140, 205, 247, 289], "mp113": [0, 10, 140, 205, 247, 289], "aliihoeflea": [0, 10, 140, 205, 247, 289], "2ww": [0, 10, 140, 205, 247, 289], "vcm10": [0, 10, 140, 205, 247, 289], "caulobacteracea": [0, 10, 140, 205, 247, 289], "pmmr1": [0, 10, 140, 205, 247, 289], "d27": [0, 10, 140, 205, 247, 289], "thermogemmatispora": [0, 10, 140, 205, 247, 289], "thermorudi": [0, 10, 140, 205, 247, 289], "pelea": [0, 10, 140, 205, 247, 289], "ailaaui": [0, 10, 140, 205, 247, 289], "methyloceanibact": [0, 10, 140, 205, 247, 289], "caenitepidi": [0, 10, 140, 205, 247, 289], "w12": [0, 10, 140, 205, 247, 289], "1067": [0, 10, 140, 205, 247, 289], "arseniciresisten": [0, 10, 140, 205, 247, 289], "zs79": [0, 10, 140, 205, 247, 289], "dg25b": [0, 10, 140, 205, 247, 289], "heron": [0, 10, 140, 205, 247, 289], "island": [0, 10, 140, 205, 247, 289], "chiriqhucha": [0, 10, 140, 205, 247, 289], "rw": [0, 10, 140, 205, 247, 289], "her1398": [0, 10, 140, 205, 247, 289], "oh31": [0, 10, 140, 205, 247, 289], "m0480": [0, 10, 140, 205, 247, 289], "ty": [0, 10, 140, 205, 247, 289], "3808": [0, 10, 140, 205, 247, 289], "kalmanozyma": [0, 10, 140, 205, 247, 289], "hun102": [0, 10, 140, 205, 247, 289], "ab3007": [0, 10, 140, 205, 247, 289], "flavimarina": [0, 10, 140, 205, 247, 289], "hel_i_48": [0, 10, 140, 205, 247, 289], "mar_2009_132": [0, 10, 140, 205, 247, 289], "sediminibact": [0, 10, 140, 205, 247, 289], "hel_i_10": [0, 10, 140, 205, 247, 289], "ae2021": [0, 10, 140, 205, 247, 289], "ac2031": [0, 10, 140, 205, 247, 289], "7101": [0, 10, 140, 205, 247, 289], "a11": [0, 10, 140, 205, 247, 289], "saccharibacteria": [0, 10, 140, 205, 247, 289], "raac3_tm7_1": [0, 10, 140, 205, 247, 289], "nk55a": [0, 10, 140, 205, 247, 289], "maepy2": [0, 10, 140, 205, 247, 289], "haloferula": [0, 10, 140, 205, 247, 289], "bvorr071": [0, 10, 140, 205, 247, 289], "bvorr034": [0, 10, 140, 205, 247, 289], "ph1c": [0, 10, 140, 205, 247, 289], "h1n": [0, 10, 140, 205, 247, 289], "p2s70": [0, 10, 140, 205, 247, 289], "pbn3": [0, 10, 140, 205, 247, 289], "micropelago": [0, 10, 140, 205, 247, 289], "thuwalensi": [0, 10, 140, 205, 247, 289], "mh3": [0, 10, 140, 205, 247, 289], "bacteroidal": [0, 10, 140, 205, 247, 289], "limnosedimini": [0, 10, 140, 205, 247, 289], "jc2902": [0, 10, 140, 205, 247, 289], "pseudonitzschia": [0, 10, 140, 205, 247, 289], "bvorr106": [0, 10, 140, 205, 247, 289], "glyciniphilum": [0, 10, 140, 205, 247, 289], "3170": [0, 10, 140, 205, 247, 289], "methanomassiliicoccu": [0, 10, 140, 205, 247, 289], "issoir": [0, 10, 140, 205, 247, 289], "mx1": [0, 10, 140, 205, 247, 289], "nkbg15041c": [0, 10, 140, 205, 247, 289], "betaproteobacteria": [0, 10, 140, 205, 247, 289], "mola814": [0, 10, 140, 205, 247, 289], "mb2021": [0, 10, 140, 205, 247, 289], "fcs014": [0, 10, 140, 205, 247, 289], "mc2021": [0, 10, 140, 205, 247, 289], "ma2016": [0, 10, 140, 205, 247, 289], "fc2011": [0, 10, 140, 205, 247, 289], "lb2011": [0, 10, 140, 205, 247, 289], "ac2028": [0, 10, 140, 205, 247, 289], "ac3007": [0, 10, 140, 205, 247, 289], "ma2020": [0, 10, 140, 205, 247, 289], "mc2017": [0, 10, 140, 205, 247, 289], "youngiibact": [0, 10, 140, 205, 247, 289], "232": [0, 10, 140, 167, 205, 247, 289], "tachikawaea": [0, 10, 140, 205, 247, 289], "gelatinosa": [0, 10, 140, 205, 247, 289], "nitrosopelagicu": [0, 10, 140, 205, 247, 289], "ga6a2": [0, 10, 140, 205, 247, 289], "c6a8": [0, 10, 140, 205, 247, 289], "p6a1": [0, 10, 140, 205, 247, 289], "p6b1": [0, 10, 140, 205, 247, 289], "md2005": [0, 10, 140, 205, 247, 289], "fc2018": [0, 10, 140, 205, 247, 289], "nd2010": [0, 10, 140, 205, 247, 289], "dd3": [0, 10, 140, 205, 247, 289], "shinella": [0, 10, 140, 205, 247, 289], "dd12": [0, 10, 140, 205, 247, 289], "c6a11": [0, 10, 140, 205, 247, 289], "fe2018": [0, 10, 140, 205, 247, 289], "md2004": [0, 10, 140, 205, 247, 289], "nc2004": [0, 10, 140, 205, 247, 289], "nd2006": [0, 10, 140, 205, 247, 289], "p6a3": [0, 10, 140, 205, 247, 289], "p6b14": [0, 10, 140, 205, 247, 289], "v9d3004": [0, 10, 140, 205, 247, 289], "ysb2008": [0, 10, 140, 205, 247, 289], "propionibacteriacea": [0, 10, 140, 205, 247, 289], "p6a17": [0, 10, 140, 205, 247, 289], "ab4001": [0, 10, 140, 205, 247, 289], "methyloglobulu": [0, 10, 140, 205, 247, 289], "morosu": [0, 10, 140, 205, 247, 289], "kom1": [0, 10, 140, 205, 247, 289], "rhizobial": [0, 10, 140, 205, 247, 289], "77505": [0, 10, 140, 205, 247, 289], "gammaproteobacteria": [0, 10, 140, 205, 247, 289], "mola455": [0, 10, 140, 205, 247, 289], "jeddahens": [0, 10, 140, 205, 247, 289], "saudiens": [0, 10, 140, 205, 247, 289], "tkp": [0, 10, 140, 205, 247, 289], "walczuchella": [0, 10, 140, 205, 247, 289], "monophlebidarum": [0, 10, 140, 205, 247, 289], "mctg268": [0, 10, 140, 205, 247, 289], "tg39a": [0, 10, 140, 205, 247, 289], "kilaueensi": [0, 10, 140, 205, 247, 289], "js1": [0, 10, 140, 205, 247, 289], "defluviimona": [0, 10, 140, 205, 247, 289], "20v17": [0, 10, 140, 205, 247, 289], "vt": [0, 10, 140, 205, 247, 289], "162": [0, 10, 140, 205, 247, 289], "3775": [0, 10, 140, 205, 247, 289], "4246": [0, 10, 140, 205, 247, 289], "4281": [0, 10, 140, 205, 247, 289], "fw": [0, 10, 140, 205, 247, 289], "2241": [0, 10, 140, 165, 166, 168, 205, 247, 289], "4513": [0, 10, 140, 205, 247, 289], "928": [0, 10, 140, 205, 247, 289], "4514": [0, 10, 140, 205, 247, 289], "929": [0, 10, 140, 205, 247, 289], "4515": [0, 10, 140, 205, 247, 289], "2607": [0, 10, 140, 205, 247, 289], "4516": [0, 10, 140, 205, 247, 289], "969": [0, 10, 140, 205, 247, 289], "4517": [0, 10, 140, 205, 247, 289], "2822": [0, 10, 140, 205, 247, 289], "4518": [0, 10, 140, 205, 247, 289], "2643": [0, 10, 140, 205, 247, 289], "4519": [0, 10, 140, 205, 247, 289], "2642": [0, 10, 140, 205, 247, 289], "4520": [0, 10, 140, 205, 247, 289], "2644": [0, 10, 140, 205, 247, 289], "salariu": [0, 10, 140, 205, 247, 289], "lam0618": [0, 10, 140, 205, 247, 289], "nitrativoran": [0, 10, 140, 205, 247, 289], "nl23": [0, 10, 140, 205, 247, 289], "entotheonella": [0, 10, 140, 205, 247, 289], "gemina": [0, 10, 140, 205, 247, 289], "p52": [0, 10, 140, 205, 247, 289], "icigianu": [0, 10, 140, 205, 247, 289], "halobonum": [0, 10, 140, 205, 247, 289], "tyrrellensi": [0, 10, 140, 205, 247, 289], "1261": [0, 9, 10, 140, 205, 247, 289], "mucinivoran": [0, 10, 140, 205, 247, 289], "hirudini": [0, 10, 140, 205, 247, 289], "kolkse": [0, 10, 140, 205, 247, 289], "mtp4": [0, 10, 140, 205, 247, 289], "wh1": [0, 10, 140, 205, 247, 289], "wwm596": [0, 10, 140, 205, 247, 289], "bohemicu": [0, 10, 140, 205, 247, 289], "3994": [0, 10, 140, 205, 247, 289], "97co": [0, 10, 140, 205, 247, 289], "symbiobact": [0, 10, 140, 205, 247, 289], "cr": [0, 10, 140, 205, 247, 289], "3557": [0, 10, 140, 205, 247, 289], "55": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "bay1663": [0, 10, 140, 205, 247, 289], "atroroseu": [0, 10, 140, 205, 247, 289], "k25": [0, 10, 140, 205, 247, 289], "xh134": [0, 10, 140, 205, 247, 289], "rubidu": [0, 10, 140, 205, 247, 289], "gynuella": [0, 10, 140, 205, 247, 289], "sunshinyii": [0, 10, 140, 205, 247, 289], "yc6258": [0, 10, 140, 205, 247, 289], "sciscionella": [0, 10, 140, 205, 247, 289], "se31": [0, 10, 140, 205, 247, 289], "dy53": [0, 10, 140, 205, 247, 289], "pc3": [0, 10, 140, 205, 247, 289], "corcagiensi": [0, 10, 140, 205, 247, 289], "halobellu": [0, 10, 140, 205, 247, 289], "unc362mftsu5": [0, 10, 140, 205, 247, 289], "unc280mftsu5": [0, 10, 140, 205, 247, 289], "unc358mftsu5": [0, 10, 140, 205, 247, 289], "knhs205": [0, 10, 140, 205, 247, 289], "unccl10": [0, 10, 140, 205, 247, 289], "unc451mf": [0, 10, 140, 205, 247, 289], "unc302mfcol5": [0, 10, 140, 205, 247, 289], "unc23mfcrub1": [0, 10, 140, 205, 247, 289], "unc363mftsu5": [0, 10, 140, 205, 247, 289], "unc305mfcol5": [0, 10, 140, 205, 247, 289], "k32": [0, 10, 140, 205, 247, 289], "k20": [0, 10, 140, 205, 247, 289], "hispalens": [0, 10, 140, 205, 247, 289], "25574": [0, 10, 140, 205, 247, 289], "hz11": [0, 10, 140, 205, 247, 289], "ba": [0, 10, 140, 205, 247, 289], "hzm": [0, 10, 140, 205, 247, 289], "10dc88": [0, 10, 140, 205, 247, 289], "gallinacea": [0, 10, 140, 205, 247, 289], "1274": [0, 10, 140, 205, 247, 289], "halapricum": [0, 10, 140, 205, 247, 289], "salinum": [0, 10, 140, 205, 247, 289], "jiangsuensi": [0, 10, 140, 205, 247, 289], "serpentinomona": [0, 10, 140, 205, 247, 289], "raichei": [0, 10, 140, 205, 247, 289], "mccroryi": [0, 10, 140, 205, 247, 289], "phaeomarinobact": [0, 10, 140, 205, 247, 289], "ectocarpi": [0, 10, 140, 205, 247, 289], "ac2029": [0, 10, 140, 205, 247, 289], "evergladensi": [0, 10, 140, 205, 247, 289], "geomicrobium": [0, 10, 140, 205, 247, 289], "19037": [0, 10, 140, 205, 247, 289], "19038": [0, 10, 140, 205, 247, 289], "19046": [0, 10, 140, 205, 247, 289], "paraphaeosphaeria": [0, 10, 140, 205, 247, 289], "sporulosa": [0, 10, 140, 205, 247, 289], "neobacillu": [0, 10, 140, 205, 247, 289], "jeddahensi": [0, 10, 140, 205, 247, 289], "saudimassiliensi": [0, 10, 140, 205, 247, 289], "metalysinibacillu": [0, 10, 140, 205, 247, 289], "actibacterium": [0, 10, 140, 205, 247, 289], "atlanticum": [0, 10, 140, 205, 247, 289], "scsio_11900": [0, 10, 140, 205, 247, 289], "papioni": [0, 10, 140, 205, 247, 289], "quasipneumonia": [0, 10, 140, 205, 247, 289], "ucicr": [0, 10, 140, 205, 247, 289], "actinosporangium": [0, 10, 140, 205, 247, 289], "3428": [0, 10, 140, 205, 247, 289], "16210": [0, 10, 140, 205, 247, 289], "16314": [0, 10, 140, 205, 247, 289], "2890": [0, 10, 140, 205, 247, 289], "5053": [0, 10, 140, 205, 247, 289], "5065": [0, 10, 140, 205, 247, 289], "5123": [0, 10, 140, 205, 247, 289], "5126": [0, 10, 140, 205, 247, 289], "5630": [0, 10, 140, 205, 247, 289], "6677": [0, 10, 140, 205, 247, 289], "118": [0, 10, 140, 205, 247, 289], "1777": [0, 10, 140, 205, 247, 289], "337": [0, 10, 140, 205, 247, 289], "340": [0, 10, 140, 205, 247, 289], "646": [0, 10, 140, 205, 247, 289], "920": [0, 10, 140, 205, 247, 289], "wc": [0, 10, 140, 205, 247, 289], "3626": [0, 10, 140, 205, 247, 289], "3742": [0, 10, 140, 205, 247, 289], "3773": [0, 10, 140, 205, 247, 289], "jc14": [0, 10, 140, 205, 247, 289], "grossensi": [0, 10, 140, 205, 247, 289], "ph5": [0, 10, 140, 205, 247, 289], "jc140": [0, 10, 140, 205, 247, 289], "diop": [0, 10, 140, 205, 247, 289], "jc66": [0, 10, 140, 205, 247, 289], "jc122": [0, 10, 140, 205, 247, 289], "jc225": [0, 10, 140, 205, 247, 289], "noviherbaspirillum": [0, 10, 140, 205, 247, 289], "jc206": [0, 10, 140, 205, 247, 289], "timonella": [0, 10, 140, 205, 247, 289], "jc301": [0, 10, 140, 205, 247, 289], "2002721687": [0, 10, 140, 205, 247, 289], "massilioanorexiu": [0, 10, 140, 205, 247, 289], "ap8": [0, 10, 140, 205, 247, 289], "os02": [0, 10, 140, 205, 247, 289], "ap2": [0, 10, 140, 205, 247, 289], "hk1": [0, 10, 140, 205, 247, 289], "gj": [0, 10, 140, 205, 247, 289], "e10": [0, 10, 140, 205, 247, 289], "jangbogonensi": [0, 10, 140, 205, 247, 289], "ni22": [0, 10, 140, 205, 247, 289], "kineothrix": [0, 10, 140, 205, 247, 289], "alysoid": [0, 10, 140, 205, 247, 289], "ap11": [0, 10, 140, 205, 247, 289], "stoquefichu": [0, 10, 140, 205, 247, 289], "ap9": [0, 10, 140, 205, 247, 289], "ap5": [0, 10, 140, 205, 247, 289], "ap3": [0, 10, 140, 205, 247, 289], "6176": [0, 10, 140, 205, 247, 289], "rit328": [0, 10, 140, 205, 247, 289], "rit357": [0, 10, 140, 205, 247, 289], "scb241_528o2": [0, 10, 140, 205, 247, 289], "scb245a_520k10": [0, 10, 140, 205, 247, 289], "basilea": [0, 10, 140, 205, 247, 289], "psittacipulmoni": [0, 10, 140, 205, 247, 289], "24701": [0, 10, 140, 205, 247, 289], "falsirhodobact": [0, 10, 140, 205, 247, 289], "alg1": [0, 10, 140, 205, 247, 289], "k24": [0, 10, 140, 205, 247, 289], "kallipyga": [0, 10, 140, 205, 247, 289], "ph2": [0, 10, 140, 205, 247, 289], "senegalimassilia": [0, 10, 140, 205, 247, 289], "anaerobia": [0, 10, 140, 205, 247, 289], "jc110": [0, 10, 140, 205, 247, 289], "mizugakiibact": [0, 10, 140, 205, 247, 289], "phoenici": [0, 10, 140, 205, 247, 289], "24720": [0, 10, 140, 205, 247, 289], "va2": [0, 10, 140, 205, 247, 289], "psnih2": [0, 10, 140, 205, 247, 289], "psnih1": [0, 10, 140, 205, 247, 289], "ab2": [0, 10, 140, 205, 247, 289], "saidenbachensi": [0, 10, 140, 205, 247, 289], "ed16": [0, 10, 140, 205, 247, 289], "cadophora": [0, 10, 140, 205, 247, 289], "dse1049": [0, 10, 140, 205, 247, 289], "ae3005": [0, 10, 140, 205, 247, 289], "ferriphaselu": [0, 10, 140, 205, 247, 289], "ghiorsea": [0, 10, 140, 205, 247, 289], "bivora": [0, 10, 140, 205, 247, 289], "mitosporidium": [0, 10, 140, 205, 247, 289], "endophytica": [0, 10, 140, 205, 247, 289], "pierantoniu": [0, 10, 140, 205, 247, 289], "sope": [0, 10, 140, 205, 247, 289], "hmp27": [0, 10, 140, 205, 247, 289], "hmp52": [0, 10, 140, 205, 247, 289], "6931": [0, 10, 140, 205, 247, 289], "ant30": [0, 10, 140, 205, 247, 289], "seoulens": [0, 10, 140, 205, 247, 289], "mfb021": [0, 10, 140, 205, 247, 289], "mesoaciditoga": [0, 10, 140, 205, 247, 289], "lauensi": [0, 10, 140, 205, 247, 289], "1655r": [0, 10, 140, 205, 247, 289], "25116": [0, 10, 140, 205, 247, 289], "wcs374": [0, 10, 140, 205, 247, 289], "griseofulvum": [0, 10, 140, 205, 247, 289], "ufmgcb": [0, 10, 140, 205, 247, 289], "6741": [0, 10, 140, 205, 247, 289], "evansia": [0, 10, 140, 205, 247, 289], "caciam": [0, 10, 140, 205, 247, 289], "listeriacea": [0, 10, 140, 205, 247, 289], "a5": [0, 10, 140, 205, 247, 289], "0209": [0, 10, 140, 205, 247, 289], "0601": [0, 10, 140, 205, 247, 289], "0602": [0, 10, 140, 205, 247, 289], "0701": [0, 10, 140, 205, 247, 289], "rubiinfanti": [0, 10, 140, 205, 247, 289], "andreraoultii": [0, 10, 140, 205, 247, 289], "saudiphocaensi": [0, 10, 140, 205, 247, 289], "amazonitimonens": [0, 10, 140, 205, 247, 289], "moduliflexu": [0, 10, 140, 205, 247, 289], "vecturithrix": [0, 10, 140, 205, 247, 289], "tca20": [0, 10, 140, 205, 247, 289], "yr295": [0, 10, 140, 205, 247, 289], "yr519": [0, 10, 140, 205, 247, 289], "cf284": [0, 10, 140, 205, 247, 289], "cf097": [0, 10, 140, 205, 247, 289], "cf394": [0, 10, 140, 205, 247, 289], "ok494": [0, 10, 140, 205, 247, 289], "luteibact": [0, 10, 140, 205, 247, 289], "9143": [0, 10, 140, 205, 247, 289], "9135": [0, 10, 140, 205, 247, 289], "9096": [0, 10, 140, 205, 247, 289], "9120": [0, 10, 140, 205, 247, 289], "rm16704": [0, 10, 140, 205, 247, 289], "tyrfi": [0, 10, 140, 205, 247, 289], "0604": [0, 10, 140, 205, 247, 289], "0801": [0, 10, 140, 205, 247, 289], "acb8": [0, 10, 140, 205, 247, 289], "asaccharolyticum": [0, 10, 140, 205, 247, 289], "acb7": [0, 10, 140, 205, 247, 289], "inop": [0, 10, 140, 205, 247, 289], "devosia": [0, 10, 140, 205, 247, 289], "lc5": [0, 10, 140, 205, 247, 289], "l2l1": [0, 10, 140, 205, 247, 289], "aac": [0, 10, 140, 205, 247, 289], "lc81": [0, 10, 140, 205, 247, 289], "lc85": [0, 10, 140, 205, 247, 289], "lc238": [0, 10, 140, 205, 247, 289], "seminali": [0, 10, 140, 205, 247, 289], "col6b": [0, 10, 140, 205, 247, 289], "cg9_12": [0, 10, 140, 205, 247, 289], "ko116": [0, 10, 140, 205, 247, 289], "chitinivibrio": [0, 10, 140, 205, 247, 289], "acht1": [0, 10, 140, 205, 247, 289], "polyrhachi": [0, 10, 140, 205, 247, 289], "hedomyrma": [0, 10, 140, 205, 247, 289], "turneri": [0, 10, 140, 205, 247, 289], "colobopsi": [0, 10, 140, 205, 247, 289], "obliquu": [0, 10, 140, 205, 247, 289], "schmidhempelia": [0, 10, 140, 205, 247, 289], "bimp": [0, 10, 140, 205, 247, 289], "eurythermali": [0, 10, 140, 205, 247, 289], "ae3004": [0, 10, 140, 205, 247, 289], "rachicladosporium": [0, 10, 140, 205, 247, 289], "jeotgalibacillu": [0, 10, 140, 205, 247, 289], "malaysiensi": [0, 10, 140, 205, 247, 289], "nl": [0, 10, 140, 205, 247, 289], "hr7": [0, 10, 140, 205, 247, 289], "pseudorhizobium": [0, 10, 140, 205, 247, 289], "pelagicum": [0, 10, 140, 205, 247, 289], "ar1": [0, 10, 140, 205, 247, 289], "unc402clcol": [0, 10, 140, 205, 247, 289], "hun007": [0, 10, 140, 205, 247, 289], "fribergensi": [0, 10, 140, 205, 247, 289], "cot": [0, 10, 140, 205, 247, 289], "oh1446": [0, 10, 140, 205, 247, 289], "290": [0, 10, 140, 205, 247, 289, 324, 325], "oh860": [0, 10, 140, 205, 247, 289], "er1a": [0, 10, 140, 205, 247, 289], "porphyromonadacea": [0, 10, 140, 205, 247, 289], "184": [0, 10, 140, 205, 247, 289], "oh4590": [0, 10, 140, 205, 247, 289], "coluzzii": [0, 10, 140, 205, 247, 289], "er4": [0, 10, 140, 205, 247, 289], "thermochlorobacteriacea": [0, 10, 140, 205, 247, 289], "gbchlb": [0, 10, 140, 205, 247, 289], "ba1": [0, 10, 140, 205, 247, 289], "ceraceosoru": [0, 10, 140, 205, 247, 289], "ml96": [0, 10, 140, 205, 247, 289], "ag1": [0, 10, 140, 205, 247, 289], "21323": [0, 10, 140, 205, 247, 289], "rickettsial": [0, 10, 140, 205, 247, 289], "ac37b": [0, 10, 140, 205, 247, 289], "seifertii": [0, 10, 140, 205, 247, 289], "palleronia": [0, 10, 140, 205, 247, 289], "rufa": [0, 10, 140, 205, 247, 289], "torrubiella": [0, 10, 140, 205, 247, 289], "hemipterigena": [0, 10, 140, 205, 247, 289], "rta": [0, 10, 140, 205, 247, 289], "1r": [0, 10, 140, 205, 247, 289], "thalassotalea": [0, 10, 140, 205, 247, 289], "nd16a": [0, 10, 140, 205, 247, 289], "p4": [0, 10, 140, 205, 247, 289], "0081": [0, 10, 140, 205, 247, 289], "0345": [0, 10, 140, 205, 247, 289], "0912": [0, 10, 140, 205, 247, 289], "0273": [0, 10, 140, 205, 247, 289], "0331": [0, 10, 140, 205, 247, 289], "0357": [0, 10, 140, 205, 247, 289], "0737": [0, 10, 140, 205, 247, 289], "mwb1": [0, 10, 140, 205, 247, 289], "scadc": [0, 10, 140, 205, 247, 289], "mlsb": [0, 10, 140, 205, 247, 289], "lor": [0, 10, 140, 205, 247, 289], "hk10": [0, 10, 140, 205, 247, 289], "aquabacterium": [0, 10, 140, 205, 247, 289], "nj1": [0, 10, 140, 205, 247, 289], "ml3w": [0, 10, 140, 205, 247, 289], "omz": [0, 10, 140, 205, 247, 289], "838": [0, 10, 140, 205, 247, 289], "77859": [0, 10, 140, 205, 247, 289], "knhs214": [0, 10, 140, 205, 247, 289], "myxosarcina": [0, 10, 140, 205, 247, 289], "gi1": [0, 10, 140, 205, 247, 289], "izimaplasma": [0, 10, 140, 205, 247, 289], "hr1": [0, 10, 140, 205, 247, 289], "hr2": [0, 10, 140, 205, 247, 289], "oleiagrimona": [0, 10, 140, 205, 247, 289], "wkb10": [0, 10, 140, 205, 247, 289], "wkb8": [0, 10, 140, 205, 247, 289], "24zxx": [0, 10, 140, 205, 247, 289], "bal378": [0, 10, 140, 205, 247, 289], "fsc1006": [0, 10, 140, 205, 247, 289], "5569": [0, 10, 140, 205, 247, 289], "taxi": [0, 10, 140, 205, 247, 289], "37zxx": [0, 10, 140, 205, 247, 289], "sphingobacteriacea": [0, 10, 140, 205, 247, 289], "dw12": [0, 10, 140, 205, 247, 289], "uzonens": [0, 10, 140, 205, 247, 289], "booria": [0, 10, 140, 205, 247, 289], "fermentimona": [0, 10, 140, 205, 247, 289], "caenicola": [0, 10, 140, 205, 247, 289], "b7740": [0, 10, 140, 205, 247, 289], "ecsmb14101": [0, 10, 140, 205, 247, 289], "rugosibact": [0, 10, 140, 205, 247, 289], "x1": [0, 10, 140, 205, 247, 289], "2014": [0, 9, 10, 140, 205, 247, 289, 323], "ihbb": [0, 10, 140, 205, 247, 289], "10380": [0, 10, 140, 205, 247, 289], "22219": [0, 10, 140, 205, 247, 289], "s60": [0, 10, 140, 205, 247, 289], "jaminaea": [0, 10, 140, 205, 247, 289], "bh072": [0, 10, 140, 205, 247, 289], "yp1": [0, 10, 140, 205, 247, 289], "methanoplasma": [0, 10, 140, 205, 247, 289], "termitum": [0, 10, 140, 205, 247, 289], "adriaticu": [0, 10, 140, 205, 247, 289], "hmsc05h02": [0, 10, 140, 205, 247, 289], "hmsc06f02": [0, 10, 140, 205, 247, 289], "methylopumilu": [0, 10, 140, 205, 247, 289], "planktonicu": [0, 10, 140, 205, 247, 289], "piranensi": [0, 10, 140, 205, 247, 289], "hwasookii": [0, 10, 140, 205, 247, 289], "chdc": [0, 10, 140, 205, 247, 289], "f128": [0, 10, 140, 205, 247, 289], "a21": [0, 10, 140, 205, 247, 289], "arsenijevicii": [0, 10, 140, 205, 247, 289], "10b238": [0, 10, 140, 205, 247, 289], "cba1115": [0, 10, 140, 205, 247, 289], "29904": [0, 10, 140, 205, 247, 289], "nitrosotenui": [0, 10, 140, 205, 247, 289], "halanaeroarchaeum": [0, 10, 140, 205, 247, 289], "sulfurireducen": [0, 10, 140, 205, 247, 289], "filomicrobium": [0, 10, 140, 205, 247, 289], "hengshuiensi": [0, 10, 140, 205, 247, 289], "mrsn12121": [0, 10, 140, 205, 247, 289], "s234": [0, 10, 140, 205, 247, 289], "psychromicrobium": [0, 10, 140, 205, 247, 289], "lacusluna": [0, 10, 140, 205, 247, 289], "lm": [0, 10, 140, 205, 247, 289], "t08": [0, 10, 140, 205, 247, 289], "imcc26134": [0, 10, 140, 205, 247, 289], "chania": [0, 10, 140, 205, 247, 289], "multitudinisenten": [0, 10, 140, 205, 247, 289], "paralicheniformi": [0, 10, 140, 205, 247, 289], "9945a": [0, 10, 140, 205, 247, 289], "rileyi": [0, 10, 140, 205, 247, 289], "4871": [0, 10, 140, 205, 247, 289], "maju": [0, 10, 140, 205, 247, 289], "297": [0, 10, 140, 205, 247, 289], "cuenoti": [0, 10, 140, 205, 247, 289], "bpaa": [0, 10, 140, 205, 247, 289], "quebecensi": [0, 10, 140, 205, 247, 289], "cac": [0, 10, 140, 205, 247, 289], "2015a": [0, 10, 140, 205, 247, 289], "percursu": [0, 10, 140, 205, 247, 289], "attinorum": [0, 10, 140, 205, 247, 289], "violaceomyc": [0, 10, 140, 205, 247, 289], "gilchristii": [0, 10, 140, 205, 247, 289], "slh14081": [0, 10, 140, 205, 247, 289], "pseudomicrostroma": [0, 10, 140, 205, 247, 289], "glucosiphilum": [0, 10, 140, 205, 247, 289], "mellicola": [0, 10, 140, 205, 247, 289], "633": [0, 10, 140, 159, 205, 211, 247, 253, 289, 296, 324, 325], "66": [0, 10, 140, 205, 247, 289], "panamericana": [0, 10, 140, 205, 247, 289], "10762": [0, 10, 140, 205, 247, 289], "leucoagaricu": [0, 10, 140, 205, 247, 289], "symc": [0, 10, 140, 205, 247, 289], "pezoloma": [0, 10, 140, 205, 247, 289], "erica": [0, 10, 140, 205, 247, 289], "neocallimastix": [0, 10, 140, 205, 247, 289], "california": [0, 10, 140, 205, 247, 289], "finni": [0, 10, 140, 205, 247, 289], "anaeromyc": [0, 10, 140, 205, 247, 289], "robustu": [0, 10, 140, 205, 247, 289], "erdmanii": [0, 10, 140, 205, 247, 289], "3471": [0, 10, 140, 205, 247, 289], "disploder": [0, 10, 140, 205, 247, 289], "roggenkampii": [0, 10, 140, 205, 247, 289], "ec_38vim1": [0, 10, 140, 205, 247, 289], "et080813": [0, 10, 140, 205, 247, 289], "dacryopinax": [0, 10, 140, 205, 247, 289], "primogenitu": [0, 10, 140, 205, 247, 289], "vgii": [0, 10, 140, 205, 247, 289], "la55": [0, 10, 140, 205, 247, 289], "vgiv": [0, 10, 140, 205, 247, 289], "ind107": [0, 10, 140, 205, 247, 289], "amphiambli": [0, 10, 140, 205, 247, 289], "wsbs2006": [0, 10, 140, 205, 247, 289], "fijiensi": [0, 10, 140, 205, 247, 289], "cirad86": [0, 10, 140, 205, 247, 289], "testicularia": [0, 10, 140, 205, 247, 289], "cyperi": [0, 10, 140, 205, 247, 289], "phaseoli": [0, 10, 140, 205, 247, 289], "planoprotostelium": [0, 10, 140, 205, 247, 289], "fungivorum": [0, 10, 140, 205, 247, 289], "fortiea": [0, 10, 140, 205, 247, 289], "contorta": [0, 10, 140, 205, 247, 289], "7126": [0, 10, 140, 205, 247, 289], "parmentieri": [0, 10, 140, 205, 247, 289], "wpp163": [0, 10, 140, 205, 247, 289], "bifiguratu": [0, 10, 140, 205, 247, 289], "adelaida": [0, 10, 140, 205, 247, 289], "emergomyc": [0, 10, 140, 205, 247, 289], "ep9510": [0, 10, 140, 205, 247, 289], "dinothrombium": [0, 10, 140, 205, 247, 289], "tinctorium": [0, 10, 140, 205, 247, 289], "ccfee": [0, 10, 140, 205, 247, 289], "5018": [0, 10, 140, 205, 247, 289], "rao": [0, 10, 140, 205, 247, 289], "2017": [0, 9, 10, 140, 205, 247, 289], "camponoti": [0, 10, 140, 205, 247, 289], "rufipedi": [0, 10, 140, 205, 247, 289], "ooceraea": [0, 10, 140, 205, 247, 289], "biroi": [0, 10, 140, 205, 247, 289], "vespertilioni": [0, 10, 140, 205, 247, 289], "coniella": [0, 10, 140, 205, 247, 289], "lustricola": [0, 10, 140, 205, 247, 289], "ultimum": [0, 10, 140, 205, 247, 289], "br144": [0, 10, 140, 205, 247, 289], "silvera": [0, 10, 140, 205, 247, 289], "303099": [0, 10, 140, 205, 247, 289], "rutstroemia": [0, 10, 140, 205, 247, 289], "njr": [0, 10, 140, 205, 247, 289], "2017a": [0, 10, 140, 205, 247, 289], "wrk4": [0, 10, 140, 205, 247, 289], "bvv2": [0, 10, 140, 205, 247, 289], "bbw": [0, 10, 140, 205, 247, 289], "paragasseri": [0, 10, 140, 205, 247, 289], "jv": [0, 10, 140, 205, 247, 289], "v03": [0, 10, 140, 205, 247, 289], "laumondii": [0, 10, 140, 205, 247, 289], "tto1": [0, 10, 140, 205, 247, 289], "pyrrhoderma": [0, 10, 140, 205, 247, 289], "noxium": [0, 10, 140, 205, 247, 289], "hondaea": [0, 10, 140, 205, 247, 289], "fermentalgiana": [0, 10, 140, 205, 247, 289], "yamadazyma": [0, 10, 140, 205, 247, 289], "tenui": [0, 10, 140, 205, 247, 289], "10573": [0, 10, 140, 205, 247, 289], "hyaloscypha": [0, 10, 140, 205, 247, 289], "nothophytophthora": [0, 10, 140, 205, 247, 289], "chile5": [0, 10, 140, 205, 247, 289], "odoratissimum": [0, 10, 140, 205, 247, 289], "54006": [0, 10, 140, 205, 247, 289], "gloeothec": [0, 10, 140, 205, 247, 289], "citriformi": [0, 10, 140, 205, 247, 289], "7424": [0, 10, 140, 205, 247, 289], "verrucosa": [0, 10, 140, 205, 247, 289], "7822": [0, 10, 140, 205, 247, 289], "subtropica": [0, 10, 140, 205, 247, 289], "51142": [0, 10, 140, 205, 247, 289], "chwakensi": [0, 10, 140, 205, 247, 289], "ccy0110": [0, 10, 140, 205, 247, 289], "rippkaea": [0, 10, 140, 205, 247, 289], "8802": [0, 10, 140, 205, 247, 289], "thermothielavioid": [0, 10, 140, 205, 247, 289], "8126": [0, 10, 140, 205, 247, 289], "podospora": [0, 10, 140, 205, 247, 289], "mat": [0, 10, 140, 205, 247, 289], "djm": [0, 10, 140, 205, 247, 289], "731": [0, 10, 140, 205, 247, 289], "ssp": [0, 10, 140, 205, 247, 289], "akanthomyc": [0, 10, 140, 205, 247, 289], "lecanii": [0, 10, 140, 205, 247, 289], "1005": [0, 10, 140, 205, 247, 289], "vanettenii": [0, 10, 140, 205, 247, 289], "consistency_score_threshold": [0, 10, 140, 205, 247, 289], "filter_consistency_scor": [0, 10, 140, 205, 247, 289], "phylomedb": [0, 5, 9, 10, 140, 205, 247, 289], "consist": [0, 5, 10, 24, 53, 140, 205, 247, 289, 315, 316, 323, 324, 325], "repres": [0, 4, 10, 140, 205, 247, 262, 289, 323, 324, 325], "orthologi": [0, 10, 140, 205, 247, 289], "normalize_median_of_ratio": [0, 10], "reference_group": [0, 10, 141], "return_scaling_factor": [0, 5, 10, 141, 142, 143, 144, 145, 146, 147, 148], "ratio": [0, 5, 10, 141, 142, 323, 324, 325], "mrn": [0, 5, 10, 141, 324, 325], "maza": [0, 10, 141], "2013": [0, 9, 10, 141], "pick": [0, 5, 10, 24, 53, 141, 142, 166, 167, 168, 169, 323, 324, 325], "multipli": [0, 10, 141, 143], "total": [0, 10, 77, 141, 144, 145, 146, 147, 148, 163, 324], "final": [0, 6, 10, 141, 143, 168, 169, 324, 325], "adjust": [0, 5, 10, 141, 143, 177, 194, 323, 324, 325], "symmetri": [0, 10, 141, 143], "integ": [0, 5, 10, 24, 53, 141, 163, 324], "normalize_rl": [0, 10, 324, 325], "rle": [0, 5, 10, 142, 324, 325], "ander": [0, 9, 10, 142], "huber": [0, 9, 10, 142], "2010": [0, 10, 142, 143, 144, 168], "geometr": [0, 10, 142], "across": [0, 5, 10, 142, 145, 148, 323, 324, 325], "wise": [0, 1, 10, 142, 152, 323], "normalize_tmm": [0, 10, 324, 325], "log_ratio_trim": [0, 10, 143], "sum_trim": [0, 10, 143], "a_cutoff": [0, 10, 143], "10000000000": [0, 10, 143], "tmm": [0, 5, 10, 143, 324, 325], "robinson": [0, 10, 143], "oshlack": [0, 10, 143], "log2": [0, 5, 10, 143, 151, 173, 177, 183, 191, 214, 218, 221, 259, 262, 268, 276, 299, 303, 323, 324, 325], "minu": [0, 10, 143], "extrem": [0, 10, 143, 323, 324, 325], "bottom": [0, 2, 5, 7, 10, 143, 163, 323, 324, 325], "smaller": [0, 10, 65, 66, 143, 323, 324, 325], "cutuff": [0, 10, 143], "avoid": [0, 10, 143, 324, 325], "inf": [0, 10, 143, 262, 324], "next": [0, 2, 7, 10, 143, 152, 323, 324, 325], "invers": [0, 10, 143, 323], "approxim": [0, 10, 143], "direct": [0, 10, 143, 191, 214, 276, 299, 323, 324, 325], "1e10": [0, 10, 143], "lower": [0, 5, 10, 143, 183, 268, 323, 324], "normalize_to_quantil": [0, 10], "quantil": [0, 5, 10, 144, 324, 325], "bullard": [0, 10, 144], "divid": [0, 10, 144, 145, 146, 147, 148, 149, 165, 323, 324, 325], "yield": [0, 10, 144], "normalize_to_rpkm": [0, 5, 10], "merged_exon": [0, 10, 145, 148], "kilobas": [0, 5, 10, 145, 148, 323], "aggreg": [0, 10, 145, 148], "goemetr": [0, 10, 145, 148], "while": [0, 2, 5, 10, 77, 145, 148, 158, 221, 323, 324], "deafult": [0, 10, 24, 30, 40, 53, 59, 65, 66, 72, 145, 148], "normalize_to_rpm": [0, 5, 10, 324, 325], "normalize_to_rpm_htseqcount": [0, 5, 10, 324, 325], "special_counter_fnam": [0, 10, 147], "ambigu": [0, 10, 147, 324, 325], "normalize_to_tpm": [0, 5, 10], "rpk": [0, 10, 148], "kbp": [0, 10, 148], "Then": [0, 1, 10, 148, 323, 325], "similar": [0, 2, 5, 10, 148, 165, 166, 167, 169, 324, 325], "normalize_with_scaling_factor": [0, 5, 10, 324], "scaling_factor_fnam": [0, 10, 149], "scaling_factor": [0, 10, 149, 324], "number_filt": [0, 10, 307, 324], "greater": [0, 7, 10, 150, 206, 248, 290, 307, 324], "equal": [0, 10, 150, 162, 172, 206, 213, 217, 248, 255, 258, 290, 298, 302], "lesser": [0, 10, 150, 206, 248, 290, 323], "applai": [0, 10, 150, 172, 206, 217, 248, 258, 290, 302], "particular": [0, 5, 9, 10, 24, 53, 150, 172, 206, 217, 248, 258, 290, 302, 323, 324, 325], "eq": [0, 10, 150, 172, 206, 217, 248, 258, 290, 302], "lt": [0, 10, 150, 206, 248, 290], "5900": [0, 10, 150, 206, 248, 290], "pairplot": [0, 5, 10, 324, 325], "show_corr": [0, 10, 151], "pairwis": [0, 10, 151, 152, 323, 324, 325], "relationship": [0, 5, 9, 10, 151, 323, 324, 325], "seaborn": [0, 5, 9, 10, 151], "pseudocount": [0, 5, 10, 151], "spearman": [0, 10, 151, 165, 166, 167, 169, 323, 324, 325], "coeffici": [0, 10, 151, 324, 325], "n_compon": [0, 10, 152, 323], "power_transform": [0, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323], "princip": [0, 5, 10, 152, 160, 163, 324, 325], "compon": [0, 5, 10, 152, 160, 163, 324, 325], "prior": [0, 5, 10, 152, 160, 163, 165, 166, 167, 168, 169], "request": [0, 5, 6, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 152, 292, 324, 325], "project": [0, 1, 5, 9, 10, 152, 323, 324], "displai": [0, 4, 5, 8, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 75, 152, 153, 323, 325], "power": [0, 5, 9, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "transform": [0, 5, 10, 152, 160, 163, 165, 166, 167, 168, 169, 323, 324, 325], "cox": [0, 10, 152, 160, 163, 165, 166, 167, 168, 169, 173, 218, 259, 303, 323], "standart": [0, 10, 152, 160, 163], "proport": [0, 5, 10, 152, 323, 324, 325], "percentag": [0, 5, 10, 76, 152, 323], "grid": [0, 5, 10, 152], "enabl": [0, 5, 10, 152, 323], "sklearn": [0, 10, 152], "decomposit": [0, 10, 152], "plot_express": [0, 5, 10, 324], "count_unit": [0, 10, 153], "Will": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 153, 292], "print_featur": [0, 10], "alt_filenam": [0, 10, 155, 156, 157, 208, 209, 210, 250, 251, 252, 293, 294, 295], "myfilenam": [0, 10, 155, 156, 157, 208, 209, 210, 250, 251, 252, 293, 294, 295], "save_parquet": [0, 10], "parquet": [0, 5, 10, 156, 157, 209, 210, 251, 252, 294, 295], "save_t": [0, 10], "tsv": [0, 2, 5, 10, 157, 165, 166, 167, 168, 169, 210, 252, 295, 323, 325], "scatter_sample_vs_sampl": [0, 5, 10], "xlabel": [0, 10, 158], "annotation_fonts": [0, 10, 158, 221], "highlight": [0, 5, 10, 75, 158, 323, 325], "point_color": [0, 10, 158], "6d7178": [0, 10, 158], "highlight_color": [0, 10, 158], "00aaff": [0, 10, 158], "opac": [0, 10, 77, 158, 221], "point_siz": [0, 10, 158, 221], "interact": [0, 1, 2, 5, 6, 7, 10, 158, 221, 323, 324], "show_cursor": [0, 10, 158, 221], "click": [0, 1, 2, 5, 7, 8, 10, 158, 221, 323, 325], "avarg": [0, 10, 158], "red": [0, 7, 10, 158, 221], "transpar": [0, 1, 10, 31, 60, 77, 158, 221], "opaqu": [0, 10, 77, 158, 221], "turn": [0, 2, 10, 158, 221, 325], "unlabel": [0, 10, 158, 221], "cursor": [0, 10, 158, 221, 323, 325], "451": [0, 10, 159, 211, 253, 296, 324, 325], "388": [0, 10, 159, 211, 253, 296, 324, 325], "sort_by_principal_compon": [0, 5, 10], "contribut": [0, 5, 6, 10, 160, 163, 324, 325], "load": [0, 4, 5, 6, 9, 10, 103, 160, 163, 177, 222, 262, 308, 323], "understand": [0, 5, 8, 10, 160, 163, 324, 325], "particularli": [0, 2, 10, 160, 324, 325], "trle": [0, 10, 160], "neg": [0, 10, 24, 53, 160, 191, 214, 221, 276, 299, 323, 324, 325], "versu": [0, 10, 160], "split_by_attribut": [0, 5, 10], "attribute2": [0, 10, 161, 212, 254, 297, 324, 325], "split_by_percentil": [0, 10], "specfieid": [0, 10, 162, 213, 255], "split_by_principal_compon": [0, 5, 10], "gene_fract": [0, 10, 163], "influenti": [0, 10, 163], "split_by_read": [0, 5, 10], "low_express": [0, 10, 164], "high_express": [0, 10, 164], "split_clicom": [0, 5, 10], "parameter_dict": [0, 10, 165], "replicate_group": [0, 10, 165], "ungroup": [0, 10, 165], "evidence_threshold": [0, 10, 165, 323, 324, 325], "6666666666666666": [0, 10, 165], "cluster_unclustered_featur": [0, 10, 165, 323, 324, 325], "min_cluster_s": [0, 10, 165, 166, 323, 324, 325], "plot_styl": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 165, 166, 167, 168, 169, 324, 325], "std_area": [0, 10, 165, 166, 167, 168, 169, 324, 325], "std_bar": [0, 10, 165, 166, 167, 168, 169, 324, 325], "parallel_backend": [0, 2, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "multiprocess": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "loki": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "sequenti": [0, 2, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 306, 308, 323], "gui_mod": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 165, 166, 167, 168, 169], "clicom": [0, 2, 5, 10, 165], "mimaroglu": [0, 5, 10, 165], "yagci": [0, 5, 10, 165], "incorpor": [0, 10, 165, 323, 324, 325], "solut": [0, 2, 10, 165, 323, 324, 325], "due": [0, 5, 10, 165, 324, 325], "natur": [0, 10, 165, 307, 323], "classifi": [0, 10, 165, 166, 323, 324, 325], "nois": [0, 10, 165, 166, 323, 324, 325], "influenc": [0, 10, 165, 323, 324, 325], "batch": [0, 5, 10, 165, 323, 324, 325], "advantag": [0, 10, 165, 323, 324, 325], "measur": [0, 10, 165, 323, 324, 325], "improv": [0, 1, 5, 7, 10, 165], "theori": [0, 10, 165], "behind": [0, 10, 165], "public": [0, 7, 10, 165, 323, 324, 325], "doi": [0, 9, 10, 165, 324, 325], "1093": [0, 9, 10, 165], "bib": [0, 10, 165], "bbs057": [0, 10, 165], "twice": [0, 5, 10, 165], "reliabl": [0, 5, 10, 165], "forc": [0, 10, 165, 323, 324, 325], "part": [0, 1, 5, 10, 165, 323, 324], "even": [0, 1, 5, 10, 165], "larger": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 165, 166, 292, 323, 324, 325], "fewer": [0, 10, 165, 166, 323, 324, 325], "seek": [0, 10, 165, 166, 167, 168, 169], "dictionari": [0, 10, 76, 77, 165, 308, 324], "medoid": [0, 5, 10, 165, 168, 169], "hdbscan": [0, 5, 7, 9, 10, 165, 166], "prefer": [0, 5, 10, 165, 323, 324], "yoi": [0, 10, 165], "n_cluster": [0, 10, 165, 167, 168, 169, 323, 324], "cosin": [0, 5, 10, 165, 166, 167, 169, 324, 325], "four": [0, 5, 10, 165, 325], "style": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 77, 165, 166, 167, 168, 169, 323, 324, 325], "babckend": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169], "case": [0, 1, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 165, 166, 167, 168, 169, 323, 324, 325], "dev_stag": [0, 10, 165, 166, 167, 168, 169], "elegans_developmental_stag": [0, 10, 165, 166, 167, 168, 169], "44072": [0, 10, 165, 166, 167, 168, 169], "2326": [0, 10, 165, 166, 167, 168, 169], "46398": [0, 10, 165, 166, 167, 168, 169], "140": [0, 10, 165, 168], "ys1": [0, 10, 165, 166, 167, 169, 324, 325], "yr1": [0, 10, 165, 166, 167, 169, 323, 324, 325], "jackknif": [0, 10, 165, 166, 167, 169, 323, 324, 325], "kmedoid": [0, 10, 165], "651": [0, 10, 165], "06it": [0, 10, 165], "cliqu": [0, 10, 165], "42436": [0, 10, 165], "61385": [0, 10, 165], "87it": [0, 10, 165], "153": [0, 10, 165, 166], "unclust": [0, 10, 165, 166, 323, 324, 325], "1864": [0, 10, 165], "462": [0, 10, 165], "2115": [0, 10, 165], "204": [0, 10, 165, 166], "2123": [0, 10, 165], "203": [0, 10, 165], "2128": [0, 10, 165], "2167": [0, 10, 165], "159": [0, 10, 165], "2179": [0, 10, 165], "2204": [0, 10, 165], "2229": [0, 10, 165, 169], "2234": [0, 10, 165, 166], "2238": [0, 10, 165, 166, 167], "2263": [0, 10, 165], "47": [0, 9, 10, 165], "split_hdbscan": [0, 5, 10], "min_sampl": [0, 5, 10, 166], "pearson": [0, 10, 166, 167, 169, 324, 325], "manhattan": [0, 10, 166, 167, 169, 324, 325], "sharpened_cosin": [0, 10, 166, 167, 169], "cluster_selection_epsilon": [0, 10, 166], "cluster_selection_method": [0, 10, 166], "eom": [0, 10, 166], "leaf": [0, 10, 166], "return_prob": [0, 10, 166], "ndarrai": [0, 10, 41, 166], "neighbourhood": [0, 10, 166], "conserv": [0, 10, 166], "condens": [0, 10, 166], "excess": [0, 10, 166], "mass": [0, 10, 166], "persist": [0, 10, 166], "fine": [0, 10, 166], "grain": [0, 10, 166, 323], "homogen": [0, 10, 166], "arrai": [0, 2, 10, 166, 323, 324], "probabl": [0, 2, 10, 166, 323, 324, 325], "categor": [0, 5, 10, 31, 60, 166, 323], "otherswis": [0, 10, 166], "79": [0, 10, 166], "2019": [0, 6, 9, 10, 166], "2146": [0, 10, 166], "2173": [0, 10, 166], "2176": [0, 10, 166], "2183": [0, 10, 166], "143": [0, 10, 166], "2192": [0, 10, 166, 169], "2244": [0, 10, 166], "2246": [0, 10, 166, 167], "split_hierarch": [0, 5, 10], "gap": [0, 9, 10, 167, 168, 169, 323, 324, 325], "silhouett": [0, 10, 167, 168, 169, 323, 324, 325], "calinski_harabasz": [0, 10, 167, 168, 169], "davies_bouldin": [0, 10, 167, 168, 169], "bic": [0, 10, 167, 168, 169], "distance_threshold": [0, 10, 167], "max_n_clusters_estim": [0, 10, 167, 168, 169], "observ": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 167, 292, 323, 324, 325], "try": [0, 5, 10, 167, 168, 169, 323, 324], "optim": [0, 9, 10, 167, 168, 169, 323, 324], "appropri": [0, 5, 10, 167, 168, 169, 323, 324, 325], "1718": [0, 10, 167], "608": [0, 10, 167], "1979": [0, 10, 167], "347": [0, 10, 167], "2094": [0, 10, 167], "2110": [0, 10, 167], "2156": [0, 10, 167], "2191": [0, 10, 167], "2195": [0, 10, 167], "2223": [0, 10, 167], "2224": [0, 10, 167], "2252": [0, 10, 167, 169], "2286": [0, 10, 167], "center": [0, 10, 73, 167, 323, 324, 325], "split_kmean": [0, 5, 10, 324], "n_init": [0, 10, 168, 169], "max_it": [0, 10, 168, 169], "300": [0, 10, 74, 75, 168, 169], "determinist": [0, 10, 168, 169, 323], "consecut": [0, 5, 10, 168, 169], "inertia": [0, 10, 168, 169], "1801": [0, 10, 168], "316": [0, 10, 168], "267": [0, 10, 168], "2185": [0, 10, 168], "2186": [0, 10, 168], "2219": [0, 10, 168], "2225": [0, 10, 168], "2250": [0, 10, 168], "67": [0, 10, 168], "2276": [0, 10, 168], "split_kmedoid": [0, 5, 10], "1967": [0, 10, 169], "359": [0, 9, 10, 169], "2071": [0, 10, 169], "2131": [0, 10, 169], "2145": [0, 10, 169], "169": [0, 10, 169], "2159": [0, 10, 169], "2182": [0, 10, 169], "144": [0, 10, 169], "136": [0, 10, 169], "2268": [0, 10, 169], "2275": [0, 10, 169], "wbgene00000017": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000024": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000010": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000020": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000029": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324], "wbgene00000019": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000023": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000025": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000014": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000027": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000021": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000012": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000026": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000007": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000008": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "wbgene00000013": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000011": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000015": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324], "wbgene00000018": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000016": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305], "wbgene00000028": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000022": [0, 10, 170, 171, 175, 215, 216, 220, 256, 257, 261, 300, 301, 305, 324, 325], "wbgene00000009": [0, 10, 170, 175, 215, 220, 256, 261, 300, 305, 324, 325], "tail": [0, 10, 324, 325], "2236": [0, 10, 171, 216, 257, 301, 324, 325], "185837": [0, 10, 171, 216, 257, 301, 324], "477374": [0, 10, 171, 216, 257, 301, 324, 325], "910000e": [0, 10, 171, 216, 257, 301, 324], "81": [0, 10, 171, 216, 257, 301, 324, 325], "460000e": [0, 10, 171, 216, 257, 301, 324], "343": [0, 10, 171, 216, 257, 301, 324, 325], "648987": [0, 10, 171, 216, 257, 301, 324], "037191": [0, 10, 171, 216, 257, 301, 324], "320000e": [0, 10, 171, 216, 257, 301, 324], "142856": [0, 10, 171, 216, 257, 301, 324], "352044": [0, 10, 171, 216, 257, 301, 324, 325], "580000e": [0, 10, 171, 216, 257, 301, 324], "120000e": [0, 10, 171, 216, 257, 301, 324], "71": [0, 10, 171, 216, 257, 301, 324, 325], "219": [0, 10, 171, 216, 257, 301, 324, 325], "163200": [0, 10, 171, 216, 257, 301, 324], "913657": [0, 10, 171, 216, 257, 301, 324, 325], "420000e": [0, 10, 171, 216, 257, 301, 324], "1066": [0, 10, 171, 216, 257, 301, 324], "242402": [0, 10, 171, 216, 257, 301, 324], "811281": [0, 10, 171, 216, 257, 301, 324], "813048": [0, 10, 171, 216, 257, 301, 324], "101303": [0, 10, 171, 216, 257, 301, 324, 325], "740000e": [0, 10, 171, 216, 257, 301, 324], "3168": [0, 10, 171, 216, 257, 301, 324, 325], "566714": [0, 10, 171, 216, 257, 301, 324], "906719": [0, 10, 171, 216, 257, 301, 324, 325], "600000e": [0, 10, 171, 216, 257, 301, 324], "340000e": [0, 10, 171, 216, 257, 301, 324], "925724": [0, 10, 171, 216, 257, 301, 324], "801676": [0, 10, 171, 216, 257, 301, 324, 325], "230000e": [0, 10, 171, 216, 257, 301, 324], "820000e": [0, 10, 171, 216, 257, 301, 324], "text_filt": [0, 10], "text": [0, 2, 5, 10, 77, 172, 217, 258, 302, 324, 325], "ew": [0, 10, 172, 217, 258, 302], "ac3": [0, 10, 172, 217, 258, 302], "ln": [0, 10, 173, 218, 259, 303, 323], "callabl": [0, 10, 173, 218, 259, 303], "function_kwarg": [0, 10, 173, 218, 259, 303], "logx": [0, 10, 173, 218, 259, 303], "taken": [0, 10, 173, 218, 259, 303, 324, 325], "filt_log10": [0, 10, 173, 218, 259], "lambda": [0, 10, 173, 218, 259], "translate_gene_id": [0, 5, 10], "translate_to": [0, 10, 37, 69, 174, 219, 260, 304], "translate_from": [0, 10, 37, 69, 174, 219, 260, 304], "anoth": [0, 5, 8, 10, 19, 26, 28, 29, 36, 37, 48, 55, 57, 58, 68, 69, 174, 177, 219, 260, 304, 323, 324, 325], "servic": [0, 9, 10, 37, 69, 174, 219, 260, 304, 325], "choos": [0, 5, 8, 10, 37, 69, 174, 219, 260, 304, 323], "fail": [0, 2, 5, 10, 37, 69, 174, 219, 260, 304], "violin_plot": [0, 5, 10], "log_10": [0, 10, 176], "insid": [0, 5, 7, 10, 176], "log2fc_col": [0, 10, 177, 198, 324], "padj_col": [0, 10, 177, 198, 324], "suppress_warn": [0, 10, 130, 177, 198, 262, 282], "deseq": [0, 10, 177, 222], "filter_abs_log2_fold_chang": [0, 10, 324], "abslog2fc": [0, 10, 183, 268], "log2fc": [0, 10, 183, 268], "went": [0, 5, 10, 183, 268], "sample_deseq": [0, 10, 183, 191, 194], "filter_fold_change_direct": [0, 10, 324], "filter_signific": [0, 10, 324], "did": [0, 5, 10, 194, 323, 324], "significantli": [0, 5, 10, 194, 221, 292, 323, 324, 325], "split_fold_change_direct": [0, 10, 324], "filteirng": [0, 10, 214], "volcano_plot": [0, 5, 10, 324], "log2fc_threshold": [0, 10, 221], "volcano": [0, 5, 10, 221, 323, 325], "adj": [0, 10, 221], "upregul": [0, 10, 221, 323, 324], "downregul": [0, 10, 221, 323], "paint": [0, 10, 221], "regul": [0, 10, 221, 323, 324, 325], "numerator_nam": [0, 10, 262, 282], "denominator_nam": [0, 10, 262, 282], "incorrect": [0, 5, 10, 262], "fc_1": [0, 10, 268, 276, 292, 299, 324], "randomization_test": [0, 10, 324], "rep": [0, 10, 292], "10000": [0, 10, 24, 30, 40, 53, 59, 72, 292], "examin": [0, 5, 6, 10, 292, 324], "background": [0, 4, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292], "repetit": [0, 10, 292, 324, 325], "000": [0, 10, 292, 324, 325], "dir": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292], "prompt": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 292, 323, 324, 325], "f_background": [0, 10, 292, 324], "f_test": [0, 10, 292, 324], "rand_test_r": [0, 10, 292, 324], "806873": [0, 10, 292, 324], "360264": [0, 10, 292, 324], "pos_log2fc": [0, 10, 299], "neg_log2fc": [0, 10, 299], "filter_typ": [0, 10, 306, 308, 324], "collect": [0, 10, 306], "_apply_filter_norm_sort": 0, "filter_object": [0, 10, 308], "other_output": 0, "other_cnt": 0, "_apply_oth": 0, "recursive_cal": 0, "counter": [0, 324, 325], "call": [0, 2, 5, 7, 323, 324, 325], "_apply_split": 0, "correspod": [0, 10, 307], "virtual": [0, 10, 307], "apply_to": [0, 5, 10, 307, 324], "unkeyword": [0, 10, 307], "col1": [0, 10, 307], "ident": [0, 10, 308, 323, 324], "noth": [0, 10, 308], "d_filter": [0, 10, 308, 324], "ontologi": [0, 5, 9, 10, 11, 24, 53, 65, 74, 75, 323, 324, 325], "tissu": [0, 10, 11, 323], "phenotyp": [0, 10, 11], "gene_set": [0, 10, 12, 41, 324], "set_nam": [0, 5, 10, 12, 15, 41, 44, 324], "preform": [0, 10, 12, 41], "func_kwarg": 0, "update_kwarg": 0, "self": 0, "en": [0, 10, 14, 18, 25, 35, 38, 43, 47, 54, 67, 70, 324, 325], "change_set_nam": [0, 5, 10], "new_nam": [0, 10, 15, 44], "clear": [0, 5, 325], "shallow": [0, 17, 46], "rankedset": [0, 4, 5, 10, 18, 25, 35], "against": [0, 10, 18, 24, 25, 30, 31, 35, 38, 40, 47, 53, 54, 59, 60, 67, 70, 72, 324, 325], "compar": [0, 1, 9, 10, 18, 25, 35, 38, 47, 54, 65, 66, 67, 70, 324, 325], "en2": [0, 10, 18, 25, 35, 38, 47, 54, 67, 70], "difference_upd": 0, "unlik": [0, 20, 49, 323, 324, 325], "rais": [0, 5, 10, 20, 31, 32, 33, 40, 49, 60, 61, 62, 64, 72], "except": [0, 5, 20, 49, 324], "go_enrich": [0, 5, 10, 324], "statistical_test": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "fisher": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "hypergeometr": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "background_gen": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 324], "biotype_ref_path": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72], "aspect": [0, 5, 10, 24, 53, 65, 74, 323], "biological_process": [0, 10, 24, 53, 65, 74], "cellular_compon": [0, 10, 24, 53, 65, 74], "molecular_funct": [0, 10, 24, 53, 65, 74], "exclude_unannotated_gen": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "return_nonsignific": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "return_fig": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 324, 325], "plot_horizont": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "show_expect": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "bar": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 323, 324, 325], "lollipop": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "plot_ontology_graph": [0, 10, 24, 53, 65, 324, 325], "ontology_graph_format": [0, 10, 24, 53, 65, 324, 325], "pdf": [0, 5, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "png": [0, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "svg": [0, 5, 10, 24, 30, 53, 59, 65, 66, 74, 75, 324, 325], "randomization_rep": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "deplet": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 324, 325], "via": [0, 2, 7, 9, 10, 24, 53, 65, 324, 325], "solr": [0, 10, 24, 53, 65], "engin": [0, 10, 24, 53, 65], "golr": [0, 10, 24, 53, 65], "variabl": [0, 10, 24, 30, 31, 40, 53, 59, 60, 72, 323, 324, 325], "benjamini": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "hochberg": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "step": [0, 1, 2, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 323, 325], "fdr": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "clariti": [0, 1, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "linear": [0, 5, 9, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 324, 325], "smallest": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 323, 324, 325], "some": [0, 2, 5, 7, 8, 10, 24, 30, 40, 53, 59, 72, 323, 324, 325], "cannot": [0, 2, 10, 24, 30, 31, 40, 53, 59, 60, 72, 323, 324, 325], "associ": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "practic": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "sinc": [0, 2, 5, 7, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323, 324, 325], "unannot": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "chanc": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 323], "spuriou": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72], "depict": [0, 10, 24, 30, 53, 59, 65, 66, 323, 324, 325], "additon": [0, 10, 24, 30, 53, 59, 65, 66, 74, 75], "horizont": [0, 5, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "vertic": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73, 324, 325], "shown": [0, 10, 24, 30, 40, 53, 59, 64, 65, 66, 72, 73], "pseudorandom": [0, 10, 24, 53], "get": [0, 5, 6, 7, 9, 10, 24, 53, 323, 324, 325], "repitit": [0, 10, 24, 30, 40, 53, 59, 72, 324, 325], "return_figur": [0, 10, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72], "common": [0, 5, 10, 25, 54, 312, 323, 324, 325], "intersection_upd": 0, "isdisjoint": 0, "null": [0, 27, 56], "issubset": 0, "report": [0, 5, 6, 7, 9, 28, 29, 57, 58], "issuperset": 0, "kegg_enrich": [0, 10, 324], "plot_pathway_graph": [0, 10, 30, 59, 66], "pathway_graphs_format": [0, 10, 30, 59, 66], "encyclopedia": [0, 10, 30, 59, 66, 325], "non_categorical_enrich": [0, 10, 324], "parametric_test": [0, 10, 31, 60, 324, 325], "attr_ref_path": [0, 10, 31, 40, 60, 64, 72, 324], "plot_log_scal": [0, 10, 31, 60, 324, 325], "interleav": [0, 10, 31, 60, 324, 325], "n_bin": [0, 10, 31, 60], "sign": [0, 10, 31, 60, 324, 325], "parametr": [0, 10, 31, 60, 324, 325], "logarithm": [0, 5, 10, 31, 60, 323, 324, 325], "histogram": [0, 10, 31, 60, 323, 324, 325], "semi": [0, 10, 31, 60, 323], "obsrev": [0, 10, 31, 60], "pop": [0, 5, 323, 325], "arbitrari": [0, 32, 61], "keyerror": [0, 32, 33, 61, 62], "empti": [0, 5, 32, 61, 323, 324, 325], "save_txt": [0, 10, 324], "doesn": [0, 10, 34, 63, 323, 324, 325], "ONE": [0, 10, 35, 67], "symmetric_difference_upd": 0, "user_defined_enrich": [0, 5, 10, 324], "ranked_gen": [0, 10, 41, 324], "rank": [0, 1, 4, 5, 9, 10, 41, 324, 325], "meaning": [0, 10, 41, 323, 324, 325], "vector": [0, 10], "single_set_enrich": [0, 5, 10, 324], "min_positive_gen": [0, 10, 64, 65, 66], "lowest_cutoff": [0, 10, 64, 65, 66], "xl": [0, 5, 7, 9, 10, 64, 65, 66, 324], "mhg": [0, 5, 7, 9, 10, 64, 65, 66, 324], "develop": [0, 1, 6, 10, 64, 65, 66, 323, 324, 325], "prof": [0, 7, 10, 64, 65, 66, 323, 325], "zohar": [0, 10, 64, 65, 66], "yakhini": [0, 9, 10, 64, 65, 66], "colleagu": [0, 10, 64, 65, 66], "florian": [0, 10, 64, 65, 66], "wagner": [0, 5, 9, 10, 64, 65, 66], "single_set_go_enrich": [0, 5, 10, 324], "nonparametr": [0, 10, 65, 66], "real": [0, 10, 65, 66, 323, 324, 325], "rest": [0, 10, 65, 66, 323, 324, 325], "single_set_kegg_enrich": [0, 10, 324], "_fetch_set": 0, "obj": [0, 5, 10, 76, 77], "upset_plot": [0, 5, 10, 324], "venn_diagram": [0, 5, 10, 324], "kei": [0, 10, 76, 77, 324, 325], "enrichment_bar_plot": [0, 5, 10], "results_table_path": [0, 10, 73, 74], "enrichment_score_column": [0, 10, 73, 74], "log2_fold_enrich": [0, 10, 73, 74, 324, 325], "log2_enrichment_scor": [0, 10, 73, 74], "n_bar": [0, 5, 10, 73], "center_bar": [0, 10, 73], "log_2": [0, 10, 73, 74, 75], "ylim": [0, 5, 10, 73], "asterisk": [0, 5, 10, 73, 324, 325], "around": [0, 10, 73, 323, 324, 325], "limit": [0, 5, 10, 73, 324], "gene_ontology_graph": [0, 5, 10], "graph_format": [0, 10, 74, 75], "dpi": [0, 10, 74, 75], "resolut": [0, 10, 74, 75], "inch": [0, 10, 74, 75], "kegg_pathway_graph": [0, 5, 10], "pathway_id": [0, 10, 75], "marked_gen": [0, 10, 75], "set_color": [0, 10, 76, 77], "colorlist": [0, 10, 76, 77], "upset": [0, 5, 8, 10, 76, 323, 325], "show_percentag": [0, 10, 76], "attr_ref_table_path": [0, 10, 76, 77], "fig": [0, 10, 76, 77], "gene1": [0, 2, 10, 12, 41, 76, 77, 324], "gene2": [0, 2, 10, 12, 41, 76, 77, 324], "gene3": [0, 2, 10, 76, 77, 324], "name_of_attribute_from_reference_t": [0, 10, 76, 77], "iif": [0, 10, 76], "subset": [0, 1, 8, 10, 76, 77, 324, 325], "mix": [0, 5, 10, 76], "entir": [0, 5, 10, 76, 323, 325], "onto": [0, 10, 76, 77], "plt": [0, 10, 76], "add_outlin": [0, 10, 77], "linecolor": [0, 10, 77], "linestyl": [0, 10, 77], "solid": [0, 10, 77], "dash": [0, 10, 77], "linewidth": [0, 10, 77], "set_fonts": [0, 10, 77], "subset_fonts": [0, 10, 77], "normalize_to": [0, 10, 77], "venn": [0, 5, 8, 9, 10, 77, 325], "diagram": [0, 5, 8, 10, 77, 325], "circl": [0, 5, 10, 77, 323, 325], "area": [0, 10, 77, 323], "outlin": [0, 5, 10, 77], "widdth": [0, 10, 77], "ax": [0, 5, 10, 77, 323], "sometim": [0, 5, 10, 77], "tune": [0, 5, 10, 77, 324, 325], "overal": [0, 5, 10, 77], "fitur": [0, 10, 77], "fit": [0, 5, 8, 10, 77, 323, 324, 325], "better": [0, 5, 10, 77, 324, 325], "venndiagram": [0, 10, 77], "patch": [0, 1, 5, 10, 77], "pars": [0, 5, 10, 312, 315, 316, 317, 325], "parse_gene_name_str": [0, 10], "daf": [0, 10, 315, 316, 324], "lin15b": [0, 10, 315], "saeg": [0, 10, 315], "lin": [0, 10, 315, 324], "15b": [0, 10, 315, 324], "cyp": [0, 10, 315], "23a1lin": [0, 10, 315], "15a": [0, 10, 315], "wbgene12345678": [0, 10, 315, 317], "ghf5h": [0, 10, 315], "23a1": [0, 10, 315], "parse_sequence_name_str": [0, 10], "y55d5a": [0, 10, 316, 324], "digit": [0, 10, 316, 317], "cele_y55d5a": [0, 10, 316], "5t23g5": [0, 10, 316], "6wbgene00000000": [0, 10, 316], "zk662": [0, 10, 316], "t23g5": [0, 10, 316, 324], "parse_wbgene_str": [0, 10, 324], "wbgene98765432wbgene00000000": [0, 10, 317], "genewbgene44444444daf": [0, 10, 317], "16a5ghb": [0, 10, 317], "wbgene55555555": [0, 10, 317], "wbgene44444444": [0, 10, 317], "wbgene98765432": [0, 10, 317], "wbgene00000000": [0, 10, 317], "print_settings_fil": [0, 10], "configur": [0, 8, 10, 318], "my_attribute_reference_table_path": [0, 10, 318, 321], "my_biotype_reference_table_path": [0, 10, 318, 322], "reset_settings_fil": [0, 10], "reset": [0, 10, 319, 325], "warn": [0, 5, 10, 103, 177, 262, 319, 323, 325], "action": [0, 5, 10, 319, 323, 324, 325], "irrevers": [0, 10, 319], "save_to_csv": [0, 10], "control": [0, 1, 10, 320, 325], "set_attr_ref_table_path": [0, 4, 10, 324], "wish": [0, 10, 321, 322, 323, 324], "set_biotype_ref_table_path": [0, 4, 10, 324], "mainli": 0, "welcom": 1, "greatli": 1, "appreci": 1, "littl": 1, "credit": [1, 6], "github": [1, 2, 5, 6, 7], "com": [1, 7, 9, 324, 325], "guyteichman": [1, 7, 9], "issu": [1, 2, 5, 103, 177, 262, 323, 324, 325], "pleas": [1, 2, 5, 7, 9, 323, 325], "system": [1, 2, 5, 7, 323, 325], "might": [1, 2, 7, 323], "troubleshoot": 1, "reproduc": [1, 2, 6, 323, 324, 325], "through": [1, 5, 7, 8, 9, 323, 324], "open": [1, 5, 6, 7, 9, 323], "whoever": 1, "offici": [1, 2, 323], "docstr": [1, 5], "web": 1, "blog": 1, "articl": [1, 324], "send": 1, "propos": 1, "scope": 1, "narrow": 1, "easier": [1, 5, 8, 323, 324, 325], "rememb": [1, 2, 323], "volunt": 1, "driven": 1, "think": 1, "rather": [1, 323], "unsort": [1, 4], "nice": 1, "thing": [1, 2, 324], "hide": 1, "gsea": 1, "enrich": [1, 4, 5, 6, 7, 9, 118, 160, 187, 231, 272], "distplot": 1, "matric": [1, 2, 4, 5, 8, 9, 323], "cell": [1, 5, 323, 324, 325], "atac": 1, "seq": [1, 7, 9, 323, 324, 325], "gener": [1, 4, 5, 6, 7, 8, 9, 24, 30, 31, 40, 53, 59, 60, 64, 65, 66, 72, 73, 74, 75, 76, 77, 91, 92, 93, 94, 95, 97, 98, 99, 104, 107, 108, 109, 111, 112, 114, 135, 137, 138, 139, 140, 142, 144, 151, 152, 155, 156, 157, 158, 165, 168, 169, 176, 180, 202, 203, 204, 205, 208, 209, 210, 221, 225, 244, 245, 246, 247, 250, 251, 252, 265, 286, 287, 288, 289, 293, 294, 295, 323], "sashimi": 1, "browser": [1, 2, 325], "custom": [1, 9, 324, 325], "As": [1, 2, 323, 325], "prinipl": 1, "futur": [1, 5, 323, 324, 325], "principl": [1, 5, 323, 324, 325], "univers": [1, 9], "usabl": [1, 5], "commonli": [1, 323, 324, 325], "linux": [1, 2, 5, 7], "maco": [1, 2, 5, 7, 9], "scenario": 1, "who": 1, "never": [1, 2, 9], "ask": [1, 5, 6, 323], "themselv": [1, 323, 324, 325], "modul": [1, 2, 4, 5, 11, 78, 102, 307, 312], "my": [1, 5, 12, 41, 323, 324], "graphic": [1, 2, 5, 6, 8, 323], "degre": [1, 323], "serv": 1, "firstli": [1, 325], "advanc": 1, "suit": [1, 9], "perhap": [1, 323], "importantli": [1, 324, 325], "know": [1, 323, 324, 325], "much": [1, 323, 324, 325], "filter": [1, 4, 5, 6, 9, 12, 14, 21, 22, 23, 24, 30, 31, 40, 41, 43, 50, 51, 52, 53, 59, 60, 72, 84, 90, 94, 95, 100, 312, 320], "readi": 1, "here": [1, 5, 323, 324, 325], "fork": 1, "repo": 1, "clone": [1, 7], "git": [1, 7], "your_name_her": 1, "virtualenv": 1, "assum": [1, 323, 324, 325], "virtualenvwrapp": 1, "mkvirtualenv": 1, "py": [1, 5, 7], "branch": 1, "checkout": 1, "bugfix": 1, "now": [1, 2, 5, 7, 8, 323, 324, 325], "flake8": 1, "tox": 1, "just": [1, 8, 324, 325], "pip": [1, 2, 6], "commit": 1, "push": 1, "meet": [1, 324, 325], "readm": 1, "rst": 1, "pypi": [1, 5, 8, 9], "coveral": 1, "io": [1, 324, 325], "sure": [1, 2, 323, 324, 325], "test_rnalysi": 1, "remind": 1, "maintain": [1, 5], "histori": [1, 8, 323, 325], "bumpvers": 1, "travi": 1, "internet": [2, 9, 325], "connect": [2, 324, 325], "command": [2, 5, 7, 8, 9, 323, 325], "troubl": [2, 7], "extend": [2, 5], "caus": [2, 5, 323], "fastq": [2, 5, 6, 7], "faq": 2, "environ": 2, "still": [2, 5, 323, 324], "submit": 2, "bug": [2, 5, 6, 9], "contact": 2, "heavi": 2, "compil": [2, 325], "unfortun": [2, 323, 324, 325], "microsoft": [2, 7, 323, 325], "restart": 2, "again": [2, 323, 325], "anaconda": 2, "miniconda": 2, "conda": 2, "numba": [2, 9], "usual": [2, 323, 324, 325], "video": [2, 5, 6, 7], "repositori": [2, 7, 9], "slow": 2, "link": [2, 5, 6, 9, 323, 324, 325], "appdata": 2, "On": [2, 7, 323, 325], "someth": 2, "roam": 2, "applic": [2, 323, 324, 325], "rnalyisi": 2, "properli": [2, 5, 323, 324, 325], "uninstal": 2, "approach": [2, 324, 325], "brows": 2, "offer": [2, 4, 6, 323, 324, 325], "larg": [2, 323, 324, 325], "imposs": 2, "fortun": [2, 323], "mark": [2, 323, 324, 325], "button": [2, 5, 7, 8, 323, 325], "hover": [2, 323, 325], "screenshot": 2, "couldn": 2, "arriv": 2, "gene4": [2, 324], "convert": [2, 5, 323, 324, 325], "convers": 2, "fairli": [2, 323], "easili": [2, 8, 324, 325], "googl": [2, 323, 325], "sheet": [2, 323, 325], "excel": [2, 5, 323, 325], "libreoffic": 2, "calc": 2, "especi": [2, 323, 324, 325], "spreadsheet": 2, "xlsx": 2, "kind": [2, 323, 324, 325], "howev": [2, 4, 323, 324, 325], "special": [2, 5], "preferr": 2, "intens": [2, 5], "task": [2, 5], "wait": [2, 9, 323], "few": [2, 5, 323, 324, 325], "minut": [2, 7, 9], "our": [2, 324, 325], "session": [2, 5, 323, 324], "compress": [2, 325], "zip": [2, 7, 325], "unzip": [2, 7, 325], "enter": [2, 7, 323, 324, 325], "rnalysis_report": [2, 325], "doubl": [2, 325], "html": [2, 323, 324, 325], "There": [2, 323, 324, 325], "pane": [2, 8, 325], "rnal": [2, 325], "close": [2, 5, 6, 323, 325], "achiev": 2, "refer": [4, 5, 6, 10, 14, 21, 24, 30, 31, 40, 43, 50, 53, 59, 60, 64, 72, 76, 77, 91, 92, 93, 99, 106, 116, 117, 135, 141, 143, 161, 179, 185, 186, 212, 224, 229, 230, 254, 264, 270, 271, 292, 297, 318, 321, 322, 323], "intestin": [4, 324, 325], "epigenet": [4, 323, 324, 325], "abut": 4, "lncrna": [4, 325], "rnalysi": [4, 5], "enrichmemt": 4, "store": [4, 324], "structur": [4, 177, 262, 324, 325], "util": [4, 5, 324, 325], "subtyp": [4, 324], "introduc": [5, 324, 325], "sever": [5, 324, 325], "read1": 5, "read2": 5, "implement": [5, 323, 324, 325], "thrill": 5, "life": [5, 323], "brief": 5, "panther": [5, 9], "extract": [5, 8, 324, 325], "vein": 5, "facilit": [5, 324, 325], "ve": 5, "person": 5, "apologi": 5, "delai": 5, "bring": 5, "reason": [5, 323], "releas": [5, 7], "schedul": 5, "august": 5, "took": 5, "patienc": 5, "been": [5, 323, 324, 325], "invalu": 5, "eager": 5, "share": [5, 6, 9, 323, 324], "excit": 5, "thank": 5, "stai": 5, "kallisto_quant_single_end": 5, "kallisto_quant_paired_end": 5, "deprac": 5, "old": 5, "freez": 5, "messag": [5, 325], "progress": [5, 323], "disappear": 5, "reach": 5, "layout": 5, "dependeci": 5, "newer": 5, "stand": [5, 6, 9, 323, 324, 325], "alon": [5, 6, 9], "invalid": 5, "discern": 5, "app": [5, 6, 9, 324], "show_exp": 5, "further": [5, 323, 324, 325], "compat": 5, "adress": 5, "relat": 5, "clearli": 5, "wrong": 5, "disabl": [5, 323], "abil": 5, "suggest": [5, 323, 324, 325], "ensur": [5, 323], "theme": 5, "address": 5, "discuss": [5, 323], "tooltip": 5, "global": [5, 9], "toggl": 5, "switch": [5, 325], "draggabl": 5, "illeg": 5, "widget": 5, "clearer": 5, "crop": 5, "outsid": 5, "visibl": 5, "neurorooki": [5, 9], "cancel": [5, 323], "chapter": [5, 324, 325], "softwar": [5, 9, 324], "unsupport": 5, "lastli": 5, "june": 5, "access": [5, 8, 9, 324], "boot": 5, "clockgen": [5, 9], "immedi": 5, "refactor": 5, "hint": 5, "parammet": 5, "sens": [5, 324, 325], "report_read_assignment_path": 5, "quickli": [5, 6, 324, 325], "reflect": [5, 323], "elaps": 5, "higli": 5, "incorrectli": 5, "belowxread": 5, "vice": 5, "versa": 5, "detect": [5, 323, 324, 325], "split_percentil": 5, "foldcangefilt": 5, "proper": 5, "recent": 5, "mac": 5, "unless": [5, 323, 325], "afterward": 5, "complexport": 5, "callinski": 5, "harabasz": 5, "davi": 5, "bouldin": 5, "bayesian": 5, "criterieon": 5, "integr": [5, 9, 325], "dialog": [5, 323, 325], "proccess": 5, "queu": 5, "job": 5, "march": 5, "1st": 5, "importerror": 5, "grei": 5, "whenev": [5, 323, 324, 325], "unabl": 5, "depend": [5, 6, 7, 323, 324, 325], "matthia": [5, 7, 9, 323, 325], "wilm": [5, 7, 9, 323, 325], "sandyl27": [5, 9], "space": 5, "characters": 5, "occasion": 5, "backend": 5, "standalon": 5, "expand": [5, 9, 323], "frequent": [5, 6], "question": [5, 6, 9, 323], "page": [5, 6, 7, 9, 323], "perl": [5, 7], "colour": 5, "obscur": 5, "newli": [5, 323], "typo": 5, "correctli": [5, 324, 325], "customiz": 5, "quick": [5, 6, 323, 324, 325], "procrss": 5, "progammat": 5, "api": [5, 6, 10, 140, 205, 247, 289, 323, 324], "made": [5, 6, 323], "speed": 5, "inherit": 5, "tightli": 5, "scratch": 5, "scree": 5, "sharpen": 5, "cach": 5, "gui": [5, 7, 8, 9, 325], "biologi": [5, 9], "section": [5, 323, 324, 325], "precis": [5, 9], "colorbar": 5, "slight": 5, "stabil": 5, "plot_enrich": 5, "differential_express": 5, "mintxoklet": [5, 9], "bipin": [5, 9], "kumar": [5, 9], "create_kallisto_index": 5, "deprec": 5, "enrich_random": [5, 324], "enrich_hypergeometr": 5, "materi": 5, "edit": [5, 8, 325], "guidelin": [5, 6], "screen": [5, 323, 325], "shorten": 5, "ellipsi": 5, "nessecari": 5, "left": [5, 323, 325], "metadata": [5, 324, 325], "date": 5, "older": 5, "overwrit": 5, "keyboard": 5, "shortcut": [5, 325], "citat": 5, "replicates_group": [5, 323, 324, 325], "filter_biotyp": 5, "queue": 5, "computation": 5, "crash": 5, "auxillari": 5, "restor": [5, 6], "renam": [5, 323, 325], "supplement": 5, "among": 5, "unweight": 5, "moreov": [5, 323, 324, 325], "slightli": 5, "runtim": 5, "randomli": [5, 324, 325], "priorit": 5, "exact": [5, 323, 324, 325], "occurs": 5, "quicker": 5, "conveni": [5, 325], "elabor": [5, 324, 325], "pattern": [5, 323, 324, 325], "perfofm": 5, "eden": [5, 9], "plo": [5, 9, 324], "biol": [5, 9], "2007": [5, 9, 323, 324, 325], "One": [5, 323, 324], "let": [5, 323, 325], "enrich_randomization_parallel": 5, "parallel_process": 5, "activ": [5, 324, 325], "six": [5, 323, 324, 325], "y_titl": 5, "data_scal": 5, "ob": [5, 324, 325], "exp": [5, 324, 325], "respect": [5, 323, 325], "boolean": [5, 324, 325], "_missing_from_biotype_refer": 5, "not_in_biotype_refer": 5, "printout": 5, "board": 5, "feature_str": 5, "abl": [5, 8, 323, 325], "depracationwarn": 5, "utf": 5, "won": [5, 8, 323], "upsetplot": [5, 9], "divis": 5, "previou": [5, 323], "stabl": 5, "upgrad": 5, "write": [5, 7, 9, 323, 324], "deseq_highlight": 5, "load_csv": 5, "predict": 5, "filter_by_ref_table_attr": 5, "split_by_ref_table_attr": 5, "norm_reads_with_size_factor": 5, "norm_reads_to_rpm": 5, "hidden": 5, "feature_name_to_wbgen": 5, "cite": [6, 324, 325], "contributor": 6, "tip": 6, "deploi": 6, "beginn": 6, "friendli": [6, 323], "undo": [6, 323, 325], "icon": [6, 325], "streamlin": 6, "bioinformat": [6, 323], "intro": 6, "word": 6, "glossari": 6, "2023": [6, 9], "02": 6, "2022": [6, 9], "2021": 6, "latest": 7, "amount": [7, 323], "z_window": 7, "z_maco": 7, "launch": [7, 9], "messagebox": 7, "past": 7, "info": 7, "anywai": 7, "corner": [7, 325], "patient": [7, 9], "dmg": [7, 9], "kindli": [7, 323, 325], "machin": 7, "graphviz": 7, "qt": 7, "imag": 7, "debian": 7, "ubuntu": 7, "sudo": 7, "apt": 7, "qt5": 7, "plugin": 7, "hat": 7, "distro": 7, "fedora": 7, "dnf": 7, "qtimageformat": 7, "squar": [7, 324, 325], "bracket": 7, "along": [7, 323, 324, 325], "consol": [7, 8, 9], "run_gui": [7, 8, 9], "Or": [7, 9, 324], "overview": [8, 9, 323, 324, 325], "entireti": [8, 325], "until": [8, 323], "moment": 8, "redo": [8, 323], "resiz": 8, "workspac": 8, "accident": 8, "worri": 8, "soon": 8, "review": [8, 324, 325], "preview": [8, 323, 325], "workflow": [8, 324, 325], "prone": [8, 324, 325], "stage": 8, "research": 9, "visualis": [9, 325], "explor": [9, 323], "profil": 9, "dimension": [9, 323], "reduct": [9, 323], "visit": 9, "simpli": [9, 323, 324, 325], "scikit": [9, 324, 325], "extra": 9, "statsmodel": 9, "joblib": 9, "tqdm": 9, "appdir": 9, "grid_strategi": 9, "pyyaml": 9, "xlmhglite": 9, "pairwisedist": 9, "typing_extens": 9, "pyqt5": 9, "qdarkstyl": 9, "defusedxml": 9, "aiohttp": 9, "aiodn": 9, "aiolimit": 9, "brotli": 9, "networkx": 9, "pyvi": 9, "tenac": 9, "teichman": 9, "cohen": 9, "ganon": 9, "o": 9, "dunski": 9, "shani": 9, "gingold": 9, "rechavi": 9, "bmc": 9, "1186": 9, "s12915": 9, "023": 9, "01574": 9, "martin": 9, "throughput": [9, 324], "embnet": 9, "journal": [9, 324], "pp": 9, "14806": 9, "ej": 9, "200": [9, 323, 324], "brai": 9, "pimentel": 9, "melst": 9, "Near": 9, "probabilist": 9, "nat": 9, "biotechnol": 9, "527": 9, "1038": 9, "nbt": 9, "langmead": 9, "salzberg": 9, "nmeth": 9, "1923": 9, "axtel": 9, "mj": 9, "740": 9, "751": 9, "035279": 9, "112": 9, "love": 9, "moder": 9, "550": 9, "s13059": 9, "0550": 9, "ritchi": 9, "phipson": 9, "wu": 9, "hu": 9, "law": 9, "shi": 9, "smyth": 9, "microarrai": 9, "studi": 9, "nucleic": 9, "acid": 9, "e47": 9, "nar": 9, "gkv007": 9, "chen": 9, "unlock": 9, "r29": 9, "mcinn": 9, "heali": 9, "astel": 9, "densiti": [9, 324, 325], "volum": 9, "1371": [9, 324], "pcbi": [9, 324], "0030039": [9, 324], "lipson": 9, "yogev": 9, "motif": 9, "e39": 9, "arxiv": [9, 324], "48550": 9, "1507": [9, 324], "07905": [9, 324], "fj": 9, "amod": 9, "aneja": 9, "austin": 9, "orimoloy": 9, "azov": 9, "barn": 9, "jan": 9, "d933": 9, "41": 9, "gkac958": 9, "thoma": 9, "ebert": 9, "muruganujan": 9, "mushayahama": 9, "albou": 9, "sci": 9, "1002": 9, "pro": 9, "4218": 9, "kress": 9, "defosset": 9, "ripp": 9, "linard": 9, "thompson": 9, "jd": 9, "portal": 9, "d411": 9, "gky1068": 9, "fuent": 9, "molina": 9, "chorostecki": 9, "u": [9, 323, 325], "capella": 9, "guti\u00e9rrez": 9, "marcet": 9, "houben": 9, "gabald\u00f3n": 9, "v5": 9, "catalogu": 9, "phylogeni": 9, "d1062": 9, "gkab966": 9, "knowledgebas": 9, "d523": 9, "gkac1052": 9, "gmail": 9, "dror": 9, "netta": 9, "shachar": 9, "cookiecutt": 9, "audreyr": 9, "pypackag": 9, "templat": 9, "from_datafram": 10, "readable_nam": 10, "filter_types_rev": 10, "clear_all_cach": 10, "clear_gui_cach": 10, "__init__": [12, 41, 79, 85, 103, 177, 222, 262, 306], "my_set": [12, 41, 324], "filter_obj": [12, 41], "my_other_set": [12, 41, 324], "deseq_pip": [306, 324], "cover": 323, "focu": 323, "nematod": [323, 324, 325], "resourc": [323, 324, 325], "exercis": [323, 325], "demonstr": [323, 324, 325], "publicli": 323, "literatur": 323, "gave": 323, "mandatori": [323, 324, 325], "later": [323, 324, 325], "dedic": [323, 325], "fpkm": 323, "actual": [323, 325], "regard": 323, "magnitud": [323, 324, 325], "everyth": 323, "unfilt": [323, 325], "conveniet": 323, "expelicitli": 323, "undon": [323, 325], "happi": [323, 325], "chose": [323, 325], "scroll": 323, "panel": 323, "reduc": [323, 324, 325], "thousand": 323, "difficult": 323, "vari": 323, "remedi": 323, "rearrang": [323, 325], "captur": [323, 324, 325], "That": 323, "standardaz": 323, "undesir": 323, "skew": 323, "neutral": 323, "largest": 323, "preceed": 323, "worth": 323, "ey": 323, "interestingli": 323, "circular": 323, "worm": 323, "hypothesi": 323, "arrang": 323, "germlin": 323, "embryo": 323, "mostli": 323, "gonad": 323, "adult": 323, "quantiti": 323, "germ": 323, "l4": 323, "prolifer": 323, "l3": 323, "pc2": 323, "spot": 323, "trend": 323, "seem": 323, "dissimilar": [323, 324, 325], "earlier": [323, 325], "unexpress": 323, "wbgene00003864": 323, "almost": 323, "embryon": 323, "skn": 323, "wbgene00004804": 323, "decid": [323, 324, 325], "unlaid": 323, "convei": 323, "had": 323, "subgroup": 323, "cycl": 323, "illustr": 323, "simplest": 323, "challeng": 323, "aren": 323, "tempor": 323, "good": [323, 325], "son": [323, 324, 325], "baek": [323, 324, 325], "anslysi": 323, "orang": 323, "neighbor": [323, 324, 325], "granular": 323, "regular": 323, "biggest": 323, "character": 323, "quit": 323, "outlier": [323, 324, 325], "hope": [323, 324, 325], "ok": [323, 325], "hsbscan": [323, 324, 325], "assumpt": [323, 324, 325], "guess": [323, 324, 325], "reveal": 323, "obviou": 323, "move": [323, 325], "emsembl": 323, "concensu": 323, "weak": [323, 324, 325], "account": [323, 324, 325], "robustli": [323, 324, 325], "robust": [323, 324, 325], "agre": 323, "half": 323, "mind": 323, "plu": 323, "enlarg": 323, "back": [323, 325], "cellular": [323, 324, 325], "molecular": [323, 324, 325], "ancestor": 323, "ran": 323, "throughout": 323, "closer": 323, "geo": 323, "caenorhabidti": 323, "stress": 323, "goal": 323, "answer": 323, "exposur": 323, "expos": 323, "osmot": 323, "gse107704": 323, "srr6348197": 323, "srr6348198": 323, "srr6348199": 323, "srr6348200": 323, "srr6348201": 323, "srr6348202": 323, "starvat": 323, "gse124178": 323, "srr8359132": 323, "srr8359133": 323, "srr8359142": 323, "srr8359134": 323, "srr8359135": 323, "srr8359136": 323, "heat": 323, "shock": 323, "gse132838": 323, "srr9310678": 323, "srr9310679": 323, "srr9310680": 323, "srr9310681": 323, "srr9310682": 323, "srr9310683": 323, "opportun": 323, "uaualli": 323, "portion": 323, "leftov": 323, "happen": 323, "prime": 323, "truseq": 323, "agatcggaagagcacacgtctgaactccagtca": 323, "10bp": 323, "didn": 323, "throw": [323, 324], "awai": 323, "agatcggaagagcgtcgtgtagggaaagagtg": 323, "reorder": 323, "proce": [323, 324, 325], "rapid": [323, 324], "physic": [323, 325], "proceed": [323, 325], "deviaton": 323, "accordingli": 323, "underneath": 323, "subfold": 323, "orient": [323, 324, 325], "languag": [323, 325], "genotyp": [323, 325], "ctrl1": [323, 325], "ctrl": [323, 325], "ctrl2": [323, 325], "ctrl3": [323, 325], "osm1": [323, 325], "osm": [323, 325], "osm2": [323, 325], "osm3": [323, 325], "prepar": [323, 325], "straight": 323, "decent": 323, "mistak": 323, "similarli": [323, 324, 325], "textbox": [323, 325], "notic": 323, "resum": 323, "hard": 323, "big": [323, 325], "seen": 323, "downregl": 323, "simplifi": [323, 325], "luckili": 323, "evolv": 323, "codon": 323, "norm": 323, "certain": [323, 324, 325], "attirbut": 323, "mock": 323, "feature_indic": [323, 324, 325], "gut": [323, 325], "wbgene0000001": [323, 324, 325], "wbgene0000002": [323, 324, 325], "wbgene0000003": [323, 324, 325], "wbgene0000004": [323, 324, 325], "wbgene0000005": [323, 324, 325], "houri": 323, "dalzel": 323, "yigit": 323, "2006": 323, "presenc": 323, "inflat": 323, "concern": 323, "18924": 323, "conclud": 323, "encompass": 323, "familiar": 323, "deeper": 323, "dive": 323, "feel": 323, "free": [323, 325], "luck": 323, "endeavor": 323, "primer": 324, "poli": 324, "unwant": 324, "sequencea": 324, "incid": 324, "atggcgttga": 324, "read1_fil": 324, "sample1read1": 324, "sample2read1": 324, "sample3read1": 324, "read2_fil": 324, "sample1read2": 324, "sample2read2": 324, "sample3read2": 324, "adapter1": 324, "atggcgt": 324, "adapter2": 324, "cgttatc": 324, "bulk": 324, "pinpoint": 324, "incredibli": 324, "transcriptome_fast": 324, "paremet": 324, "construct": 324, "ng": 324, "100bp": 324, "avg_frag_len": 324, "stdev_frag_len": 324, "preper": 324, "protocol": 324, "ultrafast": 324, "memori": [324, 325], "effici": 324, "prefix": 324, "paramat": 324, "promot": 324, "bodi": 324, "subread": 324, "furthermor": [324, 325], "paramt": 324, "glimps": [324, 325], "represent": [324, 325], "5954": 324, "17781": 324, "unaffect": 324, "unchang": [324, 325], "becam": 324, "suppos": [324, 325], "kept": [324, 325], "yet": 324, "myfold": 324, "test_deseq_below0": 324, "75basemeangt500": 324, "alternative_filenam": 324, "eahc": 324, "return_format": 324, "18129": [324, 325], "b9": [324, 325], "bioc": [324, 325], "lfcse": [324, 325], "stat": [324, 325], "044": [324, 325], "329404": [324, 325], "158938": [324, 325], "94783": [324, 325], "96e": [324, 325], "80e": [324, 325], "813": [324, 325], "291484": [324, 325], "93189": [324, 325], "74e": [324, 325], "40e": [324, 325], "567": [324, 325], "190439": [324, 325], "51433": [324, 325], "60e": [324, 325], "34e": [324, 325], "9257": [324, 325], "246313": [324, 325], "49419": [324, 325], "23e": [324, 325], "82e": [324, 325], "129606": [324, 325], "11463": [324, 325], "91e": [324, 325], "46e": [324, 325], "649": [324, 325], "03719": [324, 325], "219781": [324, 325], "3691": [324, 325], "32e": [324, 325], "70e": [324, 325], "1429": [324, 325], "347777": [324, 325], "26471": [324, 325], "58e": [324, 325], "12e": [324, 325], "1632": [324, 325], "217802": [324, 325], "96885": [324, 325], "42e": [324, 325], "insignific": [324, 325], "With": [324, 325], "capabl": [324, 325], "readthedoc": [324, 325], "master": [324, 325], "unintend": [324, 325], "nativ": [324, 325], "weren": [324, 325], "376": [324, 325], "177": [324, 325], "__no_featur": [324, 325], "__ambigu": [324, 325], "__too_low_aqu": [324, 325], "__not_align": [324, 325], "121": [324, 325], "__alignment_not_uniqu": [324, 325], "deault": 324, "uq": [324, 325], "normalize_quantil": [324, 325], "normalize_mrn": [324, 325], "sample4": [324, 325], "145": [324, 325], "9468": [324, 325], "11354": [324, 325], "14009": [324, 325], "30287": [324, 325], "557": [324, 325], "893": [324, 325], "109853": [324, 325], "277653": [324, 325], "88653": [324, 325], "96012": [324, 325], "Such": 324, "__alignment_no_uniqu": [324, 325], "varieti": [324, 325], "five_clust": 324, "len": 324, "two_clust": 324, "silhouette_clust": 324, "gap_stat_clust": 324, "evalu": [324, 325], "outcom": [324, 325], "partit": [324, 325], "eucliean": [324, 325], "simplic": [324, 325], "eucliidean": [324, 325], "cityblock": [324, 325], "heyer": [324, 325], "kruglyak": [324, 325], "yooseph": [324, 325], "1999": [324, 325], "hamm": [324, 325], "agglom": [324, 325], "aim": [324, 325], "eventu": [324, 325], "cut": [324, 325], "height": [324, 325], "specifii": [324, 325], "springer": [324, 325], "1007": [324, 325], "978": [324, 325], "642": [324, 325], "37456": [324, 325], "2_14": [324, 325], "interest": [324, 325], "1016": [324, 325], "eswa": [324, 325], "059": [324, 325], "positon": [324, 325], "agreement": [324, 325], "slope": [324, 325], "strong": [324, 325], "numerator_read": 324, "denominator_read": 324, "underli": 324, "lack": 324, "famili": 324, "mean_numerator_read": 324, "mean_denominator_read": 324, "cond3_rep1": 324, "cond3_rep2": 324, "condition1": 324, "condition2": 324, "51828": 324, "36026": 324, "column1": 324, "repr": 324, "output_dict": 324, "biotypes_1": 324, "biotypes_2": 324, "output_dict_inplac": 324, "append": 324, "someon": [324, 325], "els": [324, 325], "hyperosmot": 324, "anslys": 324, "my_filter_obj": 324, "my_python_set": 324, "wbgene0245200": 324, "wbgene00402029": 324, "third": 324, "paresd": 324, "path_to_my_fil": 324, "product": [324, 325], "6239": [324, 325], "mischaracter": [324, 325], "deem": [324, 325], "my_background_set": 324, "feature1": 324, "feature2": 324, "feature3": 324, "success": [324, 325], "oppos": [324, 325], "sucess": [324, 325], "zero": [324, 325], "topic": [324, 325], "21044043": [324, 325], "discret": [324, 325], "locomot": [324, 325], "wnt": [324, 325], "carri": [324, 325], "antioxid": [324, 325], "atp": [324, 325], "chaperon": [324, 325], "granul": [324, 325], "mitochondrion": [324, 325], "silico": [324, 325], "statement": [324, 325], "judgement": [324, 325], "homologi": [324, 325], "definit": [324, 325], "iea": [324, 325], "ikr": [324, 325], "explicit": [324, 325], "complex": [324, 325], "organel": [324, 325], "somewhat": [324, 325], "cyclic": [324, 325], "hexos": [324, 325], "biosynthet": [324, 325], "metabol": [324, 325], "said": [324, 325], "upstream": [324, 325], "rate": [324, 325], "deal": [324, 325], "problem": [324, 325], "compromis": [324, 325], "propagation_method": [324, 325], "barplot": [324, 325], "0001556": [324, 325], "oocyt": [324, 325], "1327": [324, 325], "319": [324, 325], "49722119558": [324, 325], "0000999": [324, 325], "0043186": [324, 325], "244": [324, 325], "46013879322": [324, 325], "cel00010": [324, 325], "glycolysi": [324, 325], "gluconeogenesi": [324, 325], "cel00030": [324, 325], "pentos": [324, 325], "phosphat": [324, 325], "retreiv": [324, 325], "peform": [324, 325], "neuron": [324, 325], "attirubt": [324, 325], "student": [324, 325], "wbgene00003002": 324, "wbgene00004201": 324, "wbgene00300139": 324, "union_result": 324, "inher": 324, "behav": 324, "ploscompbiol": 324, "my_ranked_set": 324, "my_list": 324, "comapr": [324, 325], "ranked_set": 324, "wbgene00000106": 324, "wbgene00000041": 324, "wbgene00000105": 324, "go_en_result": 324, "en_result": 324, "plot_enrichment_result": 324, "emploi": 324, "sets_to_visu": 324, "parser": 324, "insensit": [324, 325], "the_new_attribute_reference_table_path": 324, "the_new_biotype_reference_table_path": 324, "read_attr_ref_table_path": 324, "read_biotype_ref_table_path": 324, "attr_table_path": 324, "the_attribute_reference_table_path_that_was_saved_in_the_settings_fil": 324, "biotype_table_path": 324, "the_biotype_reference_table_path_that_was_saved_in_the_settings_fil": 324, "wbgene00023495": 324, "my_str": 324, "wbgene00000002wbgene00000003": 324, "wbgene00000004g": 324, "wbgene000000002": 324, "freeli": 325, "log2folcchang": 325, "effort": 325, "independ": 325, "fc": 325, "creation": 325, "saw": 325, "sophist": 325, "mention": 325, "essenti": 325, "mine": 325, "notabl": 325, "intermedi": 325, "arrow": 325, "flow": 325, "drag": 325, "wheel": 325, "readjust": 325, "simul": 325, "wil": 325}, "objects": {"rnalysis": [[11, 0, 0, "-", "enrichment"], [78, 0, 0, "-", "fastq"], [102, 0, 0, "-", "filtering"], [312, 0, 0, "-", "general"]], "rnalysis.enrichment": [[12, 1, 1, "", "FeatureSet"], [41, 1, 1, "", "RankedSet"], [73, 3, 1, "", "enrichment_bar_plot"], [74, 3, 1, "", "gene_ontology_graph"], [75, 3, 1, "", "kegg_pathway_graph"], [76, 3, 1, "", "upset_plot"], [77, 3, 1, "", "venn_diagram"]], "rnalysis.enrichment.FeatureSet": [[12, 2, 1, "", "__init__"], [13, 2, 1, "", "add"], [14, 2, 1, "", "biotypes_from_ref_table"], [15, 2, 1, "", "change_set_name"], [16, 2, 1, "", "clear"], [17, 2, 1, "", "copy"], [18, 2, 1, "", "difference"], [19, 2, 1, "", "difference_update"], [20, 2, 1, "", "discard"], [21, 2, 1, "", "filter_by_attribute"], [22, 2, 1, "", "filter_by_go_annotations"], [23, 2, 1, "", "filter_by_kegg_annotations"], [24, 2, 1, "", "go_enrichment"], [25, 2, 1, "", "intersection"], [26, 2, 1, "", "intersection_update"], [27, 2, 1, "", "isdisjoint"], [28, 2, 1, "", "issubset"], [29, 2, 1, "", "issuperset"], [30, 2, 1, "", "kegg_enrichment"], [31, 2, 1, "", "non_categorical_enrichment"], [32, 2, 1, "", "pop"], [33, 2, 1, "", "remove"], [34, 2, 1, "", "save_txt"], [35, 2, 1, "", "symmetric_difference"], [36, 2, 1, "", "symmetric_difference_update"], [37, 2, 1, "", "translate_gene_ids"], [38, 2, 1, "", "union"], [39, 2, 1, "", "update"], [40, 2, 1, "", "user_defined_enrichment"]], "rnalysis.enrichment.RankedSet": [[41, 2, 1, "", "__init__"], [42, 2, 1, "", "add"], [43, 2, 1, "", "biotypes_from_ref_table"], [44, 2, 1, "", "change_set_name"], [45, 2, 1, "", "clear"], [46, 2, 1, "", "copy"], [47, 2, 1, "", "difference"], [48, 2, 1, "", "difference_update"], [49, 2, 1, "", "discard"], [50, 2, 1, "", "filter_by_attribute"], [51, 2, 1, "", "filter_by_go_annotations"], [52, 2, 1, "", "filter_by_kegg_annotations"], [53, 2, 1, "", "go_enrichment"], [54, 2, 1, "", "intersection"], [55, 2, 1, "", "intersection_update"], [56, 2, 1, "", "isdisjoint"], [57, 2, 1, "", "issubset"], [58, 2, 1, "", "issuperset"], [59, 2, 1, "", "kegg_enrichment"], [60, 2, 1, "", "non_categorical_enrichment"], [61, 2, 1, "", "pop"], [62, 2, 1, "", "remove"], [63, 2, 1, "", "save_txt"], [64, 2, 1, "", "single_set_enrichment"], [65, 2, 1, "", "single_set_go_enrichment"], [66, 2, 1, "", "single_set_kegg_enrichment"], [67, 2, 1, "", "symmetric_difference"], [68, 2, 1, "", "symmetric_difference_update"], [69, 2, 1, "", "translate_gene_ids"], [70, 2, 1, "", "union"], [71, 2, 1, "", "update"], [72, 2, 1, "", "user_defined_enrichment"]], "rnalysis.fastq": [[79, 1, 1, "", "PairedEndPipeline"], [85, 1, 1, "", "SingleEndPipeline"], [91, 3, 1, "", "bowtie2_align_paired_end"], [92, 3, 1, "", "bowtie2_align_single_end"], [93, 3, 1, "", "bowtie2_create_index"], [94, 3, 1, "", "featurecounts_paired_end"], [95, 3, 1, "", "featurecounts_single_end"], [96, 3, 1, "", "kallisto_create_index"], [97, 3, 1, "", "kallisto_quantify_paired_end"], [98, 3, 1, "", "kallisto_quantify_single_end"], [99, 3, 1, "", "shortstack_align_smallrna"], [100, 3, 1, "", "trim_adapters_paired_end"], [101, 3, 1, "", "trim_adapters_single_end"]], "rnalysis.fastq.PairedEndPipeline": [[79, 2, 1, "", "__init__"], [80, 2, 1, "", "add_function"], [81, 2, 1, "", "apply_to"], [82, 2, 1, "", "export_pipeline"], [83, 2, 1, "", "import_pipeline"], [84, 2, 1, "", "remove_last_function"]], "rnalysis.fastq.SingleEndPipeline": [[85, 2, 1, "", "__init__"], [86, 2, 1, "", "add_function"], [87, 2, 1, "", "apply_to"], [88, 2, 1, "", "export_pipeline"], [89, 2, 1, "", "import_pipeline"], [90, 2, 1, "", "remove_last_function"]], "rnalysis.filtering": [[103, 1, 1, "", "CountFilter"], [177, 1, 1, "", "DESeqFilter"], [222, 1, 1, "", "Filter"], [262, 1, 1, "", "FoldChangeFilter"], [306, 1, 1, "", "Pipeline"]], "rnalysis.filtering.CountFilter": [[103, 2, 1, "", "__init__"], [104, 2, 1, "", "average_replicate_samples"], [105, 2, 1, "", "biotypes_from_gtf"], [106, 2, 1, "", "biotypes_from_ref_table"], [107, 2, 1, "", "box_plot"], [108, 2, 1, "", "clustergram"], [109, 2, 1, "", "describe"], [110, 2, 1, "", "difference"], [111, 2, 1, "", "differential_expression_deseq2"], [112, 2, 1, "", "differential_expression_limma_voom"], [113, 2, 1, "", "drop_columns"], [114, 2, 1, "", "enhanced_box_plot"], [115, 2, 1, "", "filter_biotype_from_gtf"], [116, 2, 1, "", "filter_biotype_from_ref_table"], [117, 2, 1, "", "filter_by_attribute"], [118, 2, 1, "", "filter_by_go_annotations"], [119, 2, 1, "", "filter_by_kegg_annotations"], [120, 2, 1, "", "filter_by_row_name"], [121, 2, 1, "", "filter_by_row_sum"], [122, 2, 1, "", "filter_duplicate_ids"], [123, 2, 1, "", "filter_low_reads"], [124, 2, 1, "", "filter_missing_values"], [125, 2, 1, "", "filter_percentile"], [126, 2, 1, "", "filter_top_n"], [127, 2, 1, "", "find_paralogs_ensembl"], [128, 2, 1, "", "find_paralogs_panther"], [129, 2, 1, "", "fold_change"], [130, 2, 1, "", "from_dataframe"], [131, 2, 1, "", "from_folder"], [132, 2, 1, "", "from_folder_htseqcount"], [133, 2, 1, "", "head"], [134, 2, 1, "", "intersection"], [135, 2, 1, "", "ma_plot"], [136, 2, 1, "", "majority_vote_intersection"], [137, 2, 1, "", "map_orthologs_ensembl"], [138, 2, 1, "", "map_orthologs_orthoinspector"], [139, 2, 1, "", "map_orthologs_panther"], [140, 2, 1, "", "map_orthologs_phylomedb"], [141, 2, 1, "", "normalize_median_of_ratios"], [142, 2, 1, "", "normalize_rle"], [143, 2, 1, "", "normalize_tmm"], [144, 2, 1, "", "normalize_to_quantile"], [145, 2, 1, "", "normalize_to_rpkm"], [146, 2, 1, "", "normalize_to_rpm"], [147, 2, 1, "", "normalize_to_rpm_htseqcount"], [148, 2, 1, "", "normalize_to_tpm"], [149, 2, 1, "", "normalize_with_scaling_factors"], [150, 2, 1, "", "number_filters"], [151, 2, 1, "", "pairplot"], [152, 2, 1, "", "pca"], [153, 2, 1, "", "plot_expression"], [154, 2, 1, "", "print_features"], [155, 2, 1, "", "save_csv"], [156, 2, 1, "", "save_parquet"], [157, 2, 1, "", "save_table"], [158, 2, 1, "", "scatter_sample_vs_sample"], [159, 2, 1, "", "sort"], [160, 2, 1, "", "sort_by_principal_component"], [161, 2, 1, "", "split_by_attribute"], [162, 2, 1, "", "split_by_percentile"], [163, 2, 1, "", "split_by_principal_components"], [164, 2, 1, "", "split_by_reads"], [165, 2, 1, "", "split_clicom"], [166, 2, 1, "", "split_hdbscan"], [167, 2, 1, "", "split_hierarchical"], [168, 2, 1, "", "split_kmeans"], [169, 2, 1, "", "split_kmedoids"], [170, 2, 1, "", "symmetric_difference"], [171, 2, 1, "", "tail"], [172, 2, 1, "", "text_filters"], [173, 2, 1, "", "transform"], [174, 2, 1, "", "translate_gene_ids"], [175, 2, 1, "", "union"], [176, 2, 1, "", "violin_plot"]], "rnalysis.filtering.DESeqFilter": [[177, 2, 1, "", "__init__"], [178, 2, 1, "", "biotypes_from_gtf"], [179, 2, 1, "", "biotypes_from_ref_table"], [180, 2, 1, "", "describe"], [181, 2, 1, "", "difference"], [182, 2, 1, "", "drop_columns"], [183, 2, 1, "", "filter_abs_log2_fold_change"], [184, 2, 1, "", "filter_biotype_from_gtf"], [185, 2, 1, "", "filter_biotype_from_ref_table"], [186, 2, 1, "", "filter_by_attribute"], [187, 2, 1, "", "filter_by_go_annotations"], [188, 2, 1, "", "filter_by_kegg_annotations"], [189, 2, 1, "", "filter_by_row_name"], [190, 2, 1, "", "filter_duplicate_ids"], [191, 2, 1, "", "filter_fold_change_direction"], [192, 2, 1, "", "filter_missing_values"], [193, 2, 1, "", "filter_percentile"], [194, 2, 1, "", "filter_significant"], [195, 2, 1, "", "filter_top_n"], [196, 2, 1, "", "find_paralogs_ensembl"], [197, 2, 1, "", "find_paralogs_panther"], [198, 2, 1, "", "from_dataframe"], [199, 2, 1, "", "head"], [200, 2, 1, "", "intersection"], [201, 2, 1, "", "majority_vote_intersection"], [202, 2, 1, "", "map_orthologs_ensembl"], [203, 2, 1, "", "map_orthologs_orthoinspector"], [204, 2, 1, "", "map_orthologs_panther"], [205, 2, 1, "", "map_orthologs_phylomedb"], [206, 2, 1, "", "number_filters"], [207, 2, 1, "", "print_features"], [208, 2, 1, "", "save_csv"], [209, 2, 1, "", "save_parquet"], [210, 2, 1, "", "save_table"], [211, 2, 1, "", "sort"], [212, 2, 1, "", "split_by_attribute"], [213, 2, 1, "", "split_by_percentile"], [214, 2, 1, "", "split_fold_change_direction"], [215, 2, 1, "", "symmetric_difference"], [216, 2, 1, "", "tail"], [217, 2, 1, "", "text_filters"], [218, 2, 1, "", "transform"], [219, 2, 1, "", "translate_gene_ids"], [220, 2, 1, "", "union"], [221, 2, 1, "", "volcano_plot"]], "rnalysis.filtering.Filter": [[222, 2, 1, "", "__init__"], [223, 2, 1, "", "biotypes_from_gtf"], [224, 2, 1, "", "biotypes_from_ref_table"], [225, 2, 1, "", "describe"], [226, 2, 1, "", "difference"], [227, 2, 1, "", "drop_columns"], [228, 2, 1, "", "filter_biotype_from_gtf"], [229, 2, 1, "", "filter_biotype_from_ref_table"], [230, 2, 1, "", "filter_by_attribute"], [231, 2, 1, "", "filter_by_go_annotations"], [232, 2, 1, "", "filter_by_kegg_annotations"], [233, 2, 1, "", "filter_by_row_name"], [234, 2, 1, "", "filter_duplicate_ids"], [235, 2, 1, "", "filter_missing_values"], [236, 2, 1, "", "filter_percentile"], [237, 2, 1, "", "filter_top_n"], [238, 2, 1, "", "find_paralogs_ensembl"], [239, 2, 1, "", "find_paralogs_panther"], [240, 2, 1, "", "from_dataframe"], [241, 2, 1, "", "head"], [242, 2, 1, "", "intersection"], [243, 2, 1, "", "majority_vote_intersection"], [244, 2, 1, "", "map_orthologs_ensembl"], [245, 2, 1, "", "map_orthologs_orthoinspector"], [246, 2, 1, "", "map_orthologs_panther"], [247, 2, 1, "", "map_orthologs_phylomedb"], [248, 2, 1, "", "number_filters"], [249, 2, 1, "", "print_features"], [250, 2, 1, "", "save_csv"], [251, 2, 1, "", "save_parquet"], [252, 2, 1, "", "save_table"], [253, 2, 1, "", "sort"], [254, 2, 1, "", "split_by_attribute"], [255, 2, 1, "", "split_by_percentile"], [256, 2, 1, "", "symmetric_difference"], [257, 2, 1, "", "tail"], [258, 2, 1, "", "text_filters"], [259, 2, 1, "", "transform"], [260, 2, 1, "", "translate_gene_ids"], [261, 2, 1, "", "union"]], "rnalysis.filtering.FoldChangeFilter": [[262, 2, 1, "", "__init__"], [263, 2, 1, "", "biotypes_from_gtf"], [264, 2, 1, "", "biotypes_from_ref_table"], [265, 2, 1, "", "describe"], [266, 2, 1, "", "difference"], [267, 2, 1, "", "drop_columns"], [268, 2, 1, "", "filter_abs_log2_fold_change"], [269, 2, 1, "", "filter_biotype_from_gtf"], [270, 2, 1, "", "filter_biotype_from_ref_table"], [271, 2, 1, "", "filter_by_attribute"], [272, 2, 1, "", "filter_by_go_annotations"], [273, 2, 1, "", "filter_by_kegg_annotations"], [274, 2, 1, "", "filter_by_row_name"], [275, 2, 1, "", "filter_duplicate_ids"], [276, 2, 1, "", "filter_fold_change_direction"], [277, 2, 1, "", "filter_missing_values"], [278, 2, 1, "", "filter_percentile"], [279, 2, 1, "", "filter_top_n"], [280, 2, 1, "", "find_paralogs_ensembl"], [281, 2, 1, "", "find_paralogs_panther"], [282, 2, 1, "", "from_dataframe"], [283, 2, 1, "", "head"], [284, 2, 1, "", "intersection"], [285, 2, 1, "", "majority_vote_intersection"], [286, 2, 1, "", "map_orthologs_ensembl"], [287, 2, 1, "", "map_orthologs_orthoinspector"], [288, 2, 1, "", "map_orthologs_panther"], [289, 2, 1, "", "map_orthologs_phylomedb"], [290, 2, 1, "", "number_filters"], [291, 2, 1, "", "print_features"], [292, 2, 1, "", "randomization_test"], [293, 2, 1, "", "save_csv"], [294, 2, 1, "", "save_parquet"], [295, 2, 1, "", "save_table"], [296, 2, 1, "", "sort"], [297, 2, 1, "", "split_by_attribute"], [298, 2, 1, "", "split_by_percentile"], [299, 2, 1, "", "split_fold_change_direction"], [300, 2, 1, "", "symmetric_difference"], [301, 2, 1, "", "tail"], [302, 2, 1, "", "text_filters"], [303, 2, 1, "", "transform"], [304, 2, 1, "", "translate_gene_ids"], [305, 2, 1, "", "union"]], "rnalysis.filtering.Pipeline": [[306, 2, 1, "", "__init__"], [307, 2, 1, "", "add_function"], [308, 2, 1, "", "apply_to"], [309, 2, 1, "", "export_pipeline"], [310, 2, 1, "", "import_pipeline"], [311, 2, 1, "", "remove_last_function"]], "rnalysis.general": [[313, 3, 1, "", "clear_all_cache"], [314, 3, 1, "", "clear_gui_cache"], [315, 3, 1, "", "parse_gene_name_string"], [316, 3, 1, "", "parse_sequence_name_string"], [317, 3, 1, "", "parse_wbgene_string"], [318, 3, 1, "", "print_settings_file"], [319, 3, 1, "", "reset_settings_file"], [320, 3, 1, "", "save_to_csv"], [321, 3, 1, "", "set_attr_ref_table_path"], [322, 3, 1, "", "set_biotype_ref_table_path"]]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:function"}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "function", "Python function"]}, "titleterms": {"api": 0, "refer": [0, 324, 325], "rnalysi": [0, 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325], "fastq": [0, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 323, 324], "modul": [0, 6, 10, 324, 325], "filter": [0, 8, 10, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 323, 324, 325], "enrich": [0, 2, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 323, 324, 325], "gener": [0, 2, 10, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 324, 325], "util": 0, "how": [1, 2, 7, 9], "can": [1, 2, 9], "i": [1, 2, 9, 324, 325], "contribut": 1, "type": [1, 2, 8, 324, 325], "report": [1, 2, 8, 323, 325], "bug": 1, "fix": [1, 5], "write": 1, "document": [1, 6], "submit": 1, "feedback": 1, "implement": 1, "featur": [1, 2, 324], "idea": 1, "To": 1, "do": [1, 2, 9], "design": 1, "philosophi": 1, "get": [1, 2], "start": [1, 2, 6, 8, 323], "pull": 1, "request": 1, "guidelin": 1, "tip": 1, "deploi": 1, "frequent": 2, "ask": 2, "question": 2, "instal": [2, 7, 9], "an": [2, 8, 324, 325], "error": 2, "messag": 2, "when": 2, "try": 2, "what": [2, 9, 324, 325], "hdbscan": [2, 323, 324, 325], "random": [2, 324], "am": 2, "open": [2, 8, 325], "first": 2, "time": [2, 8, 323], "take": 2, "long": 2, "load": [2, 8, 324, 325], "doesn": 2, "t": 2, "all": 2, "should": 2, "previou": 2, "version": 2, "usag": 2, "view": [2, 324, 325], "quick": [2, 8], "guid": [2, 8, 324, 325], "see": 2, "onli": 2, "blank": 2, "page": 2, "appli": [2, 8, 323, 324, 325], "function": [2, 325], "my": 2, "data": [2, 8, 323, 324, 325], "tabl": [2, 6, 8, 324, 325], "know": 2, "differ": [2, 8, 18, 47, 110, 181, 226, 266], "parmet": 2, "want": 2, "us": [2, 9, 324, 325], "particular": 2, "statist": [2, 324, 325], "method": [2, 324, 325], "algorithm": 2, "avail": 2, "exactli": 2, "doe": 2, "work": [2, 8, 324, 325], "file": [2, 323, 324, 325], "format": [2, 325], "ar": [2, 323], "support": 2, "analyz": [2, 8, 325], "run": [2, 7, 323], "cluster": [2, 323, 324, 325], "other": [2, 8], "progress": 2, "bar": 2, "appear": 2, "noth": 2, "happen": 2, "ran": 2, "problem": 2, "specifi": 2, "here": 2, "automat": 2, "analysi": [2, 8, 323, 324, 325], "share": [2, 8, 325], "access": [2, 325], "figur": 2, "need": 2, "manual": 2, "edit": 2, "crash": 2, "dure": 2, "restor": [2, 8], "creat": [2, 8, 323, 324, 325], "through": [2, 325], "programmat": [2, 4, 324], "interfac": [2, 4, 8, 324, 325], "index": [3, 324], "glossari": 4, "histori": [5, 6], "3": [5, 6], "10": [5, 6], "1": [5, 6, 323], "2023": 5, "11": 5, "22": 5, "ad": 5, "0": 5, "31": 5, "chang": [5, 6, 8, 324], "9": 5, "2": [5, 323], "06": 5, "23": 5, "19": 5, "09": 5, "new": [5, 8, 324, 325], "contributor": [5, 9], "8": 5, "05": 5, "07": 5, "7": 5, "04": 5, "6": 5, "03": 5, "25": 5, "5": 5, "02": 5, "08": 5, "4": 5, "01": 5, "remov": [5, 33, 62, 323], "2022": 5, "12": 5, "16": 5, "2021": 5, "2020": 5, "27": 5, "28": 5, "2019": 5, "about": 6, "indic": [6, 324], "stand": 7, "alon": 7, "app": 7, "most": 7, "beginn": 7, "friendli": 7, "further": 7, "guidanc": 7, "python": 7, "packag": [7, 10], "pip": 7, "best": 7, "perform": [7, 8, 324, 325], "from": [7, 324, 325], "sourc": 7, "video": 8, "program": 8, "examin": [8, 323, 325], "your": [8, 324, 325], "undo": 8, "oper": [8, 324, 325], "you": 8, "place": 8, "save": [8, 324], "made": [8, 324, 325], "multipl": [8, 324, 325], "same": 8, "offer": 8, "wai": 8, "graph": 8, "quickli": 8, "look": 8, "up": 8, "gene": [8, 323, 324, 325], "databas": [8, 324, 325], "choic": 8, "sort": [8, 159, 211, 253, 296], "tab": 8, "icon": 8, "close": 8, "import": [8, 324, 325], "list": 8, "set": [8, 323, 324, 325], "visual": [8, 323, 324, 325], "intersect": [8, 25, 54, 134, 200, 242, 284, 324, 325], "between": [8, 323], "pipelin": [8, 306, 307, 308, 309, 310, 311, 323, 324, 325], "streamlin": 8, "one": 8, "more": 8, "export": [8, 325], "make": 8, "reproduc": 8, "bioinformat": 8, "tool": 8, "interact": [8, 325], "depend": 9, "credit": 9, "cite": 9, "develop": 9, "lead": 9, "featureset": [12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 324], "add": [13, 42], "biotypes_from_ref_t": [14, 43, 106, 179, 224, 264], "change_set_nam": [15, 44], "clear": [16, 45], "copi": [17, 46, 325], "difference_upd": [19, 48], "discard": [20, 49], "filter_by_attribut": [21, 50, 117, 186, 230, 271], "filter_by_go_annot": [22, 51, 118, 187, 231, 272], "filter_by_kegg_annot": [23, 52, 119, 188, 232, 273], "go_enrich": [24, 53], "intersection_upd": [26, 55], "isdisjoint": [27, 56], "issubset": [28, 57], "issuperset": [29, 58], "kegg_enrich": [30, 59], "non_categorical_enrich": [31, 60], "pop": [32, 61], "save_txt": [34, 63], "symmetric_differ": [35, 67, 170, 215, 256, 300], "symmetric_difference_upd": [36, 68], "translate_gene_id": [37, 69, 174, 219, 260, 304], "union": [38, 70, 175, 220, 261, 305], "updat": [39, 71], "user_defined_enrich": [40, 72], "rankedset": [41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 324], "single_set_enrich": 64, "single_set_go_enrich": 65, "single_set_kegg_enrich": 66, "enrichment_bar_plot": 73, "gene_ontology_graph": 74, "kegg_pathway_graph": 75, "upset_plot": 76, "venn_diagram": 77, "pairedendpipelin": [79, 80, 81, 82, 83, 84], "add_funct": [80, 86, 307], "apply_to": [81, 87, 308], "export_pipelin": [82, 88, 309], "import_pipelin": [83, 89, 310], "remove_last_funct": [84, 90, 311], "singleendpipelin": [85, 86, 87, 88, 89, 90], "bowtie2_align_paired_end": 91, "bowtie2_align_single_end": 92, "bowtie2_create_index": 93, "featurecounts_paired_end": 94, "featurecounts_single_end": 95, "kallisto_create_index": 96, "kallisto_quantify_paired_end": 97, "kallisto_quantify_single_end": 98, "shortstack_align_smallrna": 99, "trim_adapters_paired_end": 100, "trim_adapters_single_end": 101, "countfilt": [103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 324], "average_replicate_sampl": 104, "biotypes_from_gtf": [105, 178, 223, 263], "box_plot": 107, "clustergram": 108, "describ": [109, 180, 225, 265], "differential_expression_deseq2": 111, "differential_expression_limma_voom": 112, "drop_column": [113, 182, 227, 267], "enhanced_box_plot": 114, "filter_biotype_from_gtf": [115, 184, 228, 269], "filter_biotype_from_ref_t": [116, 185, 229, 270], "filter_by_row_nam": [120, 189, 233, 274], "filter_by_row_sum": 121, "filter_duplicate_id": [122, 190, 234, 275], "filter_low_read": 123, "filter_missing_valu": [124, 192, 235, 277], "filter_percentil": [125, 193, 236, 278], "filter_top_n": [126, 195, 237, 279], "find_paralogs_ensembl": [127, 196, 238, 280], "find_paralogs_panth": [128, 197, 239, 281], "fold_chang": 129, "from_datafram": [130, 198, 240, 282], "from_fold": 131, "from_folder_htseqcount": 132, "head": [133, 199, 241, 283], "ma_plot": 135, "majority_vote_intersect": [136, 201, 243, 285], "map_orthologs_ensembl": [137, 202, 244, 286], "map_orthologs_orthoinspector": [138, 203, 245, 287], "map_orthologs_panth": [139, 204, 246, 288], "map_orthologs_phylomedb": [140, 205, 247, 289], "normalize_median_of_ratio": 141, "normalize_rl": 142, "normalize_tmm": 143, "normalize_to_quantil": 144, "normalize_to_rpkm": 145, "normalize_to_rpm": 146, "normalize_to_rpm_htseqcount": 147, "normalize_to_tpm": 148, "normalize_with_scaling_factor": 149, "number_filt": [150, 206, 248, 290], "pairplot": 151, "pca": 152, "plot_express": 153, "print_featur": [154, 207, 249, 291], "save_csv": [155, 208, 250, 293], "save_parquet": [156, 209, 251, 294], "save_t": [157, 210, 252, 295], "scatter_sample_vs_sampl": 158, "sort_by_principal_compon": 160, "split_by_attribut": [161, 212, 254, 297], "split_by_percentil": [162, 213, 255, 298], "split_by_principal_compon": 163, "split_by_read": 164, "split_clicom": 165, "split_hdbscan": 166, "split_hierarch": 167, "split_kmean": 168, "split_kmedoid": 169, "tail": [171, 216, 257, 301], "text_filt": [172, 217, 258, 302], "transform": [173, 218, 259, 303], "violin_plot": 176, "deseqfilt": [177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 324], "filter_abs_log2_fold_chang": [183, 268], "filter_fold_change_direct": [191, 276], "filter_signific": 194, "split_fold_change_direct": [214, 299], "volcano_plot": 221, "foldchangefilt": [262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 324], "randomization_test": 292, "clear_all_cach": 313, "clear_gui_cach": 314, "parse_gene_name_str": 315, "parse_sequence_name_str": 316, "parse_wbgene_str": 317, "print_settings_fil": 318, "reset_settings_fil": 319, "save_to_csv": 320, "set_attr_ref_table_path": 321, "set_biotype_ref_table_path": 322, "A": 323, "z": 323, "tutori": 323, "exampl": 323, "intro": 323, "recommend": 323, "seri": 323, "rna": [323, 324], "sequenc": [323, 324], "The": 323, "dataset": [323, 324, 325], "preprocess": 323, "exploratori": [323, 324, 325], "out": 323, "lowli": 323, "express": [323, 324, 325], "varianc": 323, "our": 323, "princip": 323, "compon": 323, "similar": 323, "development": 323, "stage": 323, "compar": 323, "specif": 323, "over": 323, "simpl": 323, "approach": 323, "distanc": [323, 324, 325], "base": 323, "k": [323, 324, 325], "medoid": [323, 324, 325], "fine": 323, "tune": 323, "densiti": 323, "complex": 323, "ensembl": 323, "clicom": [323, 324, 325], "differenti": [323, 325], "quantifi": 323, "qualiti": 323, "control": 323, "fastqc": 323, "trim": [323, 324], "adapt": [323, 324], "low": 323, "read": [323, 324], "cutadapt": [323, 324], "kallisto": [323, 324], "deseq2": [323, 324, 325], "custom": 323, "extract": 323, "interesct": 323, "venn": [323, 324], "diagram": [323, 324], "subset": 323, "we": 323, "interest": 323, "defin": [323, 324, 325], "background": [323, 324, 325], "attribut": [323, 324, 325], "final": 323, "word": 323, "user": [324, 325], "singl": [324, 325], "end": 324, "pair": 324, "quantif": 324, "build": 324, "acquir": 324, "align": 324, "bowtie2": 324, "count": [324, 325], "featurecount": 324, "object": 324, "initi": 324, "result": 324, "biotyp": [324, 325], "output": [324, 325], "csv": [324, 325], "uniqu": [324, 325], "matric": [324, 325], "folder": [324, 325], "htseq": [324, 325], "txt": [324, 325], "pre": [324, 325], "normal": [324, 325], "mean": [324, 325], "hierarch": [324, 325], "special": [324, 325], "metric": [324, 325], "fold": 324, "exist": 324, "test": [324, 325], "sequenti": [324, 325], "go": [324, 325], "correct": [324, 325], "organ": [324, 325], "id": [324, 325], "choos": [324, 325], "option": [324, 325], "term": [324, 325], "aspect": [324, 325], "annot": [324, 325], "evid": [324, 325], "code": [324, 325], "qualifi": [324, 325], "propag": [324, 325], "plot": [324, 325], "paramet": [324, 325], "kegg": [324, 325], "pathwai": [324, 325], "which": [324, 325], "calcul": [324, 325], "non": [324, 325], "categor": [324, 325], "visualis": 324, "without": [324, 325], "upset": 324, "default": [324, 325], "path": 324, "pars": 324, "c": 324, "elegan": 324, "name": 324, "wbgene": 324, "regular": 324, "graphic": 325, "workspac": 325, "gtf": 325, "summar": 325, "matrix": 325, "enabl": 325, "session": 325}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx": 57}, "alltitles": {"How can I contribute to RNAlysis?": [[1, "how-can-i-contribute-to-rnalysis"]], "Types of Contributions": [[1, "types-of-contributions"]], "Report Bugs": [[1, "report-bugs"]], "Fix Bugs": [[1, "fix-bugs"]], "Write Documentation": [[1, "write-documentation"]], "Submit Feedback": [[1, "submit-feedback"]], "Implement Features": [[1, "implement-features"]], "Ideas/To-Do": [[1, "ideas-to-do"]], "RNAlysis Design Philosophy": [[1, "rnalysis-design-philosophy"]], "Get Started!": [[1, "get-started"]], "Pull Request Guidelines": [[1, "pull-request-guidelines"]], "Tips": [[1, "tips"]], "Deploying": [[1, "deploying"]], "Frequently asked questions": [[2, "frequently-asked-questions"]], "Installation": [[2, "installation"], [7, "installation"]], "I get an error message when I try to install RNAlysis. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-rnalysis-what-can-i-do"]], "I get an error message when I try to install the RNAlysis hdbscan feature. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-the-rnalysis-hdbscan-feature-what-can-i-do"]], "I get an error message when I try to install the RNAlysis randomization feature. what can I do?": [[2, "i-get-an-error-message-when-i-try-to-install-the-rnalysis-randomization-feature-what-can-i-do"]], "I am trying to open RNAlysis for the first time and it takes a long time to load/doesn\u2019t load at all. What should I do?": [[2, "i-am-trying-to-open-rnalysis-for-the-first-time-and-it-takes-a-long-time-to-load-doesn-t-load-at-all-what-should-i-do"]], "Can I install a previous version of RNAlysis?": [[2, "can-i-install-a-previous-version-of-rnalysis"]], "Usage": [[2, "usage"]], "I am trying to view the RNAlysis quick-start guide, but see only blank pages. What should I do?": [[2, "i-am-trying-to-view-the-rnalysis-quick-start-guide-but-see-only-blank-pages-what-should-i-do"]], "I am trying to apply a function to my data table. How do I know what all the different functions and parmeters do?": [[2, "i-am-trying-to-apply-a-function-to-my-data-table-how-do-i-know-what-all-the-different-functions-and-parmeters-do"]], "I want to use a particular statistical method or algorithm available in RNAlysis. How do I know exactly what it does and how it works?": [[2, "i-want-to-use-a-particular-statistical-method-or-algorithm-available-in-rnalysis-how-do-i-know-exactly-what-it-does-and-how-it-works"]], "What file formats are supported by RNAlysis?": [[2, "what-file-formats-are-supported-by-rnalysis"]], "What types of tables can I analyze with RNAlysis?": [[2, "what-types-of-tables-can-i-analyze-with-rnalysis"]], "When trying to run clustering/enrichment/other functions in RNAlysis, a progress bar appears but nothing happens. What can I do?": [[2, "when-trying-to-run-clustering-enrichment-other-functions-in-rnalysis-a-progress-bar-appears-but-nothing-happens-what-can-i-do"]], "I ran into a problem that is not specified here. What can I do?": [[2, "i-ran-into-a-problem-that-is-not-specified-here-what-can-i-do"]], "Automatic analysis reports": [[2, "automatic-analysis-reports"]], "How can I generate an analysis report?": [[2, "how-can-i-generate-an-analysis-report"]], "How can I view an analysis report?": [[2, "how-can-i-view-an-analysis-report"]], "How can I share an analysis report?": [[2, "how-can-i-share-an-analysis-report"]], "How can I access the data and figures that appear in an analysis report?": [[2, "how-can-i-access-the-data-and-figures-that-appear-in-an-analysis-report"]], "Do I need to generate analysis reports manually?": [[2, "do-i-need-to-generate-analysis-reports-manually"]], "Can I edit my analysis report?": [[2, "can-i-edit-my-analysis-report"]], "RNAlysis crashed during an analysis! Can I restore my automatic analysis report?": [[2, "rnalysis-crashed-during-an-analysis-can-i-restore-my-automatic-analysis-report"]], "Can I create an analysis report through the programmatic interface?": [[2, "can-i-create-an-analysis-report-through-the-programmatic-interface"]], "Index": [[3, "index"]], "Glossary - programmatic interface": [[4, "glossary-programmatic-interface"]], "RNAlysis 3.10.1 documentation": [[6, "rnalysis-release-documentation"]], "About RNAlysis:": [[6, null]], "Starting with RNAlysis:": [[6, null]], "Change history:": [[6, null]], "Modules:": [[6, "modules"]], "Indices and tables:": [[6, null]], "RNAlysis stand-alone app (most beginner-friendly)": [[7, "rnalysis-stand-alone-app-most-beginner-friendly"]], "How to install it": [[7, "how-to-install-it"], [7, "id1"], [7, "id3"]], "How to run it": [[7, "how-to-run-it"], [7, "id2"], [7, "id4"]], "Further guidance": [[7, "further-guidance"]], "Install as a Python package with pip (best performance)": [[7, "install-as-a-python-package-with-pip-best-performance"]], "From sources": [[7, "from-sources"]], "RNAlysis quick-start video guide": [[8, "rnalysis-quick-start-video-guide"]], "Open the program": [[8, "open-the-program"]], "Load a table": [[8, "load-a-table"]], "Examine your table": [[8, "examine-your-table"]], "Filter your table": [[8, "filter-your-table"]], "Undo the operations you applied to your table": [[8, "undo-the-operations-you-applied-to-your-table"]], "Apply your operations \u2018in-place\u2019 or apply on a new table": [[8, "apply-your-operations-in-place-or-apply-on-a-new-table"]], "Save the changes you made to your table": [[8, "save-the-changes-you-made-to-your-table"]], "Work on multiple tables at the same time": [[8, "work-on-multiple-tables-at-the-same-time"]], "Different types of tables offer different ways to filter and analyze your data": [[8, "different-types-of-tables-offer-different-ways-to-filter-and-analyze-your-data"]], "Create and save graphs": [[8, "create-and-save-graphs"]], "Quickly look-up genes in your database of choice": [[8, "quickly-look-up-genes-in-your-database-of-choice"]], "Sort your tabs and change their icons": [[8, "sort-your-tabs-and-change-their-icons"]], "Restore tabs you closed": [[8, "restore-tabs-you-closed"]], "Import lists of genes as Gene Sets": [[8, "import-lists-of-genes-as-gene-sets"]], "Visualize the intersections between your tables and gene sets": [[8, "visualize-the-intersections-between-your-tables-and-gene-sets"]], "Apply set operations to your tables and gene sets": [[8, "apply-set-operations-to-your-tables-and-gene-sets"]], "Perform enrichment analysis on your tables and gene sets": [[8, "perform-enrichment-analysis-on-your-tables-and-gene-sets"]], "Create Pipelines to streamline your data analysis": [[8, "create-pipelines-to-streamline-your-data-analysis"]], "Apply Pipelines to one or more of your tables": [[8, "apply-pipelines-to-one-or-more-of-your-tables"]], "Export and share Pipelines to make your analysis more reproducible": [[8, "export-and-share-pipelines-to-make-your-analysis-more-reproducible"]], "Interface with other bioinformatic tools": [[8, "interface-with-other-bioinformatic-tools"]], "Create an interactive analysis report": [[8, "create-an-interactive-analysis-report"]], "What is RNAlysis?": [[9, "what-is-rnalysis"]], "What can I do with RNAlysis?": [[9, "what-can-i-do-with-rnalysis"]], "How do I install it?": [[9, "how-do-i-install-it"]], "How do I use it?": [[9, "how-do-i-use-it"]], "Dependencies": [[9, "dependencies"]], "Credits": [[9, "credits"]], "How do I cite RNAlysis?": [[9, "how-do-i-cite-rnalysis"]], "Development Lead": [[9, "development-lead"]], "Contributors": [[9, "contributors"]], "rnalysis.enrichment": [[11, "rnalysis-enrichment"]], "rnalysis.enrichment.FeatureSet": [[12, "rnalysis-enrichment-featureset"]], "rnalysis.enrichment.FeatureSet.add": [[13, "rnalysis-enrichment-featureset-add"]], "rnalysis.enrichment.FeatureSet.biotypes_from_ref_table": [[14, "rnalysis-enrichment-featureset-biotypes-from-ref-table"]], "rnalysis.enrichment.FeatureSet.change_set_name": [[15, "rnalysis-enrichment-featureset-change-set-name"]], "rnalysis.enrichment.FeatureSet.clear": [[16, "rnalysis-enrichment-featureset-clear"]], "rnalysis.enrichment.FeatureSet.copy": [[17, "rnalysis-enrichment-featureset-copy"]], "rnalysis.enrichment.FeatureSet.difference": [[18, "rnalysis-enrichment-featureset-difference"]], "rnalysis.enrichment.FeatureSet.difference_update": [[19, "rnalysis-enrichment-featureset-difference-update"]], "rnalysis.enrichment.FeatureSet.discard": [[20, "rnalysis-enrichment-featureset-discard"]], "rnalysis.enrichment.FeatureSet.filter_by_attribute": [[21, "rnalysis-enrichment-featureset-filter-by-attribute"]], "rnalysis.enrichment.FeatureSet.filter_by_go_annotations": [[22, "rnalysis-enrichment-featureset-filter-by-go-annotations"]], "rnalysis.enrichment.FeatureSet.filter_by_kegg_annotations": [[23, "rnalysis-enrichment-featureset-filter-by-kegg-annotations"]], "rnalysis.enrichment.FeatureSet.go_enrichment": [[24, "rnalysis-enrichment-featureset-go-enrichment"]], "rnalysis.enrichment.FeatureSet.intersection": [[25, "rnalysis-enrichment-featureset-intersection"]], "rnalysis.enrichment.FeatureSet.intersection_update": [[26, "rnalysis-enrichment-featureset-intersection-update"]], "rnalysis.enrichment.FeatureSet.isdisjoint": [[27, "rnalysis-enrichment-featureset-isdisjoint"]], "rnalysis.enrichment.FeatureSet.issubset": [[28, "rnalysis-enrichment-featureset-issubset"]], "rnalysis.enrichment.FeatureSet.issuperset": [[29, "rnalysis-enrichment-featureset-issuperset"]], "rnalysis.enrichment.FeatureSet.kegg_enrichment": [[30, "rnalysis-enrichment-featureset-kegg-enrichment"]], "rnalysis.enrichment.FeatureSet.non_categorical_enrichment": [[31, "rnalysis-enrichment-featureset-non-categorical-enrichment"]], "rnalysis.enrichment.FeatureSet.pop": [[32, "rnalysis-enrichment-featureset-pop"]], "rnalysis.enrichment.FeatureSet.remove": [[33, "rnalysis-enrichment-featureset-remove"]], "rnalysis.enrichment.FeatureSet.save_txt": [[34, "rnalysis-enrichment-featureset-save-txt"]], "rnalysis.enrichment.FeatureSet.symmetric_difference": [[35, "rnalysis-enrichment-featureset-symmetric-difference"]], "rnalysis.enrichment.FeatureSet.symmetric_difference_update": [[36, "rnalysis-enrichment-featureset-symmetric-difference-update"]], "rnalysis.enrichment.FeatureSet.translate_gene_ids": [[37, "rnalysis-enrichment-featureset-translate-gene-ids"]], "rnalysis.enrichment.FeatureSet.union": [[38, "rnalysis-enrichment-featureset-union"]], "rnalysis.enrichment.FeatureSet.update": [[39, "rnalysis-enrichment-featureset-update"]], "rnalysis.enrichment.FeatureSet.user_defined_enrichment": [[40, "rnalysis-enrichment-featureset-user-defined-enrichment"]], "rnalysis.enrichment.RankedSet": [[41, "rnalysis-enrichment-rankedset"]], "rnalysis.enrichment.RankedSet.add": [[42, "rnalysis-enrichment-rankedset-add"]], "rnalysis.enrichment.RankedSet.biotypes_from_ref_table": [[43, "rnalysis-enrichment-rankedset-biotypes-from-ref-table"]], "rnalysis.enrichment.RankedSet.change_set_name": [[44, "rnalysis-enrichment-rankedset-change-set-name"]], "rnalysis.enrichment.RankedSet.clear": [[45, "rnalysis-enrichment-rankedset-clear"]], "rnalysis.enrichment.RankedSet.copy": [[46, "rnalysis-enrichment-rankedset-copy"]], "rnalysis.enrichment.RankedSet.difference": [[47, "rnalysis-enrichment-rankedset-difference"]], "rnalysis.enrichment.RankedSet.difference_update": [[48, "rnalysis-enrichment-rankedset-difference-update"]], "rnalysis.enrichment.RankedSet.discard": [[49, "rnalysis-enrichment-rankedset-discard"]], "rnalysis.enrichment.RankedSet.filter_by_attribute": [[50, "rnalysis-enrichment-rankedset-filter-by-attribute"]], "rnalysis.enrichment.RankedSet.filter_by_go_annotations": [[51, "rnalysis-enrichment-rankedset-filter-by-go-annotations"]], "rnalysis.enrichment.RankedSet.filter_by_kegg_annotations": [[52, "rnalysis-enrichment-rankedset-filter-by-kegg-annotations"]], "rnalysis.enrichment.RankedSet.go_enrichment": [[53, "rnalysis-enrichment-rankedset-go-enrichment"]], "rnalysis.enrichment.RankedSet.intersection": [[54, "rnalysis-enrichment-rankedset-intersection"]], "rnalysis.enrichment.RankedSet.intersection_update": [[55, "rnalysis-enrichment-rankedset-intersection-update"]], "rnalysis.enrichment.RankedSet.isdisjoint": [[56, "rnalysis-enrichment-rankedset-isdisjoint"]], "rnalysis.enrichment.RankedSet.issubset": [[57, "rnalysis-enrichment-rankedset-issubset"]], "rnalysis.enrichment.RankedSet.issuperset": [[58, "rnalysis-enrichment-rankedset-issuperset"]], "rnalysis.enrichment.RankedSet.kegg_enrichment": [[59, "rnalysis-enrichment-rankedset-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.non_categorical_enrichment": [[60, "rnalysis-enrichment-rankedset-non-categorical-enrichment"]], "rnalysis.enrichment.RankedSet.pop": [[61, "rnalysis-enrichment-rankedset-pop"]], "rnalysis.enrichment.RankedSet.remove": [[62, "rnalysis-enrichment-rankedset-remove"]], "rnalysis.enrichment.RankedSet.save_txt": [[63, "rnalysis-enrichment-rankedset-save-txt"]], "rnalysis.enrichment.RankedSet.single_set_enrichment": [[64, "rnalysis-enrichment-rankedset-single-set-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_go_enrichment": [[65, "rnalysis-enrichment-rankedset-single-set-go-enrichment"]], "rnalysis.enrichment.RankedSet.symmetric_difference": [[67, "rnalysis-enrichment-rankedset-symmetric-difference"]], "rnalysis.enrichment.RankedSet.symmetric_difference_update": [[68, "rnalysis-enrichment-rankedset-symmetric-difference-update"]], "rnalysis.enrichment.RankedSet.translate_gene_ids": [[69, "rnalysis-enrichment-rankedset-translate-gene-ids"]], "rnalysis.enrichment.RankedSet.union": [[70, "rnalysis-enrichment-rankedset-union"]], "rnalysis.enrichment.RankedSet.update": [[71, "rnalysis-enrichment-rankedset-update"]], "rnalysis.enrichment.RankedSet.user_defined_enrichment": [[72, "rnalysis-enrichment-rankedset-user-defined-enrichment"]], "rnalysis.enrichment.enrichment_bar_plot": [[73, "rnalysis-enrichment-enrichment-bar-plot"]], "rnalysis.enrichment.gene_ontology_graph": [[74, "rnalysis-enrichment-gene-ontology-graph"]], "rnalysis.enrichment.kegg_pathway_graph": [[75, "rnalysis-enrichment-kegg-pathway-graph"]], "rnalysis.enrichment.upset_plot": [[76, "rnalysis-enrichment-upset-plot"]], "rnalysis.enrichment.venn_diagram": [[77, "rnalysis-enrichment-venn-diagram"]], "rnalysis.fastq": [[78, "rnalysis-fastq"]], "rnalysis.fastq.PairedEndPipeline": [[79, "rnalysis-fastq-pairedendpipeline"]], "rnalysis.fastq.PairedEndPipeline.add_function": [[80, "rnalysis-fastq-pairedendpipeline-add-function"]], "rnalysis.fastq.PairedEndPipeline.apply_to": [[81, "rnalysis-fastq-pairedendpipeline-apply-to"]], "rnalysis.fastq.PairedEndPipeline.export_pipeline": [[82, "rnalysis-fastq-pairedendpipeline-export-pipeline"]], "rnalysis.fastq.PairedEndPipeline.import_pipeline": [[83, "rnalysis-fastq-pairedendpipeline-import-pipeline"]], "rnalysis.fastq.PairedEndPipeline.remove_last_function": [[84, "rnalysis-fastq-pairedendpipeline-remove-last-function"]], "rnalysis.fastq.SingleEndPipeline": [[85, "rnalysis-fastq-singleendpipeline"]], "rnalysis.fastq.SingleEndPipeline.add_function": [[86, "rnalysis-fastq-singleendpipeline-add-function"]], "rnalysis.fastq.SingleEndPipeline.apply_to": [[87, "rnalysis-fastq-singleendpipeline-apply-to"]], "rnalysis.fastq.SingleEndPipeline.export_pipeline": [[88, "rnalysis-fastq-singleendpipeline-export-pipeline"]], "rnalysis.fastq.SingleEndPipeline.import_pipeline": [[89, "rnalysis-fastq-singleendpipeline-import-pipeline"]], "rnalysis.fastq.SingleEndPipeline.remove_last_function": [[90, "rnalysis-fastq-singleendpipeline-remove-last-function"]], "rnalysis.fastq.bowtie2_align_paired_end": [[91, "rnalysis-fastq-bowtie2-align-paired-end"]], "rnalysis.fastq.bowtie2_align_single_end": [[92, "rnalysis-fastq-bowtie2-align-single-end"]], "rnalysis.fastq.bowtie2_create_index": [[93, "rnalysis-fastq-bowtie2-create-index"]], "rnalysis.fastq.featurecounts_paired_end": [[94, "rnalysis-fastq-featurecounts-paired-end"]], "rnalysis.fastq.featurecounts_single_end": [[95, "rnalysis-fastq-featurecounts-single-end"]], "rnalysis.fastq.kallisto_create_index": [[96, "rnalysis-fastq-kallisto-create-index"]], "rnalysis.fastq.kallisto_quantify_paired_end": [[97, "rnalysis-fastq-kallisto-quantify-paired-end"]], "rnalysis.fastq.kallisto_quantify_single_end": [[98, "rnalysis-fastq-kallisto-quantify-single-end"]], "rnalysis.fastq.shortstack_align_smallrna": [[99, "rnalysis-fastq-shortstack-align-smallrna"]], "rnalysis.fastq.trim_adapters_paired_end": [[100, "rnalysis-fastq-trim-adapters-paired-end"]], "rnalysis.fastq.trim_adapters_single_end": [[101, "rnalysis-fastq-trim-adapters-single-end"]], "rnalysis.filtering.Pipeline.export_pipeline": [[309, "rnalysis-filtering-pipeline-export-pipeline"]], "rnalysis.filtering.Pipeline.import_pipeline": [[310, "rnalysis-filtering-pipeline-import-pipeline"]], "rnalysis.filtering.Pipeline.remove_last_function": [[311, "rnalysis-filtering-pipeline-remove-last-function"]], "rnalysis.general": [[312, "rnalysis-general"]], "rnalysis.general.clear_all_cache": [[313, "rnalysis-general-clear-all-cache"]], "rnalysis.general.clear_gui_cache": [[314, "rnalysis-general-clear-gui-cache"]], "rnalysis.general.parse_gene_name_string": [[315, "rnalysis-general-parse-gene-name-string"]], "rnalysis.general.parse_sequence_name_string": [[316, "rnalysis-general-parse-sequence-name-string"]], "rnalysis.general.parse_wbgene_string": [[317, "rnalysis-general-parse-wbgene-string"]], "rnalysis.general.print_settings_file": [[318, "rnalysis-general-print-settings-file"]], "rnalysis.general.reset_settings_file": [[319, "rnalysis-general-reset-settings-file"]], "rnalysis.general.save_to_csv": [[320, "rnalysis-general-save-to-csv"]], "rnalysis.general.set_attr_ref_table_path": [[321, "rnalysis-general-set-attr-ref-table-path"]], "rnalysis.general.set_biotype_ref_table_path": [[322, "rnalysis-general-set-biotype-ref-table-path"]], "A-to-Z tutorial - example analysis": [[323, "a-to-z-tutorial-example-analysis"]], "Intro and recommendations": [[323, "intro-and-recommendations"]], "Analysis #1 - time series RNA sequencing": [[323, "analysis-1-time-series-rna-sequencing"]], "The dataset": [[323, "the-dataset"], [323, "id6"]], "Start RNAlysis": [[323, "start-rnalysis"]], "Data preprocessing and exploratory data analysis": [[323, "data-preprocessing-and-exploratory-data-analysis"]], "Filter out lowly-expressed genes": [[323, "filter-out-lowly-expressed-genes"]], "Examine variance in our data with Principal Component Analysis": [[323, "examine-variance-in-our-data-with-principal-component-analysis"]], "Examine similarity between developmental stages": [[323, "examine-similarity-between-developmental-stages"]], "Compare the expression of specific genes over the developmental stages": [[323, "compare-the-expression-of-specific-genes-over-the-developmental-stages"]], "Clustering analysis": [[323, "clustering-analysis"]], "The simple approach - distance-based clustering with K-Medoids": [[323, "the-simple-approach-distance-based-clustering-with-k-medoids"]], "Fine-tuning our approach - density-based clustering with HDBSCAN": [[323, "fine-tuning-our-approach-density-based-clustering-with-hdbscan"]], "The complex approach - ensemble-based clustering with CLICOM": [[323, "the-complex-approach-ensemble-based-clustering-with-clicom"]], "Enrichment analysis": [[323, "enrichment-analysis"], [323, "id9"], [325, "enrichment-analysis"]], "Running enrichment analysis": [[323, "running-enrichment-analysis"], [323, "id11"]], "Create analysis report": [[323, "create-analysis-report"]], "Analysis #2 - differential expression data": [[323, "analysis-2-differential-expression-data"]], "Quantify FASTQ files and Differential Expression Analysis": [[323, "quantify-fastq-files-and-differential-expression-analysis"]], "Quality control with FastQC": [[323, "quality-control-with-fastqc"]], "Trim adapters and remove low-quality reads with CutAdapt": [[323, "trim-adapters-and-remove-low-quality-reads-with-cutadapt"]], "Quantify gene expression with kallisto": [[323, "quantify-gene-expression-with-kallisto"]], "Run differential expression analysis with DESeq2": [[323, "run-differential-expression-analysis-with-deseq2"]], "Data filtering and visualization with customized Pipelines": [[323, "data-filtering-and-visualization-with-customized-pipelines"]], "Create a customized Pipeline": [[323, "create-a-customized-pipeline"]], "Apply the Pipeline to our datasets": [[323, "apply-the-pipeline-to-our-datasets"]], "Visualizing and extracting gene set interesctions": [[323, "visualizing-and-extracting-gene-set-interesctions"]], "Create a Venn diagram": [[323, "create-a-venn-diagram"]], "Extract the gene subsets we are interested in": [[323, "extract-the-gene-subsets-we-are-interested-in"]], "Define a background set": [[323, "define-a-background-set"]], "Define our custom enrichment attributes": [[323, "define-our-custom-enrichment-attributes"]], "Final words": [[323, "final-words"]], "User guide - programmatic interface": [[324, "user-guide-programmatic-interface"]], "RNAlysis fastq module": [[324, "rnalysis-fastq-module"]], "Working with the fastq module": [[324, "working-with-the-fastq-module"]], "Adapter trimming with CutAdapt": [[324, "adapter-trimming-with-cutadapt"]], "Single-end adapter trimming": [[324, "single-end-adapter-trimming"]], "Paired-end adapter trimming": [[324, "paired-end-adapter-trimming"]], "RNA sequencing quantification with kallisto": [[324, "rna-sequencing-quantification-with-kallisto"]], "Building or acquiring index files": [[324, "building-or-acquiring-index-files"], [324, "id2"]], "Single-end read quantification": [[324, "single-end-read-quantification"]], "Paired-end read quantification": [[324, "paired-end-read-quantification"]], "Read alignment with bowtie2": [[324, "read-alignment-with-bowtie2"]], "Single-end read alignment": [[324, "single-end-read-alignment"]], "Paired-end read alignment": [[324, "paired-end-read-alignment"]], "Feature counting with featureCounts": [[324, "feature-counting-with-featurecounts"]], "Single-end read feature counting": [[324, "single-end-read-feature-counting"]], "Paired-end read feature counting": [[324, "paired-end-read-feature-counting"]], "RNAlysis filtering module": [[324, "rnalysis-filtering-module"]], "Working with Filter objects": [[324, "working-with-filter-objects"]], "Initialize a Filter object": [[324, "initialize-a-filter-object"]], "View a Filter object": [[324, "view-a-filter-object"]], "Filtering operations": [[324, "filtering-operations"], [325, "filtering-operations"]], "Performing set operations on multiple Filter objects": [[324, "performing-set-operations-on-multiple-filter-objects"]], "Saving Filter results": [[324, "saving-filter-results"]], "Using an Attribute Reference Table for filter operations": [[324, "using-an-attribute-reference-table-for-filter-operations"]], "Using a Biotype Reference Table for filter operations": [[324, "using-a-biotype-reference-table-for-filter-operations"]], "Filtering DESeq2 output files with filtering.DESeqFilter": [[324, "filtering-deseq2-output-files-with-filtering-deseqfilter"]], "Loading from a csv file": [[324, "loading-from-a-csv-file"]], "Filtering operations unique to DESeqFilter": [[324, "filtering-operations-unique-to-deseqfilter"]], "Data visualization and exploratory data analysis with DESeqFilter": [[324, "data-visualization-and-exploratory-data-analysis-with-deseqfilter"]], "Filtering count matrices with filtering.CountFilter": [[324, "filtering-count-matrices-with-filtering-countfilter"]], "Generating an CountFilter object from a folder of HTSeq-count output .txt files": [[324, "generating-an-countfilter-object-from-a-folder-of-htseq-count-output-txt-files"]], "Loading from a pre-made csv file": [[324, "loading-from-a-pre-made-csv-file"]], "Filtering operations unique to CountFilter": [[324, "filtering-operations-unique-to-countfilter"]], "Normalizing reads with CountFilter": [[324, "normalizing-reads-with-countfilter"]], "Data clustering with CountFilter": [[324, "data-clustering-with-countfilter"]], "K-Means clustering": [[324, "k-means-clustering"], [325, "k-means-clustering"]], "K-Medoids clustering": [[324, "k-medoids-clustering"], [325, "k-medoids-clustering"]], "Hierarchical clustering": [[324, "hierarchical-clustering"], [325, "hierarchical-clustering"]], "HDBSCAN clustering": [[324, "hdbscan-clustering"], [325, "hdbscan-clustering"]], "CLICOM clustering": [[324, "clicom-clustering"], [325, "clicom-clustering"]], "Specialized clustering distance metrics": [[324, "specialized-clustering-distance-metrics"], [325, "specialized-clustering-distance-metrics"]], "Data visualization and exploratory data analysis with CountFilter": [[324, "data-visualization-and-exploratory-data-analysis-with-countfilter"]], "Filtering fold-change data of features using filtering.FoldChangeFilter": [[324, "filtering-fold-change-data-of-features-using-filtering-foldchangefilter"]], "Loading fold change data from a csv file": [[324, "loading-fold-change-data-from-a-csv-file"]], "Generating fold change data from an existing CountFilter object": [[324, "generating-fold-change-data-from-an-existing-countfilter-object"]], "Performing randomization tests on a FoldChangeFilter object": [[324, "performing-randomization-tests-on-a-foldchangefilter-object"]], "Sequentially applying filtering operations using Pipelines": [[324, "sequentially-applying-filtering-operations-using-pipelines"]], "Creating a new Pipeline": [[324, "creating-a-new-pipeline"], [325, "creating-a-new-pipeline"]], "Applying Pipelines to Filter objects": [[324, "applying-pipelines-to-filter-objects"]], "Importing a Pipeline": [[324, "importing-a-pipeline"], [325, "importing-a-pipeline"]], "RNAlysis enrichment module": [[324, "rnalysis-enrichment-module"]], "Working with FeatureSet objects": [[324, "working-with-featureset-objects"]], "Initialize an FeatureSet object": [[324, "initialize-an-featureset-object"]], "GO Enrichment": [[324, "go-enrichment"], [325, "go-enrichment"]], "Define the correct organism and gene ID type for your dataset": [[324, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [324, "id21"], [325, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [325, "id18"]], "Define the background set": [[324, "define-the-background-set"], [324, "id22"], [324, "id30"], [324, "id38"]], "Choose the statistical test (optional)": [[324, "choose-the-statistical-test-optional"], [324, "id23"], [324, "id31"], [324, "id39"], [325, "choose-the-statistical-test-optional"], [325, "id19"], [325, "id26"], [325, "id33"]], "Filter GO Terms by GO aspects (optional)": [[324, "filter-go-terms-by-go-aspects-optional"], [325, "filter-go-terms-by-go-aspects-optional"]], "Filter GO Annotations by Evidence Codes (optional)": [[324, "filter-go-annotations-by-evidence-codes-optional"], [325, "filter-go-annotations-by-evidence-codes-optional"]], "Filter GO Annotations by database (optional)": [[324, "filter-go-annotations-by-database-optional"], [325, "filter-go-annotations-by-database-optional"]], "Filter GO Annotations by Qualifiers (optional)": [[324, "filter-go-annotations-by-qualifiers-optional"], [325, "filter-go-annotations-by-qualifiers-optional"]], "Choose annotation propagation method (optional)": [[324, "choose-annotation-propagation-method-optional"], [325, "choose-annotation-propagation-method-optional"]], "Choose plotting parameters (optional)": [[324, "choose-plotting-parameters-optional"], [324, "id24"], [324, "id32"], [324, "id40"], [325, "choose-plotting-parameters-optional"], [325, "id20"], [325, "id27"], [325, "id34"]], "Enrichment analysis output": [[324, "enrichment-analysis-output"], [324, "id29"], [324, "id37"], [325, "enrichment-analysis-output"], [325, "id25"], [325, "id32"]], "KEGG Pathways enrichment": [[324, "kegg-pathways-enrichment"], [325, "kegg-pathways-enrichment"]], "Enrichment analysis for user-defined attributes": [[324, "enrichment-analysis-for-user-defined-attributes"], [325, "enrichment-analysis-for-user-defined-attributes"]], "Choose which user-defined attributes to calculate enrichment for": [[324, "choose-which-user-defined-attributes-to-calculate-enrichment-for"], [325, "choose-which-user-defined-attributes-to-calculate-enrichment-for"]], "Performing enrichment analysis for non-categorical user-defined attributes": [[324, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"], [325, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"]], "Choose which user-defined non-categorical attributes to calculate enrichment for": [[324, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"], [325, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"]], "Non-Categorical Enrichment analysis output": [[324, "non-categorical-enrichment-analysis-output"], [325, "non-categorical-enrichment-analysis-output"]], "Performing set operations and visualisation on multiple FeatureSet objects": [[324, "performing-set-operations-and-visualisation-on-multiple-featureset-objects"]], "Saving indices from FeatureSet to a .txt file": [[324, "saving-indices-from-featureset-to-a-txt-file"]], "Working with RankedSet objects": [[324, "working-with-rankedset-objects"]], "Initialize an RankedSet object": [[324, "initialize-an-rankedset-object"]], "Performing single-set GO Enrichment analysis without a background set": [[324, "performing-single-set-go-enrichment-analysis-without-a-background-set"]], "Performing single-set KEGG Enrichment analysis without a background set": [[324, "performing-single-set-kegg-enrichment-analysis-without-a-background-set"]], "Performing single-set enrichment analysis for user-defined attributes without a background set": [[324, "performing-single-set-enrichment-analysis-for-user-defined-attributes-without-a-background-set"]], "Visualizing sets, intersections, and enrichment": [[324, "visualizing-sets-intersections-and-enrichment"]], "Plotting results of enrichment analysis": [[324, "plotting-results-of-enrichment-analysis"]], "Plotting Venn Diagrams and UpSet Plots": [[324, "plotting-venn-diagrams-and-upset-plots"]], "RNAlysis general module": [[324, "rnalysis-general-module"]], "Set and load a Reference Table": [[324, "set-and-load-a-reference-table"], [325, "set-and-load-a-reference-table"]], "What is an Attribute Reference Table?": [[324, "what-is-an-attribute-reference-table"], [325, "what-is-an-attribute-reference-table"]], "What is a Biotype Reference Table?": [[324, "what-is-a-biotype-reference-table"], [325, "what-is-a-biotype-reference-table"]], "Set a Reference Table as default": [[324, "set-a-reference-table-as-default"], [325, "set-a-reference-table-as-default"]], "Load the default Attribute Reference Table path": [[324, "load-the-default-attribute-reference-table-path"]], "Parse C. elegans gene names, WBGene indices and sequence names using regular expressions": [[324, "parse-c-elegans-gene-names-wbgene-indices-and-sequence-names-using-regular-expressions"]], "User guide - graphical interface": [[325, "user-guide-graphical-interface"]], "Analyzing data tables with RNAlysis": [[325, "analyzing-data-tables-with-rnalysis"]], "Working with tables": [[325, "working-with-tables"]], "Loading tables into RNAlysis": [[325, "loading-tables-into-rnalysis"]], "Loading multiple tables into RNAlysis": [[325, "loading-multiple-tables-into-rnalysis"]], "Working with multiple tables and organizing your workspace": [[325, "working-with-multiple-tables-and-organizing-your-workspace"]], "Examining tables": [[325, "examining-tables"]], "Using an Attribute Reference Table to filter tables": [[325, "using-an-attribute-reference-table-to-filter-tables"]], "Using a GTF file or Biotype Reference Table to filter tables or summarize tables": [[325, "using-a-gtf-file-or-biotype-reference-table-to-filter-tables-or-summarize-tables"]], "Working with Differential Expression Tables": [[325, "working-with-differential-expression-tables"]], "Differential expression analysis using DESeq2 through RNAlysis": [[325, "differential-expression-analysis-using-deseq2-through-rnalysis"]], "Differential Expression table format": [[325, "differential-expression-table-format"]], "Filtering operations unique to Differential Expression tables": [[325, "filtering-operations-unique-to-differential-expression-tables"]], "Data visualization and exploratory data analysis with Differential Expression Tables": [[325, "data-visualization-and-exploratory-data-analysis-with-differential-expression-tables"]], "Working with count matrices": [[325, "working-with-count-matrices"]], "Generating a count matrix from a folder of HTSeq-count output .txt files": [[325, "generating-a-count-matrix-from-a-folder-of-htseq-count-output-txt-files"]], "Loading  a pre-made csv file": [[325, "loading-a-pre-made-csv-file"]], "Filtering operations unique to count matrices": [[325, "filtering-operations-unique-to-count-matrices"]], "Normalizing count matrices": [[325, "normalizing-count-matrices"]], "Clustering of count matrices": [[325, "clustering-of-count-matrices"]], "Data visualization and exploratory data analysis of count matrices": [[325, "data-visualization-and-exploratory-data-analysis-of-count-matrices"]], "Sequentially applying functions using Pipelines": [[325, "sequentially-applying-functions-using-pipelines"]], "Applying Pipelines to tables": [[325, "applying-pipelines-to-tables"]], "RNAlysis Gene Sets module": [[325, "rnalysis-gene-sets-module"]], "Working with gene sets": [[325, "working-with-gene-sets"]], "Importing gene sets into RNAlysis": [[325, "importing-gene-sets-into-rnalysis"]], "Copying gene sets from RNAlysis": [[325, "copying-gene-sets-from-rnalysis"]], "Exporting gene sets from RNAlysis": [[325, "exporting-gene-sets-from-rnalysis"]], "Visualizing gene set and table intersections": [[325, "visualizing-gene-set-and-table-intersections"]], "Performing set operations on multiple tables and gene sets": [[325, "performing-set-operations-on-multiple-tables-and-gene-sets"]], "Performing single-set enrichment analysis (enrichment without a background set)": [[325, "performing-single-set-enrichment-analysis-enrichment-without-a-background-set"]], "RNAlysis interactive analysis reports": [[325, "rnalysis-interactive-analysis-reports"]], "Enable report generation": [[325, "enable-report-generation"]], "Generate an analysis report": [[325, "generate-an-analysis-report"]], "Viewing your analysis report": [[325, "viewing-your-analysis-report"]], "Open an analysis report": [[325, "open-an-analysis-report"]], "Interacting with the analysis report": [[325, "interacting-with-the-analysis-report"]], "Access the session output files": [[325, "access-the-session-output-files"]], "Sharing your analysis report": [[325, "sharing-your-analysis-report"]], "RNAlysis settings": [[325, "rnalysis-settings"]], "API Reference": [[0, "api-reference"]], "rnalysis.fastq module": [[0, "rnalysis-fastq-module"]], "rnalysis.filtering module": [[0, "rnalysis-filtering-module"], [10, "rnalysis-filtering-module"]], "rnalysis.enrichment module": [[0, "rnalysis-enrichment-module"], [10, "rnalysis-enrichment-module"]], "rnalysis.general module": [[0, "rnalysis-general-module"], [10, "rnalysis-general-module"]], "rnalysis.utils module": [[0, "rnalysis-utils-module"]], "History": [[5, "history"]], "3.10.1 (2023-11-22)": [[5, "id1"]], "Added": [[5, "added"], [5, "id3"], [5, "id9"], [5, "id13"], [5, "id18"], [5, "id24"], [5, "id28"], [5, "id34"], [5, "id45"], [5, "id51"], [5, "id58"], [5, "id67"], [5, "id71"], [5, "id76"], [5, "id82"], [5, "id86"], [5, "id90"], [5, "id94"], [5, "id101"]], "Fixed": [[5, "fixed"], [5, "id4"], [5, "id7"], [5, "id11"], [5, "id15"], [5, "id20"], [5, "id26"], [5, "id29"], [5, "id32"], [5, "id36"], [5, "id41"], [5, "id43"], [5, "id47"], [5, "id49"], [5, "id53"], [5, "id60"], [5, "id62"], [5, "id65"], [5, "id69"], [5, "id73"], [5, "id78"], [5, "id84"], [5, "id88"], [5, "id92"], [5, "id96"], [5, "id99"], [5, "id103"]], "3.10.0 (2023-10-31)": [[5, "id2"]], "Changed": [[5, "changed"], [5, "id6"], [5, "id10"], [5, "id14"], [5, "id19"], [5, "id25"], [5, "id31"], [5, "id35"], [5, "id40"], [5, "id46"], [5, "id52"], [5, "id59"], [5, "id64"], [5, "id68"], [5, "id72"], [5, "id77"], [5, "id80"], [5, "id83"], [5, "id87"], [5, "id91"], [5, "id95"], [5, "id98"], [5, "id102"]], "3.9.2 (2023-06-23)": [[5, "id5"]], "3.9.1 (2023-06-19)": [[5, "id8"]], "3.9.0 (2023-06-09)": [[5, "id12"]], "New Contributors": [[5, "new-contributors"], [5, "id22"], [5, "id38"], [5, "id56"]], "3.8.0 (2023-05-07)": [[5, "id17"]], "3.7.0 (2023-04-07)": [[5, "id23"]], "3.6.2 (2023-03-25)": [[5, "id27"]], "3.6.1 (2023-03-22)": [[5, "id30"]], "3.6.0 (2023-03-07)": [[5, "id33"]], "3.5.2 (2023-02-23)": [[5, "id39"]], "3.5.1 (2023-02-22)": [[5, "id42"]], "3.5.0 (2023-02-08)": [[5, "id44"]], "3.4.2 (2023-02-01)": [[5, "id48"]], "3.4.0 (2023-02-01)": [[5, "id50"]], "Removed": [[5, "removed"], [5, "id104"]], "3.3.0 (2022-12-02)": [[5, "id57"]], "3.2.2 (2022-11-25)": [[5, "id61"]], "3.2.1 (2022-11-25)": [[5, "id63"]], "3.2.0 (2022-11-23)": [[5, "id66"]], "3.1.0 (2022-10-16)": [[5, "id70"]], "3.0.1 (2022-10-12)": [[5, "id74"]], "3.0.0 (2022-10-10)": [[5, "id75"]], "2.1.1 (2022-07-05)": [[5, "id79"]], "2.1.0 (2022-04-16)": [[5, "id81"]], "2.0.1 (2022-04-02)": [[5, "id85"]], "2.0.0 (2021-12-05)": [[5, "id89"]], "1.3.5 (2020-05-27)": [[5, "id93"]], "1.3.4 (2020-04-07)": [[5, "id97"]], "1.3.3 (2020-03-28)": [[5, "id100"]], "1.3.2 (2019-12-11)": [[5, "id105"]], "rnalysis package": [[10, "rnalysis-package"]], "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment": [[66, "rnalysis-enrichment-rankedset-single-set-kegg-enrichment"]], "rnalysis.filtering": [[102, "rnalysis-filtering"]], "rnalysis.filtering.CountFilter": [[103, "rnalysis-filtering-countfilter"]], "rnalysis.filtering.CountFilter.average_replicate_samples": [[104, "rnalysis-filtering-countfilter-average-replicate-samples"]], "rnalysis.filtering.CountFilter.biotypes_from_gtf": [[105, "rnalysis-filtering-countfilter-biotypes-from-gtf"]], "rnalysis.filtering.CountFilter.biotypes_from_ref_table": [[106, "rnalysis-filtering-countfilter-biotypes-from-ref-table"]], "rnalysis.filtering.CountFilter.box_plot": [[107, "rnalysis-filtering-countfilter-box-plot"]], "rnalysis.filtering.CountFilter.clustergram": [[108, "rnalysis-filtering-countfilter-clustergram"]], "rnalysis.filtering.CountFilter.describe": [[109, "rnalysis-filtering-countfilter-describe"]], "rnalysis.filtering.CountFilter.difference": [[110, "rnalysis-filtering-countfilter-difference"]], "rnalysis.filtering.CountFilter.differential_expression_deseq2": [[111, "rnalysis-filtering-countfilter-differential-expression-deseq2"]], "rnalysis.filtering.CountFilter.differential_expression_limma_voom": [[112, "rnalysis-filtering-countfilter-differential-expression-limma-voom"]], "rnalysis.filtering.CountFilter.drop_columns": [[113, "rnalysis-filtering-countfilter-drop-columns"]], "rnalysis.filtering.CountFilter.enhanced_box_plot": [[114, "rnalysis-filtering-countfilter-enhanced-box-plot"]], "rnalysis.filtering.CountFilter.filter_biotype_from_gtf": [[115, "rnalysis-filtering-countfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table": [[116, "rnalysis-filtering-countfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.CountFilter.filter_by_attribute": [[117, "rnalysis-filtering-countfilter-filter-by-attribute"]], "rnalysis.filtering.CountFilter.filter_by_go_annotations": [[118, "rnalysis-filtering-countfilter-filter-by-go-annotations"]], "rnalysis.filtering.CountFilter.filter_by_kegg_annotations": [[119, "rnalysis-filtering-countfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.CountFilter.filter_by_row_name": [[120, "rnalysis-filtering-countfilter-filter-by-row-name"]], "rnalysis.filtering.CountFilter.filter_by_row_sum": [[121, "rnalysis-filtering-countfilter-filter-by-row-sum"]], "rnalysis.filtering.CountFilter.filter_duplicate_ids": [[122, "rnalysis-filtering-countfilter-filter-duplicate-ids"]], "rnalysis.filtering.CountFilter.filter_low_reads": [[123, "rnalysis-filtering-countfilter-filter-low-reads"]], "rnalysis.filtering.CountFilter.filter_missing_values": [[124, "rnalysis-filtering-countfilter-filter-missing-values"]], "rnalysis.filtering.CountFilter.filter_percentile": [[125, "rnalysis-filtering-countfilter-filter-percentile"]], "rnalysis.filtering.CountFilter.filter_top_n": [[126, "rnalysis-filtering-countfilter-filter-top-n"]], "rnalysis.filtering.CountFilter.find_paralogs_ensembl": [[127, "rnalysis-filtering-countfilter-find-paralogs-ensembl"]], "rnalysis.filtering.CountFilter.find_paralogs_panther": [[128, "rnalysis-filtering-countfilter-find-paralogs-panther"]], "rnalysis.filtering.CountFilter.fold_change": [[129, "rnalysis-filtering-countfilter-fold-change"]], "rnalysis.filtering.CountFilter.from_dataframe": [[130, "rnalysis-filtering-countfilter-from-dataframe"]], "rnalysis.filtering.CountFilter.from_folder": [[131, "rnalysis-filtering-countfilter-from-folder"]], "rnalysis.filtering.CountFilter.from_folder_htseqcount": [[132, "rnalysis-filtering-countfilter-from-folder-htseqcount"]], "rnalysis.filtering.CountFilter.head": [[133, "rnalysis-filtering-countfilter-head"]], "rnalysis.filtering.CountFilter.intersection": [[134, "rnalysis-filtering-countfilter-intersection"]], "rnalysis.filtering.CountFilter.ma_plot": [[135, "rnalysis-filtering-countfilter-ma-plot"]], "rnalysis.filtering.CountFilter.majority_vote_intersection": [[136, "rnalysis-filtering-countfilter-majority-vote-intersection"]], "rnalysis.filtering.CountFilter.map_orthologs_ensembl": [[137, "rnalysis-filtering-countfilter-map-orthologs-ensembl"]], "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector": [[138, "rnalysis-filtering-countfilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.CountFilter.map_orthologs_panther": [[139, "rnalysis-filtering-countfilter-map-orthologs-panther"]], "rnalysis.filtering.CountFilter.map_orthologs_phylomedb": [[140, "rnalysis-filtering-countfilter-map-orthologs-phylomedb"]], "rnalysis.filtering.CountFilter.normalize_median_of_ratios": [[141, "rnalysis-filtering-countfilter-normalize-median-of-ratios"]], "rnalysis.filtering.CountFilter.normalize_rle": [[142, "rnalysis-filtering-countfilter-normalize-rle"]], "rnalysis.filtering.CountFilter.normalize_tmm": [[143, "rnalysis-filtering-countfilter-normalize-tmm"]], "rnalysis.filtering.CountFilter.normalize_to_quantile": [[144, "rnalysis-filtering-countfilter-normalize-to-quantile"]], "rnalysis.filtering.CountFilter.normalize_to_rpkm": [[145, "rnalysis-filtering-countfilter-normalize-to-rpkm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm": [[146, "rnalysis-filtering-countfilter-normalize-to-rpm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount": [[147, "rnalysis-filtering-countfilter-normalize-to-rpm-htseqcount"]], "rnalysis.filtering.CountFilter.normalize_to_tpm": [[148, "rnalysis-filtering-countfilter-normalize-to-tpm"]], "rnalysis.filtering.CountFilter.normalize_with_scaling_factors": [[149, "rnalysis-filtering-countfilter-normalize-with-scaling-factors"]], "rnalysis.filtering.CountFilter.number_filters": [[150, "rnalysis-filtering-countfilter-number-filters"]], "rnalysis.filtering.CountFilter.pairplot": [[151, "rnalysis-filtering-countfilter-pairplot"]], "rnalysis.filtering.CountFilter.pca": [[152, "rnalysis-filtering-countfilter-pca"]], "rnalysis.filtering.CountFilter.plot_expression": [[153, "rnalysis-filtering-countfilter-plot-expression"]], "rnalysis.filtering.CountFilter.print_features": [[154, "rnalysis-filtering-countfilter-print-features"]], "rnalysis.filtering.CountFilter.save_csv": [[155, "rnalysis-filtering-countfilter-save-csv"]], "rnalysis.filtering.CountFilter.save_parquet": [[156, "rnalysis-filtering-countfilter-save-parquet"]], "rnalysis.filtering.CountFilter.save_table": [[157, "rnalysis-filtering-countfilter-save-table"]], "rnalysis.filtering.CountFilter.scatter_sample_vs_sample": [[158, "rnalysis-filtering-countfilter-scatter-sample-vs-sample"]], "rnalysis.filtering.CountFilter.sort": [[159, "rnalysis-filtering-countfilter-sort"]], "rnalysis.filtering.CountFilter.sort_by_principal_component": [[160, "rnalysis-filtering-countfilter-sort-by-principal-component"]], "rnalysis.filtering.CountFilter.split_by_attribute": [[161, "rnalysis-filtering-countfilter-split-by-attribute"]], "rnalysis.filtering.CountFilter.split_by_percentile": [[162, "rnalysis-filtering-countfilter-split-by-percentile"]], "rnalysis.filtering.CountFilter.split_by_principal_components": [[163, "rnalysis-filtering-countfilter-split-by-principal-components"]], "rnalysis.filtering.CountFilter.split_by_reads": [[164, "rnalysis-filtering-countfilter-split-by-reads"]], "rnalysis.filtering.CountFilter.split_clicom": [[165, "rnalysis-filtering-countfilter-split-clicom"]], "rnalysis.filtering.CountFilter.split_hdbscan": [[166, "rnalysis-filtering-countfilter-split-hdbscan"]], "rnalysis.filtering.CountFilter.split_hierarchical": [[167, "rnalysis-filtering-countfilter-split-hierarchical"]], "rnalysis.filtering.CountFilter.split_kmeans": [[168, "rnalysis-filtering-countfilter-split-kmeans"]], "rnalysis.filtering.CountFilter.split_kmedoids": [[169, "rnalysis-filtering-countfilter-split-kmedoids"]], "rnalysis.filtering.CountFilter.symmetric_difference": [[170, "rnalysis-filtering-countfilter-symmetric-difference"]], "rnalysis.filtering.CountFilter.tail": [[171, "rnalysis-filtering-countfilter-tail"]], "rnalysis.filtering.CountFilter.text_filters": [[172, "rnalysis-filtering-countfilter-text-filters"]], "rnalysis.filtering.CountFilter.transform": [[173, "rnalysis-filtering-countfilter-transform"]], "rnalysis.filtering.CountFilter.translate_gene_ids": [[174, "rnalysis-filtering-countfilter-translate-gene-ids"]], "rnalysis.filtering.CountFilter.union": [[175, "rnalysis-filtering-countfilter-union"]], "rnalysis.filtering.CountFilter.violin_plot": [[176, "rnalysis-filtering-countfilter-violin-plot"]], "rnalysis.filtering.DESeqFilter": [[177, "rnalysis-filtering-deseqfilter"]], "rnalysis.filtering.DESeqFilter.biotypes_from_gtf": [[178, "rnalysis-filtering-deseqfilter-biotypes-from-gtf"]], "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table": [[179, "rnalysis-filtering-deseqfilter-biotypes-from-ref-table"]], "rnalysis.filtering.DESeqFilter.describe": [[180, "rnalysis-filtering-deseqfilter-describe"]], "rnalysis.filtering.DESeqFilter.difference": [[181, "rnalysis-filtering-deseqfilter-difference"]], "rnalysis.filtering.DESeqFilter.drop_columns": [[182, "rnalysis-filtering-deseqfilter-drop-columns"]], "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change": [[183, "rnalysis-filtering-deseqfilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf": [[184, "rnalysis-filtering-deseqfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table": [[185, "rnalysis-filtering-deseqfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.DESeqFilter.filter_by_attribute": [[186, "rnalysis-filtering-deseqfilter-filter-by-attribute"]], "rnalysis.filtering.DESeqFilter.filter_by_go_annotations": [[187, "rnalysis-filtering-deseqfilter-filter-by-go-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations": [[188, "rnalysis-filtering-deseqfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_row_name": [[189, "rnalysis-filtering-deseqfilter-filter-by-row-name"]], "rnalysis.filtering.DESeqFilter.filter_duplicate_ids": [[190, "rnalysis-filtering-deseqfilter-filter-duplicate-ids"]], "rnalysis.filtering.DESeqFilter.filter_fold_change_direction": [[191, "rnalysis-filtering-deseqfilter-filter-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.filter_missing_values": [[192, "rnalysis-filtering-deseqfilter-filter-missing-values"]], "rnalysis.filtering.DESeqFilter.filter_percentile": [[193, "rnalysis-filtering-deseqfilter-filter-percentile"]], "rnalysis.filtering.DESeqFilter.filter_significant": [[194, "rnalysis-filtering-deseqfilter-filter-significant"]], "rnalysis.filtering.DESeqFilter.filter_top_n": [[195, "rnalysis-filtering-deseqfilter-filter-top-n"]], "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl": [[196, "rnalysis-filtering-deseqfilter-find-paralogs-ensembl"]], "rnalysis.filtering.DESeqFilter.find_paralogs_panther": [[197, "rnalysis-filtering-deseqfilter-find-paralogs-panther"]], "rnalysis.filtering.DESeqFilter.from_dataframe": [[198, "rnalysis-filtering-deseqfilter-from-dataframe"]], "rnalysis.filtering.DESeqFilter.head": [[199, "rnalysis-filtering-deseqfilter-head"]], "rnalysis.filtering.DESeqFilter.intersection": [[200, "rnalysis-filtering-deseqfilter-intersection"]], "rnalysis.filtering.DESeqFilter.majority_vote_intersection": [[201, "rnalysis-filtering-deseqfilter-majority-vote-intersection"]], "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl": [[202, "rnalysis-filtering-deseqfilter-map-orthologs-ensembl"]], "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector": [[203, "rnalysis-filtering-deseqfilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.DESeqFilter.map_orthologs_panther": [[204, "rnalysis-filtering-deseqfilter-map-orthologs-panther"]], "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb": [[205, "rnalysis-filtering-deseqfilter-map-orthologs-phylomedb"]], "rnalysis.filtering.DESeqFilter.number_filters": [[206, "rnalysis-filtering-deseqfilter-number-filters"]], "rnalysis.filtering.DESeqFilter.print_features": [[207, "rnalysis-filtering-deseqfilter-print-features"]], "rnalysis.filtering.DESeqFilter.save_csv": [[208, "rnalysis-filtering-deseqfilter-save-csv"]], "rnalysis.filtering.DESeqFilter.save_parquet": [[209, "rnalysis-filtering-deseqfilter-save-parquet"]], "rnalysis.filtering.DESeqFilter.save_table": [[210, "rnalysis-filtering-deseqfilter-save-table"]], "rnalysis.filtering.DESeqFilter.sort": [[211, "rnalysis-filtering-deseqfilter-sort"]], "rnalysis.filtering.DESeqFilter.split_by_attribute": [[212, "rnalysis-filtering-deseqfilter-split-by-attribute"]], "rnalysis.filtering.DESeqFilter.split_by_percentile": [[213, "rnalysis-filtering-deseqfilter-split-by-percentile"]], "rnalysis.filtering.DESeqFilter.split_fold_change_direction": [[214, "rnalysis-filtering-deseqfilter-split-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.symmetric_difference": [[215, "rnalysis-filtering-deseqfilter-symmetric-difference"]], "rnalysis.filtering.DESeqFilter.tail": [[216, "rnalysis-filtering-deseqfilter-tail"]], "rnalysis.filtering.DESeqFilter.text_filters": [[217, "rnalysis-filtering-deseqfilter-text-filters"]], "rnalysis.filtering.DESeqFilter.transform": [[218, "rnalysis-filtering-deseqfilter-transform"]], "rnalysis.filtering.DESeqFilter.translate_gene_ids": [[219, "rnalysis-filtering-deseqfilter-translate-gene-ids"]], "rnalysis.filtering.DESeqFilter.union": [[220, "rnalysis-filtering-deseqfilter-union"]], "rnalysis.filtering.DESeqFilter.volcano_plot": [[221, "rnalysis-filtering-deseqfilter-volcano-plot"]], "rnalysis.filtering.Filter": [[222, "rnalysis-filtering-filter"]], "rnalysis.filtering.Filter.biotypes_from_gtf": [[223, "rnalysis-filtering-filter-biotypes-from-gtf"]], "rnalysis.filtering.Filter.biotypes_from_ref_table": [[224, "rnalysis-filtering-filter-biotypes-from-ref-table"]], "rnalysis.filtering.Filter.describe": [[225, "rnalysis-filtering-filter-describe"]], "rnalysis.filtering.Filter.difference": [[226, "rnalysis-filtering-filter-difference"]], "rnalysis.filtering.Filter.drop_columns": [[227, "rnalysis-filtering-filter-drop-columns"]], "rnalysis.filtering.Filter.filter_biotype_from_gtf": [[228, "rnalysis-filtering-filter-filter-biotype-from-gtf"]], "rnalysis.filtering.Filter.filter_biotype_from_ref_table": [[229, "rnalysis-filtering-filter-filter-biotype-from-ref-table"]], "rnalysis.filtering.Filter.filter_by_attribute": [[230, "rnalysis-filtering-filter-filter-by-attribute"]], "rnalysis.filtering.Filter.filter_by_go_annotations": [[231, "rnalysis-filtering-filter-filter-by-go-annotations"]], "rnalysis.filtering.Filter.filter_by_kegg_annotations": [[232, "rnalysis-filtering-filter-filter-by-kegg-annotations"]], "rnalysis.filtering.Filter.filter_by_row_name": [[233, "rnalysis-filtering-filter-filter-by-row-name"]], "rnalysis.filtering.Filter.filter_duplicate_ids": [[234, "rnalysis-filtering-filter-filter-duplicate-ids"]], "rnalysis.filtering.Filter.filter_missing_values": [[235, "rnalysis-filtering-filter-filter-missing-values"]], "rnalysis.filtering.Filter.filter_percentile": [[236, "rnalysis-filtering-filter-filter-percentile"]], "rnalysis.filtering.Filter.filter_top_n": [[237, "rnalysis-filtering-filter-filter-top-n"]], "rnalysis.filtering.Filter.find_paralogs_ensembl": [[238, "rnalysis-filtering-filter-find-paralogs-ensembl"]], "rnalysis.filtering.Filter.find_paralogs_panther": [[239, "rnalysis-filtering-filter-find-paralogs-panther"]], "rnalysis.filtering.Filter.from_dataframe": [[240, "rnalysis-filtering-filter-from-dataframe"]], "rnalysis.filtering.Filter.head": [[241, "rnalysis-filtering-filter-head"]], "rnalysis.filtering.Filter.intersection": [[242, "rnalysis-filtering-filter-intersection"]], "rnalysis.filtering.Filter.majority_vote_intersection": [[243, "rnalysis-filtering-filter-majority-vote-intersection"]], "rnalysis.filtering.Filter.map_orthologs_ensembl": [[244, "rnalysis-filtering-filter-map-orthologs-ensembl"]], "rnalysis.filtering.Filter.map_orthologs_orthoinspector": [[245, "rnalysis-filtering-filter-map-orthologs-orthoinspector"]], "rnalysis.filtering.Filter.map_orthologs_panther": [[246, "rnalysis-filtering-filter-map-orthologs-panther"]], "rnalysis.filtering.Filter.map_orthologs_phylomedb": [[247, "rnalysis-filtering-filter-map-orthologs-phylomedb"]], "rnalysis.filtering.Filter.number_filters": [[248, "rnalysis-filtering-filter-number-filters"]], "rnalysis.filtering.Filter.print_features": [[249, "rnalysis-filtering-filter-print-features"]], "rnalysis.filtering.Filter.save_csv": [[250, "rnalysis-filtering-filter-save-csv"]], "rnalysis.filtering.Filter.save_parquet": [[251, "rnalysis-filtering-filter-save-parquet"]], "rnalysis.filtering.Filter.save_table": [[252, "rnalysis-filtering-filter-save-table"]], "rnalysis.filtering.Filter.sort": [[253, "rnalysis-filtering-filter-sort"]], "rnalysis.filtering.Filter.split_by_attribute": [[254, "rnalysis-filtering-filter-split-by-attribute"]], "rnalysis.filtering.Filter.split_by_percentile": [[255, "rnalysis-filtering-filter-split-by-percentile"]], "rnalysis.filtering.Filter.symmetric_difference": [[256, "rnalysis-filtering-filter-symmetric-difference"]], "rnalysis.filtering.Filter.tail": [[257, "rnalysis-filtering-filter-tail"]], "rnalysis.filtering.Filter.text_filters": [[258, "rnalysis-filtering-filter-text-filters"]], "rnalysis.filtering.Filter.transform": [[259, "rnalysis-filtering-filter-transform"]], "rnalysis.filtering.Filter.translate_gene_ids": [[260, "rnalysis-filtering-filter-translate-gene-ids"]], "rnalysis.filtering.Filter.union": [[261, "rnalysis-filtering-filter-union"]], "rnalysis.filtering.FoldChangeFilter": [[262, "rnalysis-filtering-foldchangefilter"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf": [[263, "rnalysis-filtering-foldchangefilter-biotypes-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table": [[264, "rnalysis-filtering-foldchangefilter-biotypes-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.describe": [[265, "rnalysis-filtering-foldchangefilter-describe"]], "rnalysis.filtering.FoldChangeFilter.difference": [[266, "rnalysis-filtering-foldchangefilter-difference"]], "rnalysis.filtering.FoldChangeFilter.drop_columns": [[267, "rnalysis-filtering-foldchangefilter-drop-columns"]], "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change": [[268, "rnalysis-filtering-foldchangefilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf": [[269, "rnalysis-filtering-foldchangefilter-filter-biotype-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table": [[270, "rnalysis-filtering-foldchangefilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.filter_by_attribute": [[271, "rnalysis-filtering-foldchangefilter-filter-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations": [[272, "rnalysis-filtering-foldchangefilter-filter-by-go-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations": [[273, "rnalysis-filtering-foldchangefilter-filter-by-kegg-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_row_name": [[274, "rnalysis-filtering-foldchangefilter-filter-by-row-name"]], "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids": [[275, "rnalysis-filtering-foldchangefilter-filter-duplicate-ids"]], "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction": [[276, "rnalysis-filtering-foldchangefilter-filter-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.filter_missing_values": [[277, "rnalysis-filtering-foldchangefilter-filter-missing-values"]], "rnalysis.filtering.FoldChangeFilter.filter_percentile": [[278, "rnalysis-filtering-foldchangefilter-filter-percentile"]], "rnalysis.filtering.FoldChangeFilter.filter_top_n": [[279, "rnalysis-filtering-foldchangefilter-filter-top-n"]], "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl": [[280, "rnalysis-filtering-foldchangefilter-find-paralogs-ensembl"]], "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther": [[281, "rnalysis-filtering-foldchangefilter-find-paralogs-panther"]], "rnalysis.filtering.FoldChangeFilter.from_dataframe": [[282, "rnalysis-filtering-foldchangefilter-from-dataframe"]], "rnalysis.filtering.FoldChangeFilter.head": [[283, "rnalysis-filtering-foldchangefilter-head"]], "rnalysis.filtering.FoldChangeFilter.intersection": [[284, "rnalysis-filtering-foldchangefilter-intersection"]], "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection": [[285, "rnalysis-filtering-foldchangefilter-majority-vote-intersection"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl": [[286, "rnalysis-filtering-foldchangefilter-map-orthologs-ensembl"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector": [[287, "rnalysis-filtering-foldchangefilter-map-orthologs-orthoinspector"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther": [[288, "rnalysis-filtering-foldchangefilter-map-orthologs-panther"]], "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb": [[289, "rnalysis-filtering-foldchangefilter-map-orthologs-phylomedb"]], "rnalysis.filtering.FoldChangeFilter.number_filters": [[290, "rnalysis-filtering-foldchangefilter-number-filters"]], "rnalysis.filtering.FoldChangeFilter.print_features": [[291, "rnalysis-filtering-foldchangefilter-print-features"]], "rnalysis.filtering.FoldChangeFilter.randomization_test": [[292, "rnalysis-filtering-foldchangefilter-randomization-test"]], "rnalysis.filtering.FoldChangeFilter.save_csv": [[293, "rnalysis-filtering-foldchangefilter-save-csv"]], "rnalysis.filtering.FoldChangeFilter.save_parquet": [[294, "rnalysis-filtering-foldchangefilter-save-parquet"]], "rnalysis.filtering.FoldChangeFilter.save_table": [[295, "rnalysis-filtering-foldchangefilter-save-table"]], "rnalysis.filtering.FoldChangeFilter.sort": [[296, "rnalysis-filtering-foldchangefilter-sort"]], "rnalysis.filtering.FoldChangeFilter.split_by_attribute": [[297, "rnalysis-filtering-foldchangefilter-split-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.split_by_percentile": [[298, "rnalysis-filtering-foldchangefilter-split-by-percentile"]], "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction": [[299, "rnalysis-filtering-foldchangefilter-split-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.symmetric_difference": [[300, "rnalysis-filtering-foldchangefilter-symmetric-difference"]], "rnalysis.filtering.FoldChangeFilter.tail": [[301, "rnalysis-filtering-foldchangefilter-tail"]], "rnalysis.filtering.FoldChangeFilter.text_filters": [[302, "rnalysis-filtering-foldchangefilter-text-filters"]], "rnalysis.filtering.FoldChangeFilter.transform": [[303, "rnalysis-filtering-foldchangefilter-transform"]], "rnalysis.filtering.FoldChangeFilter.translate_gene_ids": [[304, "rnalysis-filtering-foldchangefilter-translate-gene-ids"]], "rnalysis.filtering.FoldChangeFilter.union": [[305, "rnalysis-filtering-foldchangefilter-union"]], "rnalysis.filtering.Pipeline": [[306, "rnalysis-filtering-pipeline"]], "rnalysis.filtering.Pipeline.add_function": [[307, "rnalysis-filtering-pipeline-add-function"]], "rnalysis.filtering.Pipeline.apply_to": [[308, "rnalysis-filtering-pipeline-apply-to"]]}, "indexentries": {"rankedset (class in rnalysis.enrichment)": [[41, "rnalysis.enrichment.RankedSet"]], "__init__() (rnalysis.enrichment.rankedset method)": [[41, "rnalysis.enrichment.RankedSet.__init__"]], "single_set_kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[66, "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment"]], "module": [[102, "module-rnalysis.filtering"]], "rnalysis.filtering": [[102, "module-rnalysis.filtering"]], "countfilter (class in rnalysis.filtering)": [[103, "rnalysis.filtering.CountFilter"]], "__init__() (rnalysis.filtering.countfilter method)": [[103, "rnalysis.filtering.CountFilter.__init__"]], "average_replicate_samples() (rnalysis.filtering.countfilter method)": [[104, "rnalysis.filtering.CountFilter.average_replicate_samples"]], "biotypes_from_gtf() (rnalysis.filtering.countfilter method)": [[105, "rnalysis.filtering.CountFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.countfilter method)": [[106, "rnalysis.filtering.CountFilter.biotypes_from_ref_table"]], "box_plot() (rnalysis.filtering.countfilter method)": [[107, "rnalysis.filtering.CountFilter.box_plot"]], "clustergram() (rnalysis.filtering.countfilter method)": [[108, "rnalysis.filtering.CountFilter.clustergram"]], "describe() (rnalysis.filtering.countfilter method)": [[109, "rnalysis.filtering.CountFilter.describe"]], "difference() (rnalysis.filtering.countfilter method)": [[110, "rnalysis.filtering.CountFilter.difference"]], "differential_expression_deseq2() (rnalysis.filtering.countfilter method)": [[111, "rnalysis.filtering.CountFilter.differential_expression_deseq2"]], "differential_expression_limma_voom() (rnalysis.filtering.countfilter method)": [[112, "rnalysis.filtering.CountFilter.differential_expression_limma_voom"]], "drop_columns() (rnalysis.filtering.countfilter method)": [[113, "rnalysis.filtering.CountFilter.drop_columns"]], "enhanced_box_plot() (rnalysis.filtering.countfilter method)": [[114, "rnalysis.filtering.CountFilter.enhanced_box_plot"]], "filter_biotype_from_gtf() (rnalysis.filtering.countfilter method)": [[115, "rnalysis.filtering.CountFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.countfilter method)": [[116, "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.countfilter method)": [[117, "rnalysis.filtering.CountFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.countfilter method)": [[118, "rnalysis.filtering.CountFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.countfilter method)": [[119, "rnalysis.filtering.CountFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.countfilter method)": [[120, "rnalysis.filtering.CountFilter.filter_by_row_name"]], "filter_by_row_sum() (rnalysis.filtering.countfilter method)": [[121, "rnalysis.filtering.CountFilter.filter_by_row_sum"]], "filter_duplicate_ids() (rnalysis.filtering.countfilter method)": [[122, "rnalysis.filtering.CountFilter.filter_duplicate_ids"]], "filter_low_reads() (rnalysis.filtering.countfilter method)": [[123, "rnalysis.filtering.CountFilter.filter_low_reads"]], "filter_missing_values() (rnalysis.filtering.countfilter method)": [[124, "rnalysis.filtering.CountFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.countfilter method)": [[125, "rnalysis.filtering.CountFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.countfilter method)": [[126, "rnalysis.filtering.CountFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.countfilter method)": [[127, "rnalysis.filtering.CountFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.countfilter method)": [[128, "rnalysis.filtering.CountFilter.find_paralogs_panther"]], "fold_change() (rnalysis.filtering.countfilter method)": [[129, "rnalysis.filtering.CountFilter.fold_change"]], "from_dataframe() (rnalysis.filtering.countfilter class method)": [[130, "rnalysis.filtering.CountFilter.from_dataframe"]], "from_folder() (rnalysis.filtering.countfilter class method)": [[131, "rnalysis.filtering.CountFilter.from_folder"]], "from_folder_htseqcount() (rnalysis.filtering.countfilter class method)": [[132, "rnalysis.filtering.CountFilter.from_folder_htseqcount"]], "head() (rnalysis.filtering.countfilter method)": [[133, "rnalysis.filtering.CountFilter.head"]], "intersection() (rnalysis.filtering.countfilter method)": [[134, "rnalysis.filtering.CountFilter.intersection"]], "ma_plot() (rnalysis.filtering.countfilter method)": [[135, "rnalysis.filtering.CountFilter.ma_plot"]], "majority_vote_intersection() (rnalysis.filtering.countfilter method)": [[136, "rnalysis.filtering.CountFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.countfilter method)": [[137, "rnalysis.filtering.CountFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.countfilter method)": [[138, "rnalysis.filtering.CountFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.countfilter method)": [[139, "rnalysis.filtering.CountFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.countfilter method)": [[140, "rnalysis.filtering.CountFilter.map_orthologs_phylomedb"]], "normalize_median_of_ratios() (rnalysis.filtering.countfilter method)": [[141, "rnalysis.filtering.CountFilter.normalize_median_of_ratios"]], "normalize_rle() (rnalysis.filtering.countfilter method)": [[142, "rnalysis.filtering.CountFilter.normalize_rle"]], "normalize_tmm() (rnalysis.filtering.countfilter method)": [[143, "rnalysis.filtering.CountFilter.normalize_tmm"]], "normalize_to_quantile() (rnalysis.filtering.countfilter method)": [[144, "rnalysis.filtering.CountFilter.normalize_to_quantile"]], "normalize_to_rpkm() (rnalysis.filtering.countfilter method)": [[145, "rnalysis.filtering.CountFilter.normalize_to_rpkm"]], "normalize_to_rpm() (rnalysis.filtering.countfilter method)": [[146, "rnalysis.filtering.CountFilter.normalize_to_rpm"]], "normalize_to_rpm_htseqcount() (rnalysis.filtering.countfilter method)": [[147, "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount"]], "normalize_to_tpm() (rnalysis.filtering.countfilter method)": [[148, "rnalysis.filtering.CountFilter.normalize_to_tpm"]], "normalize_with_scaling_factors() (rnalysis.filtering.countfilter method)": [[149, "rnalysis.filtering.CountFilter.normalize_with_scaling_factors"]], "number_filters() (rnalysis.filtering.countfilter method)": [[150, "rnalysis.filtering.CountFilter.number_filters"]], "pairplot() (rnalysis.filtering.countfilter method)": [[151, "rnalysis.filtering.CountFilter.pairplot"]], "pca() (rnalysis.filtering.countfilter method)": [[152, "rnalysis.filtering.CountFilter.pca"]], "plot_expression() (rnalysis.filtering.countfilter method)": [[153, "rnalysis.filtering.CountFilter.plot_expression"]], "print_features() (rnalysis.filtering.countfilter method)": [[154, "rnalysis.filtering.CountFilter.print_features"]], "save_csv() (rnalysis.filtering.countfilter method)": [[155, "rnalysis.filtering.CountFilter.save_csv"]], "save_parquet() (rnalysis.filtering.countfilter method)": [[156, "rnalysis.filtering.CountFilter.save_parquet"]], "save_table() (rnalysis.filtering.countfilter method)": [[157, "rnalysis.filtering.CountFilter.save_table"]], "scatter_sample_vs_sample() (rnalysis.filtering.countfilter method)": [[158, "rnalysis.filtering.CountFilter.scatter_sample_vs_sample"]], "sort() (rnalysis.filtering.countfilter method)": [[159, "rnalysis.filtering.CountFilter.sort"]], "sort_by_principal_component() (rnalysis.filtering.countfilter method)": [[160, "rnalysis.filtering.CountFilter.sort_by_principal_component"]], "split_by_attribute() (rnalysis.filtering.countfilter method)": [[161, "rnalysis.filtering.CountFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.countfilter method)": [[162, "rnalysis.filtering.CountFilter.split_by_percentile"]], "split_by_principal_components() (rnalysis.filtering.countfilter method)": [[163, "rnalysis.filtering.CountFilter.split_by_principal_components"]], "split_by_reads() (rnalysis.filtering.countfilter method)": [[164, "rnalysis.filtering.CountFilter.split_by_reads"]], "split_clicom() (rnalysis.filtering.countfilter method)": [[165, "rnalysis.filtering.CountFilter.split_clicom"]], "split_hdbscan() (rnalysis.filtering.countfilter method)": [[166, "rnalysis.filtering.CountFilter.split_hdbscan"]], "split_hierarchical() (rnalysis.filtering.countfilter method)": [[167, "rnalysis.filtering.CountFilter.split_hierarchical"]], "split_kmeans() (rnalysis.filtering.countfilter method)": [[168, "rnalysis.filtering.CountFilter.split_kmeans"]], "split_kmedoids() (rnalysis.filtering.countfilter method)": [[169, "rnalysis.filtering.CountFilter.split_kmedoids"]], "symmetric_difference() (rnalysis.filtering.countfilter method)": [[170, "rnalysis.filtering.CountFilter.symmetric_difference"]], "tail() (rnalysis.filtering.countfilter method)": [[171, "rnalysis.filtering.CountFilter.tail"]], "text_filters() (rnalysis.filtering.countfilter method)": [[172, "rnalysis.filtering.CountFilter.text_filters"]], "transform() (rnalysis.filtering.countfilter method)": [[173, "rnalysis.filtering.CountFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.countfilter method)": [[174, "rnalysis.filtering.CountFilter.translate_gene_ids"]], "union() (rnalysis.filtering.countfilter method)": [[175, "rnalysis.filtering.CountFilter.union"]], "violin_plot() (rnalysis.filtering.countfilter method)": [[176, "rnalysis.filtering.CountFilter.violin_plot"]], "deseqfilter (class in rnalysis.filtering)": [[177, "rnalysis.filtering.DESeqFilter"]], "__init__() (rnalysis.filtering.deseqfilter method)": [[177, "rnalysis.filtering.DESeqFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.deseqfilter method)": [[178, "rnalysis.filtering.DESeqFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[179, "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.deseqfilter method)": [[180, "rnalysis.filtering.DESeqFilter.describe"]], "difference() (rnalysis.filtering.deseqfilter method)": [[181, "rnalysis.filtering.DESeqFilter.difference"]], "drop_columns() (rnalysis.filtering.deseqfilter method)": [[182, "rnalysis.filtering.DESeqFilter.drop_columns"]], "filter_abs_log2_fold_change() (rnalysis.filtering.deseqfilter method)": [[183, "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.deseqfilter method)": [[184, "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[185, "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.deseqfilter method)": [[186, "rnalysis.filtering.DESeqFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.deseqfilter method)": [[187, "rnalysis.filtering.DESeqFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.deseqfilter method)": [[188, "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.deseqfilter method)": [[189, "rnalysis.filtering.DESeqFilter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.deseqfilter method)": [[190, "rnalysis.filtering.DESeqFilter.filter_duplicate_ids"]], "filter_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[191, "rnalysis.filtering.DESeqFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.deseqfilter method)": [[192, "rnalysis.filtering.DESeqFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.deseqfilter method)": [[193, "rnalysis.filtering.DESeqFilter.filter_percentile"]], "filter_significant() (rnalysis.filtering.deseqfilter method)": [[194, "rnalysis.filtering.DESeqFilter.filter_significant"]], "filter_top_n() (rnalysis.filtering.deseqfilter method)": [[195, "rnalysis.filtering.DESeqFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.deseqfilter method)": [[196, "rnalysis.filtering.DESeqFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.deseqfilter method)": [[197, "rnalysis.filtering.DESeqFilter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.deseqfilter class method)": [[198, "rnalysis.filtering.DESeqFilter.from_dataframe"]], "head() (rnalysis.filtering.deseqfilter method)": [[199, "rnalysis.filtering.DESeqFilter.head"]], "intersection() (rnalysis.filtering.deseqfilter method)": [[200, "rnalysis.filtering.DESeqFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.deseqfilter method)": [[201, "rnalysis.filtering.DESeqFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.deseqfilter method)": [[202, "rnalysis.filtering.DESeqFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.deseqfilter method)": [[203, "rnalysis.filtering.DESeqFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.deseqfilter method)": [[204, "rnalysis.filtering.DESeqFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.deseqfilter method)": [[205, "rnalysis.filtering.DESeqFilter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.deseqfilter method)": [[206, "rnalysis.filtering.DESeqFilter.number_filters"]], "print_features() (rnalysis.filtering.deseqfilter method)": [[207, "rnalysis.filtering.DESeqFilter.print_features"]], "save_csv() (rnalysis.filtering.deseqfilter method)": [[208, "rnalysis.filtering.DESeqFilter.save_csv"]], "save_parquet() (rnalysis.filtering.deseqfilter method)": [[209, "rnalysis.filtering.DESeqFilter.save_parquet"]], "save_table() (rnalysis.filtering.deseqfilter method)": [[210, "rnalysis.filtering.DESeqFilter.save_table"]], "sort() (rnalysis.filtering.deseqfilter method)": [[211, "rnalysis.filtering.DESeqFilter.sort"]], "split_by_attribute() (rnalysis.filtering.deseqfilter method)": [[212, "rnalysis.filtering.DESeqFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.deseqfilter method)": [[213, "rnalysis.filtering.DESeqFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[214, "rnalysis.filtering.DESeqFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.deseqfilter method)": [[215, "rnalysis.filtering.DESeqFilter.symmetric_difference"]], "tail() (rnalysis.filtering.deseqfilter method)": [[216, "rnalysis.filtering.DESeqFilter.tail"]], "text_filters() (rnalysis.filtering.deseqfilter method)": [[217, "rnalysis.filtering.DESeqFilter.text_filters"]], "transform() (rnalysis.filtering.deseqfilter method)": [[218, "rnalysis.filtering.DESeqFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.deseqfilter method)": [[219, "rnalysis.filtering.DESeqFilter.translate_gene_ids"]], "union() (rnalysis.filtering.deseqfilter method)": [[220, "rnalysis.filtering.DESeqFilter.union"]], "volcano_plot() (rnalysis.filtering.deseqfilter method)": [[221, "rnalysis.filtering.DESeqFilter.volcano_plot"]], "filter (class in rnalysis.filtering)": [[222, "rnalysis.filtering.Filter"]], "__init__() (rnalysis.filtering.filter method)": [[222, "rnalysis.filtering.Filter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.filter method)": [[223, "rnalysis.filtering.Filter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.filter method)": [[224, "rnalysis.filtering.Filter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.filter method)": [[225, "rnalysis.filtering.Filter.describe"]], "difference() (rnalysis.filtering.filter method)": [[226, "rnalysis.filtering.Filter.difference"]], "drop_columns() (rnalysis.filtering.filter method)": [[227, "rnalysis.filtering.Filter.drop_columns"]], "filter_biotype_from_gtf() (rnalysis.filtering.filter method)": [[228, "rnalysis.filtering.Filter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.filter method)": [[229, "rnalysis.filtering.Filter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.filter method)": [[230, "rnalysis.filtering.Filter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.filter method)": [[231, "rnalysis.filtering.Filter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.filter method)": [[232, "rnalysis.filtering.Filter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.filter method)": [[233, "rnalysis.filtering.Filter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.filter method)": [[234, "rnalysis.filtering.Filter.filter_duplicate_ids"]], "filter_missing_values() (rnalysis.filtering.filter method)": [[235, "rnalysis.filtering.Filter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.filter method)": [[236, "rnalysis.filtering.Filter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.filter method)": [[237, "rnalysis.filtering.Filter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.filter method)": [[238, "rnalysis.filtering.Filter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.filter method)": [[239, "rnalysis.filtering.Filter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.filter class method)": [[240, "rnalysis.filtering.Filter.from_dataframe"]], "head() (rnalysis.filtering.filter method)": [[241, "rnalysis.filtering.Filter.head"]], "intersection() (rnalysis.filtering.filter method)": [[242, "rnalysis.filtering.Filter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.filter method)": [[243, "rnalysis.filtering.Filter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.filter method)": [[244, "rnalysis.filtering.Filter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.filter method)": [[245, "rnalysis.filtering.Filter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.filter method)": [[246, "rnalysis.filtering.Filter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.filter method)": [[247, "rnalysis.filtering.Filter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.filter method)": [[248, "rnalysis.filtering.Filter.number_filters"]], "print_features() (rnalysis.filtering.filter method)": [[249, "rnalysis.filtering.Filter.print_features"]], "save_csv() (rnalysis.filtering.filter method)": [[250, "rnalysis.filtering.Filter.save_csv"]], "save_parquet() (rnalysis.filtering.filter method)": [[251, "rnalysis.filtering.Filter.save_parquet"]], "save_table() (rnalysis.filtering.filter method)": [[252, "rnalysis.filtering.Filter.save_table"]], "sort() (rnalysis.filtering.filter method)": [[253, "rnalysis.filtering.Filter.sort"]], "split_by_attribute() (rnalysis.filtering.filter method)": [[254, "rnalysis.filtering.Filter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.filter method)": [[255, "rnalysis.filtering.Filter.split_by_percentile"]], "symmetric_difference() (rnalysis.filtering.filter method)": [[256, "rnalysis.filtering.Filter.symmetric_difference"]], "tail() (rnalysis.filtering.filter method)": [[257, "rnalysis.filtering.Filter.tail"]], "text_filters() (rnalysis.filtering.filter method)": [[258, "rnalysis.filtering.Filter.text_filters"]], "transform() (rnalysis.filtering.filter method)": [[259, "rnalysis.filtering.Filter.transform"]], "translate_gene_ids() (rnalysis.filtering.filter method)": [[260, "rnalysis.filtering.Filter.translate_gene_ids"]], "union() (rnalysis.filtering.filter method)": [[261, "rnalysis.filtering.Filter.union"]], "foldchangefilter (class in rnalysis.filtering)": [[262, "rnalysis.filtering.FoldChangeFilter"]], "__init__() (rnalysis.filtering.foldchangefilter method)": [[262, "rnalysis.filtering.FoldChangeFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[263, "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[264, "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.foldchangefilter method)": [[265, "rnalysis.filtering.FoldChangeFilter.describe"]], "difference() (rnalysis.filtering.foldchangefilter method)": [[266, "rnalysis.filtering.FoldChangeFilter.difference"]], "drop_columns() (rnalysis.filtering.foldchangefilter method)": [[267, "rnalysis.filtering.FoldChangeFilter.drop_columns"]], "filter_abs_log2_fold_change() (rnalysis.filtering.foldchangefilter method)": [[268, "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[269, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[270, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[271, "rnalysis.filtering.FoldChangeFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.foldchangefilter method)": [[272, "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.foldchangefilter method)": [[273, "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations"]], "filter_by_row_name() (rnalysis.filtering.foldchangefilter method)": [[274, "rnalysis.filtering.FoldChangeFilter.filter_by_row_name"]], "filter_duplicate_ids() (rnalysis.filtering.foldchangefilter method)": [[275, "rnalysis.filtering.FoldChangeFilter.filter_duplicate_ids"]], "filter_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[276, "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.foldchangefilter method)": [[277, "rnalysis.filtering.FoldChangeFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.foldchangefilter method)": [[278, "rnalysis.filtering.FoldChangeFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.foldchangefilter method)": [[279, "rnalysis.filtering.FoldChangeFilter.filter_top_n"]], "find_paralogs_ensembl() (rnalysis.filtering.foldchangefilter method)": [[280, "rnalysis.filtering.FoldChangeFilter.find_paralogs_ensembl"]], "find_paralogs_panther() (rnalysis.filtering.foldchangefilter method)": [[281, "rnalysis.filtering.FoldChangeFilter.find_paralogs_panther"]], "from_dataframe() (rnalysis.filtering.foldchangefilter class method)": [[282, "rnalysis.filtering.FoldChangeFilter.from_dataframe"]], "head() (rnalysis.filtering.foldchangefilter method)": [[283, "rnalysis.filtering.FoldChangeFilter.head"]], "intersection() (rnalysis.filtering.foldchangefilter method)": [[284, "rnalysis.filtering.FoldChangeFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.foldchangefilter method)": [[285, "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection"]], "map_orthologs_ensembl() (rnalysis.filtering.foldchangefilter method)": [[286, "rnalysis.filtering.FoldChangeFilter.map_orthologs_ensembl"]], "map_orthologs_orthoinspector() (rnalysis.filtering.foldchangefilter method)": [[287, "rnalysis.filtering.FoldChangeFilter.map_orthologs_orthoinspector"]], "map_orthologs_panther() (rnalysis.filtering.foldchangefilter method)": [[288, "rnalysis.filtering.FoldChangeFilter.map_orthologs_panther"]], "map_orthologs_phylomedb() (rnalysis.filtering.foldchangefilter method)": [[289, "rnalysis.filtering.FoldChangeFilter.map_orthologs_phylomedb"]], "number_filters() (rnalysis.filtering.foldchangefilter method)": [[290, "rnalysis.filtering.FoldChangeFilter.number_filters"]], "print_features() (rnalysis.filtering.foldchangefilter method)": [[291, "rnalysis.filtering.FoldChangeFilter.print_features"]], "randomization_test() (rnalysis.filtering.foldchangefilter method)": [[292, "rnalysis.filtering.FoldChangeFilter.randomization_test"]], "save_csv() (rnalysis.filtering.foldchangefilter method)": [[293, "rnalysis.filtering.FoldChangeFilter.save_csv"]], "save_parquet() (rnalysis.filtering.foldchangefilter method)": [[294, "rnalysis.filtering.FoldChangeFilter.save_parquet"]], "save_table() (rnalysis.filtering.foldchangefilter method)": [[295, "rnalysis.filtering.FoldChangeFilter.save_table"]], "sort() (rnalysis.filtering.foldchangefilter method)": [[296, "rnalysis.filtering.FoldChangeFilter.sort"]], "split_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[297, "rnalysis.filtering.FoldChangeFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.foldchangefilter method)": [[298, "rnalysis.filtering.FoldChangeFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[299, "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.foldchangefilter method)": [[300, "rnalysis.filtering.FoldChangeFilter.symmetric_difference"]], "tail() (rnalysis.filtering.foldchangefilter method)": [[301, "rnalysis.filtering.FoldChangeFilter.tail"]], "text_filters() (rnalysis.filtering.foldchangefilter method)": [[302, "rnalysis.filtering.FoldChangeFilter.text_filters"]], "transform() (rnalysis.filtering.foldchangefilter method)": [[303, "rnalysis.filtering.FoldChangeFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.foldchangefilter method)": [[304, "rnalysis.filtering.FoldChangeFilter.translate_gene_ids"]], "union() (rnalysis.filtering.foldchangefilter method)": [[305, "rnalysis.filtering.FoldChangeFilter.union"]], "pipeline (class in rnalysis.filtering)": [[306, "rnalysis.filtering.Pipeline"]], "__init__() (rnalysis.filtering.pipeline method)": [[306, "rnalysis.filtering.Pipeline.__init__"]], "add_function() (rnalysis.filtering.pipeline method)": [[307, "rnalysis.filtering.Pipeline.add_function"]], "apply_to() (rnalysis.filtering.pipeline method)": [[308, "rnalysis.filtering.Pipeline.apply_to"]]}})
\ No newline at end of file