diff --git a/HISTORY.rst b/HISTORY.rst
index 8814b96df..d6ce9a0ce 100644
--- a/HISTORY.rst
+++ b/HISTORY.rst
@@ -2,6 +2,14 @@
 History
 =======
 
+3.2.2 (2022-11-25)
+------------------
+
+
+Fixed
+******
+* Fixed bug with DESeq2 automatic installation on Windows computers.
+
 3.2.1 (2022-11-25)
 ------------------
 
diff --git a/docs/build/.buildinfo b/docs/build/.buildinfo
index b9034f5dc..edfb01242 100644
--- a/docs/build/.buildinfo
+++ b/docs/build/.buildinfo
@@ -1,4 +1,4 @@
 # Sphinx build info version 1
 # This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done.
-config: ccb0d7a576f0bdf8c37a6e6011c48294
+config: 8e4f29eb9c976b36874b6634f1ee605e
 tags: 645f666f9bcd5a90fca523b33c5a78b7
diff --git a/docs/build/.doctrees/environment.pickle b/docs/build/.doctrees/environment.pickle
index 73c55b4d6..33c1c6f18 100644
Binary files a/docs/build/.doctrees/environment.pickle and b/docs/build/.doctrees/environment.pickle differ
diff --git a/docs/build/.doctrees/history.doctree b/docs/build/.doctrees/history.doctree
index 71050965c..3c27281bc 100644
Binary files a/docs/build/.doctrees/history.doctree and b/docs/build/.doctrees/history.doctree differ
diff --git a/docs/build/.doctrees/index.doctree b/docs/build/.doctrees/index.doctree
index 2a2828584..13e01d12c 100644
Binary files a/docs/build/.doctrees/index.doctree and b/docs/build/.doctrees/index.doctree differ
diff --git a/docs/build/_static/documentation_options.js b/docs/build/_static/documentation_options.js
index 573a5071b..021fc3cea 100644
--- a/docs/build/_static/documentation_options.js
+++ b/docs/build/_static/documentation_options.js
@@ -1,6 +1,6 @@
 var DOCUMENTATION_OPTIONS = {
     URL_ROOT: document.getElementById("documentation_options").getAttribute('data-url_root'),
-    VERSION: '3.2.1',
+    VERSION: '3.2.2',
     LANGUAGE: 'en',
     COLLAPSE_INDEX: false,
     BUILDER: 'html',
diff --git a/docs/build/api_reference.html b/docs/build/api_reference.html
index f5c97f2c7..d7e8a8026 100644
--- a/docs/build/api_reference.html
+++ b/docs/build/api_reference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>API Reference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>API Reference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/contributing.html b/docs/build/contributing.html
index e17c9141b..0ecff6ccf 100644
--- a/docs/build/contributing.html
+++ b/docs/build/contributing.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Contributing &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Contributing &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/genindex.html b/docs/build/genindex.html
index 27e303302..beec5b20c 100644
--- a/docs/build/genindex.html
+++ b/docs/build/genindex.html
@@ -3,7 +3,7 @@
 <head>
   <meta charset="utf-8" />
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Index &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Index &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/glossary.html b/docs/build/glossary.html
index 709e36aea..37d019605 100644
--- a/docs/build/glossary.html
+++ b/docs/build/glossary.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Glossary &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Glossary &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/history.html b/docs/build/history.html
index ef086f5a0..9fb000977 100644
--- a/docs/build/history.html
+++ b/docs/build/history.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>History &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>History &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
@@ -62,71 +62,75 @@
 <p class="caption" role="heading"><span class="caption-text">Change history:</span></p>
 <ul class="current">
 <li class="toctree-l1 current"><a class="current reference internal" href="#">History</a><ul>
-<li class="toctree-l2"><a class="reference internal" href="#id1">3.2.1 (2022-11-25)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#changed">Changed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id1">3.2.2 (2022-11-25)</a><ul>
 <li class="toctree-l3"><a class="reference internal" href="#fixed">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id2">3.2.0 (2022-11-23)</a><ul>
+<li class="toctree-l2"><a class="reference internal" href="#id2">3.2.1 (2022-11-25)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#changed">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id3">Fixed</a></li>
+</ul>
+</li>
+<li class="toctree-l2"><a class="reference internal" href="#id4">3.2.0 (2022-11-23)</a><ul>
 <li class="toctree-l3"><a class="reference internal" href="#added">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id3">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id4">Fixed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id5">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id6">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id5">3.1.0 (2022-10-16)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id6">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id7">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id8">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id7">3.1.0 (2022-10-16)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id8">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id9">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id10">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id9">3.0.1 (2022-10-12)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="#id10">3.0.0 (2022-10-10)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id11">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id12">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id13">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id11">3.0.1 (2022-10-12)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id12">3.0.0 (2022-10-10)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id13">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id14">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id15">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id14">2.1.1 (2022-07-05)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id15">Changed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id16">2.1.1 (2022-07-05)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id17">Changed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id16">2.1.0 (2022-04-16)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id17">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id18">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id19">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id18">2.1.0 (2022-04-16)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id19">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id20">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id21">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id20">2.0.1 (2022-04-02)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id21">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id22">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id23">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id22">2.0.1 (2022-04-02)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id23">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id24">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id25">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id24">2.0.0 (2021-12-05)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id25">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id26">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id27">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id26">2.0.0 (2021-12-05)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id27">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id28">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id29">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id28">1.3.5 (2020-05-27)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id29">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id30">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id31">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id30">1.3.5 (2020-05-27)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id31">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id32">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id33">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id32">1.3.4 (2020-04-07)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id33">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id34">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id34">1.3.4 (2020-04-07)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id35">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id36">Fixed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id35">1.3.3 (2020-03-28)</a><ul>
-<li class="toctree-l3"><a class="reference internal" href="#id36">Added</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id37">Changed</a></li>
-<li class="toctree-l3"><a class="reference internal" href="#id38">Fixed</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id37">1.3.3 (2020-03-28)</a><ul>
+<li class="toctree-l3"><a class="reference internal" href="#id38">Added</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id39">Changed</a></li>
+<li class="toctree-l3"><a class="reference internal" href="#id40">Fixed</a></li>
 <li class="toctree-l3"><a class="reference internal" href="#removed">Removed</a></li>
 </ul>
 </li>
-<li class="toctree-l2"><a class="reference internal" href="#id39">1.3.2 (2019-12-11)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="#id41">1.3.2 (2019-12-11)</a></li>
 </ul>
 </li>
 </ul>
@@ -169,22 +173,31 @@
   <section id="history">
 <h1>History<a class="headerlink" href="#history" title="Permalink to this heading"></a></h1>
 <section id="id1">
-<h2>3.2.1 (2022-11-25)<a class="headerlink" href="#id1" title="Permalink to this heading"></a></h2>
+<h2>3.2.2 (2022-11-25)<a class="headerlink" href="#id1" title="Permalink to this heading"></a></h2>
+<section id="fixed">
+<h3>Fixed<a class="headerlink" href="#fixed" title="Permalink to this heading"></a></h3>
+<ul class="simple">
+<li><p>Fixed bug with DESeq2 automatic installation on Windows computers.</p></li>
+</ul>
+</section>
+</section>
+<section id="id2">
+<h2>3.2.1 (2022-11-25)<a class="headerlink" href="#id2" title="Permalink to this heading"></a></h2>
 <section id="changed">
 <h3>Changed<a class="headerlink" href="#changed" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Updated citation information for <em>RNAlysis</em></p></li>
 </ul>
 </section>
-<section id="fixed">
-<h3>Fixed<a class="headerlink" href="#fixed" title="Permalink to this heading"></a></h3>
+<section id="id3">
+<h3>Fixed<a class="headerlink" href="#id3" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed typos in the <em>RNAlysis</em> tutorial</p></li>
 </ul>
 </section>
 </section>
-<section id="id2">
-<h2>3.2.0 (2022-11-23)<a class="headerlink" href="#id2" title="Permalink to this heading"></a></h2>
+<section id="id4">
+<h2>3.2.0 (2022-11-23)<a class="headerlink" href="#id4" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces quality-of-life changes to the graphical user interface, functions for translating gene IDs and running differential expression analysis, and extends RNAlysis to support Python versions 3.9 and 3.10.</p></li>
 </ul>
@@ -199,8 +212,8 @@ <h3>Added<a class="headerlink" href="#added" title="Permalink to this heading">
 <li><p>Added fastq module that contains adapter-trimming functions utilizing CutAdapt, and mRNA-sequencing quantification using kallisto.</p></li>
 </ul>
 </section>
-<section id="id3">
-<h3>Changed<a class="headerlink" href="#id3" title="Permalink to this heading"></a></h3>
+<section id="id5">
+<h3>Changed<a class="headerlink" href="#id5" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added additional plotting parameters to visualization functions.</p></li>
 <li><p>Improved performance of some aspects of the graphical user interface.</p></li>
@@ -212,8 +225,8 @@ <h3>Changed<a class="headerlink" href="#id3" title="Permalink to this heading">
 <li><p>Filter.filter_biotype() was refactored into Filter.filter_biotype_from_ref_table()</p></li>
 </ul>
 </section>
-<section id="id4">
-<h3>Fixed<a class="headerlink" href="#id4" title="Permalink to this heading"></a></h3>
+<section id="id6">
+<h3>Fixed<a class="headerlink" href="#id6" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Users can now queue multiple computationally-intense enrichment/clustering tasks while another task is running.</p></li>
 <li><p>Fixed a bug where sometimes some function parameters would disappear from the graphical user interface.</p></li>
@@ -222,52 +235,52 @@ <h3>Fixed<a class="headerlink" href="#id4" title="Permalink to this heading">
 </ul>
 </section>
 </section>
-<section id="id5">
-<h2>3.1.0 (2022-10-16)<a class="headerlink" href="#id5" title="Permalink to this heading"></a></h2>
+<section id="id7">
+<h2>3.1.0 (2022-10-16)<a class="headerlink" href="#id7" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces new count matrix normalization methods, as well as MA plots and minor bug fixes.</p></li>
 </ul>
-<section id="id6">
-<h3>Added<a class="headerlink" href="#id6" title="Permalink to this heading"></a></h3>
+<section id="id8">
+<h3>Added<a class="headerlink" href="#id8" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added the visualization function ma_plot() for CountFilter</p></li>
 <li><p>Added functions for the normalization functions Relative Log Ratio (RLE), Trimmed Mean of M-values (TMM), Median of Ratios (MRN), Quantile normalization (quantile)</p></li>
 </ul>
 </section>
-<section id="id7">
-<h3>Changed<a class="headerlink" href="#id7" title="Permalink to this heading"></a></h3>
+<section id="id9">
+<h3>Changed<a class="headerlink" href="#id9" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>CountFilter.normalize_to_rpm() was renamed to CountFilter.normalize_to_rpm_htseqcount(), and was supplemented by the more general function for normalizing to Reads Per Million CountFilter.normalize_to_rpm()</p></li>
 </ul>
 </section>
-<section id="id8">
-<h3>Fixed<a class="headerlink" href="#id8" title="Permalink to this heading"></a></h3>
+<section id="id10">
+<h3>Fixed<a class="headerlink" href="#id10" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed a bug where some elements of the graphical user interface would not display correctly</p></li>
 </ul>
 </section>
 </section>
-<section id="id9">
-<h2>3.0.1 (2022-10-12)<a class="headerlink" href="#id9" title="Permalink to this heading"></a></h2>
+<section id="id11">
+<h2>3.0.1 (2022-10-12)<a class="headerlink" href="#id11" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version fixes a bug with displaying the tutorial videos in the graphical user interface.</p></li>
 </ul>
 </section>
-<section id="id10">
-<h2>3.0.0 (2022-10-10)<a class="headerlink" href="#id10" title="Permalink to this heading"></a></h2>
+<section id="id12">
+<h2>3.0.0 (2022-10-10)<a class="headerlink" href="#id12" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces a graphical user interface for RNAlysis, as well as new functions for KEGG Pathways enrichment analysis.</p></li>
 </ul>
-<section id="id11">
-<h3>Added<a class="headerlink" href="#id11" title="Permalink to this heading"></a></h3>
+<section id="id13">
+<h3>Added<a class="headerlink" href="#id13" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>RNAlysis now includes a graphical user interface</p></li>
 <li><p>Pipelines can now be imported and exported</p></li>
 <li><p>Enrichment and single-set-enrichment for KEGG pathway data</p></li>
 </ul>
 </section>
-<section id="id12">
-<h3>Changed<a class="headerlink" href="#id12" title="Permalink to this heading"></a></h3>
+<section id="id14">
+<h3>Changed<a class="headerlink" href="#id14" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added function FeatureSet.user_defined_enrichment(), which will replace FeatureSet.enrich_hypergeometric() and FeatureSet.enrich_randomization()</p></li>
 <li><p>Updated signature of enrichment.venn_diagram</p></li>
@@ -277,21 +290,21 @@ <h3>Changed<a class="headerlink" href="#id12" title="Permalink to this heading">
 <li><p>Changed signature of CountFilter.pca, CountFilter.box_plot, CountFilter.enhanced_box_plot, CountFilter.clustergram, and CountFilter.pairplot to ensure consistency among visualization functions.</p></li>
 </ul>
 </section>
-<section id="id13">
-<h3>Fixed<a class="headerlink" href="#id13" title="Permalink to this heading"></a></h3>
+<section id="id15">
+<h3>Fixed<a class="headerlink" href="#id15" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>enrichment.venn_diagram can now be plotted with outlines when the circles are unweighted</p></li>
 <li><p>Fixed bug in Pipeline.apply_to() where a Filter object would be returned even when the Pipeline was applied inplace</p></li>
 </ul>
 </section>
 </section>
-<section id="id14">
-<h2>2.1.1 (2022-07-05)<a class="headerlink" href="#id14" title="Permalink to this heading"></a></h2>
+<section id="id16">
+<h2>2.1.1 (2022-07-05)<a class="headerlink" href="#id16" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version fixes issues with running GO enrichment that resulted from recent changes to UniProt’s API.  Moreover, this version slightly improves the performance of some functions.</p></li>
 </ul>
-<section id="id15">
-<h3>Changed<a class="headerlink" href="#id15" title="Permalink to this heading"></a></h3>
+<section id="id17">
+<h3>Changed<a class="headerlink" href="#id17" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed issues with running GO enrichment that resulted from changes to UniProt’s API.</p></li>
 <li><p>Some functions that fetch annotations now cache their results, leading to improved runtimes.</p></li>
@@ -299,61 +312,61 @@ <h3>Changed<a class="headerlink" href="#id15" title="Permalink to this heading">
 </ul>
 </section>
 </section>
-<section id="id16">
-<h2>2.1.0 (2022-04-16)<a class="headerlink" href="#id16" title="Permalink to this heading"></a></h2>
+<section id="id18">
+<h2>2.1.0 (2022-04-16)<a class="headerlink" href="#id18" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces multiple new features, as well as generally improved graphs and quality-of-life changes.</p></li>
 </ul>
-<section id="id17">
-<h3>Added<a class="headerlink" href="#id17" title="Permalink to this heading"></a></h3>
+<section id="id19">
+<h3>Added<a class="headerlink" href="#id19" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>GO enrichment can now generate Ontology Graphs for the statistically significant GO terms.</p></li>
 <li><p>Added CountFilter.split_clicom(), an implementation of the CLICOM ensemble-based clustering method (Mimaroglu and Yagci 2012).</p></li>
 <li><p>Added Filter.transform(), a method that can transform your data tables with either predefined or user-defined transformations.</p></li>
 </ul>
 </section>
-<section id="id18">
-<h3>Changed<a class="headerlink" href="#id18" title="Permalink to this heading"></a></h3>
+<section id="id20">
+<h3>Changed<a class="headerlink" href="#id20" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>CountFilter.pairplot() now uses a logarithmic scale by default.</p></li>
 <li><p>Visually improved the graphs generated by many functions, including CountFilter.pairplot() and CountFilter.plot_expression().</p></li>
 <li><p>The clusters resulting from all clustering functions are now sorted by size instead of being sorted randomly.</p></li>
 </ul>
 </section>
-<section id="id19">
-<h3>Fixed<a class="headerlink" href="#id19" title="Permalink to this heading"></a></h3>
+<section id="id21">
+<h3>Fixed<a class="headerlink" href="#id21" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Minor bug fixes.</p></li>
 </ul>
 </section>
 </section>
-<section id="id20">
-<h2>2.0.1 (2022-04-02)<a class="headerlink" href="#id20" title="Permalink to this heading"></a></h2>
+<section id="id22">
+<h2>2.0.1 (2022-04-02)<a class="headerlink" href="#id22" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces small bug fixes, as well as a new function in the Filtering module.</p></li>
 </ul>
-<section id="id21">
-<h3>Added<a class="headerlink" href="#id21" title="Permalink to this heading"></a></h3>
+<section id="id23">
+<h3>Added<a class="headerlink" href="#id23" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added Filter.majority_vote_intersection(), which returns a set/string of the features that appear in at least (majority_threhold * 100)% of the given Filter objects/sets.</p></li>
 </ul>
 </section>
-<section id="id22">
-<h3>Changed<a class="headerlink" href="#id22" title="Permalink to this heading"></a></h3>
+<section id="id24">
+<h3>Changed<a class="headerlink" href="#id24" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>When mapping/inferring taxon IDs during GO enrichment analysis, organisms will now be prioritized based on their taxon ID values (numerically lower IDs will be considered to be more relevant).</p></li>
 </ul>
 </section>
-<section id="id23">
-<h3>Fixed<a class="headerlink" href="#id23" title="Permalink to this heading"></a></h3>
+<section id="id25">
+<h3>Fixed<a class="headerlink" href="#id25" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed bug that occured when mapping/inferring taxon IDs during GO enrichment analysis, where integer taxon IDs would be matched by name similarity before trying an exact ID match, leading to spurious matches.</p></li>
 <li><p>Fixed bug that occursed when plotting clustering results with style=’all’ on Python 3.8.</p></li>
 </ul>
 </section>
 </section>
-<section id="id24">
-<h2>2.0.0 (2021-12-05)<a class="headerlink" href="#id24" title="Permalink to this heading"></a></h2>
+<section id="id26">
+<h2>2.0.0 (2021-12-05)<a class="headerlink" href="#id26" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces new method to cluster your read count matrices, including K-Means/Medoids clustering, Hierarchical clustering, and HDBSCAN.</p></li>
 <li><p>This version introduces many new ways to perform enrichment analysis and to visualize your results, including highly customizable GO Enrichment, enrichment based on ranked lists of genes, and enrichment for non-categorical attributes.</p></li>
@@ -361,8 +374,8 @@ <h2>2.0.0 (2021-12-05)<a class="headerlink" href="#id24" title="Permalink to thi
 <li><p>This version improves the performance of many functions in RNAlysis, and in particular the performance of randomization tests.</p></li>
 <li><p>This version includes changes to names and signatures of some functions in the module, as elaborated below.</p></li>
 </ul>
-<section id="id25">
-<h3>Added<a class="headerlink" href="#id25" title="Permalink to this heading"></a></h3>
+<section id="id27">
+<h3>Added<a class="headerlink" href="#id27" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added class Pipeline to filtering module, which applies a series of filter functions to specified Filter objects.</p></li>
 <li><p>Added CountFilter.split_kmeans(), CountFilter.split_kmedoids(), CountFilter.split_hierarchical() and CountFilter.split_hdbscan(), which split your read count matrices into clusters with similar expression patterns.</p></li>
@@ -374,8 +387,8 @@ <h3>Added<a class="headerlink" href="#id25" title="Permalink to this heading">
 <li><p>Added FeatureSet.change_set_name(), to give a new ‘set_name’ to a FeatureSet object.</p></li>
 </ul>
 </section>
-<section id="id26">
-<h3>Changed<a class="headerlink" href="#id26" title="Permalink to this heading"></a></h3>
+<section id="id28">
+<h3>Changed<a class="headerlink" href="#id28" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>FeatureSet.enrich_randomization_parallel() was deprecated. Instead, you can compute your enrichment analysis with parallel computing by calling FeatureSet.enrich_randomization() with the argument ‘parallel_processing=True’. Moreover, parallel session will now start automatically if one was not already active.</p></li>
 <li><p>Improved running time of enrich_randomization() about six-fold.</p></li>
@@ -392,8 +405,8 @@ <h3>Changed<a class="headerlink" href="#id26" title="Permalink to this heading">
 <li><p>Filter.biotypes_from_ref_table() and FeatureSet.biotypes_from_ref_table() now count features which do not appear in the Biotype Reference Table as ‘_missing_from_biotype_reference’ instead of ‘not_in_biotype_reference’.</p></li>
 </ul>
 </section>
-<section id="id27">
-<h3>Fixed<a class="headerlink" href="#id27" title="Permalink to this heading"></a></h3>
+<section id="id29">
+<h3>Fixed<a class="headerlink" href="#id29" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Updated type-hinting of specific functions.</p></li>
 <li><p>Filter.biotypes_from_ref_table() and FeatureSet.biotypes_from_ref_table() now support Biotype Reference Tables with different column names.</p></li>
@@ -404,20 +417,20 @@ <h3>Fixed<a class="headerlink" href="#id27" title="Permalink to this heading">
 </ul>
 </section>
 </section>
-<section id="id28">
-<h2>1.3.5 (2020-05-27)<a class="headerlink" href="#id28" title="Permalink to this heading"></a></h2>
+<section id="id30">
+<h2>1.3.5 (2020-05-27)<a class="headerlink" href="#id30" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version introduces minor bug fixes and a few more visualization options.</p></li>
 </ul>
-<section id="id29">
-<h3>Added<a class="headerlink" href="#id29" title="Permalink to this heading"></a></h3>
+<section id="id31">
+<h3>Added<a class="headerlink" href="#id31" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added Filter.filter_missing_values(), which can remove rows with NaN values in some (or all) columns.</p></li>
 <li><p>Added the visualization function CountFilter.box_plot().</p></li>
 </ul>
 </section>
-<section id="id30">
-<h3>Changed<a class="headerlink" href="#id30" title="Permalink to this heading"></a></h3>
+<section id="id32">
+<h3>Changed<a class="headerlink" href="#id32" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Updated docstrings and printouts of several functions.</p></li>
 <li><p>Slightly improved speed and performance across the board.</p></li>
@@ -426,8 +439,8 @@ <h3>Changed<a class="headerlink" href="#id30" title="Permalink to this heading">
 <li><p>Enrichment randomization functions can now return the matplotlib Figure object, in addition to the results table.</p></li>
 </ul>
 </section>
-<section id="id31">
-<h3>Fixed<a class="headerlink" href="#id31" title="Permalink to this heading"></a></h3>
+<section id="id33">
+<h3>Fixed<a class="headerlink" href="#id33" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed DepracationWarning on parsing functions from the general module.</p></li>
 <li><p>Fixed bug where saving csv files on Linux systems would save the files under the wrong directory.</p></li>
@@ -437,31 +450,31 @@ <h3>Fixed<a class="headerlink" href="#id31" title="Permalink to this heading">
 </ul>
 </section>
 </section>
-<section id="id32">
-<h2>1.3.4 (2020-04-07)<a class="headerlink" href="#id32" title="Permalink to this heading"></a></h2>
+<section id="id34">
+<h2>1.3.4 (2020-04-07)<a class="headerlink" href="#id34" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>This version fixed a bug that prevented installation of the package.</p></li>
 </ul>
-<section id="id33">
-<h3>Changed<a class="headerlink" href="#id33" title="Permalink to this heading"></a></h3>
+<section id="id35">
+<h3>Changed<a class="headerlink" href="#id35" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Updated docstrings and printouts of several functions</p></li>
 </ul>
 </section>
-<section id="id34">
-<h3>Fixed<a class="headerlink" href="#id34" title="Permalink to this heading"></a></h3>
+<section id="id36">
+<h3>Fixed<a class="headerlink" href="#id36" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Fixed a bug with installation of the previous version</p></li>
 </ul>
 </section>
 </section>
-<section id="id35">
-<h2>1.3.3 (2020-03-28)<a class="headerlink" href="#id35" title="Permalink to this heading"></a></h2>
+<section id="id37">
+<h2>1.3.3 (2020-03-28)<a class="headerlink" href="#id37" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>First stable release on PyPI.</p></li>
 </ul>
-<section id="id36">
-<h3>Added<a class="headerlink" href="#id36" title="Permalink to this heading"></a></h3>
+<section id="id38">
+<h3>Added<a class="headerlink" href="#id38" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Added Filter.sort(), and upgraded the functionality of Filter.filter_top_n().</p></li>
 <li><p>Added UpSet plots and Venn diagrams to enrichment module.</p></li>
@@ -473,8 +486,8 @@ <h3>Added<a class="headerlink" href="#id36" title="Permalink to this heading">
 <li><p>Added code examples to the user guide and to the docstrings of most functions.</p></li>
 </ul>
 </section>
-<section id="id37">
-<h3>Changed<a class="headerlink" href="#id37" title="Permalink to this heading"></a></h3>
+<section id="id39">
+<h3>Changed<a class="headerlink" href="#id39" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Changed argument order and default values in filtering.CountFilter.from_folder().</p></li>
 <li><p>Changed default title in scatter_sample_vs_sample().</p></li>
@@ -492,8 +505,8 @@ <h3>Changed<a class="headerlink" href="#id37" title="Permalink to this heading">
 <li><p>Made some functions in the general module hidden.</p></li>
 </ul>
 </section>
-<section id="id38">
-<h3>Fixed<a class="headerlink" href="#id38" title="Permalink to this heading"></a></h3>
+<section id="id40">
+<h3>Fixed<a class="headerlink" href="#id40" title="Permalink to this heading"></a></h3>
 <ul class="simple">
 <li><p>Various bug fixes</p></li>
 </ul>
@@ -505,8 +518,8 @@ <h3>Removed<a class="headerlink" href="#removed" title="Permalink to this headin
 </ul>
 </section>
 </section>
-<section id="id39">
-<h2>1.3.2 (2019-12-11)<a class="headerlink" href="#id39" title="Permalink to this heading"></a></h2>
+<section id="id41">
+<h2>1.3.2 (2019-12-11)<a class="headerlink" href="#id41" title="Permalink to this heading"></a></h2>
 <ul class="simple">
 <li><p>First beta release on PyPI.</p></li>
 </ul>
diff --git a/docs/build/index.html b/docs/build/index.html
index 41c0e5316..943f26964 100644
--- a/docs/build/index.html
+++ b/docs/build/index.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>RNAlysis 3.2.1 documentation &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>RNAlysis 3.2.2 documentation &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
@@ -88,7 +88,7 @@
           <div role="navigation" aria-label="Page navigation">
   <ul class="wy-breadcrumbs">
       <li><a href="#" class="icon icon-home"></a> &raquo;</li>
-      <li>RNAlysis 3.2.1 documentation</li>
+      <li>RNAlysis 3.2.2 documentation</li>
       <li class="wy-breadcrumbs-aside">
             <a href="_sources/index.rst.txt" rel="nofollow"> View page source</a>
       </li>
@@ -99,7 +99,7 @@
            <div itemprop="articleBody">
              
   <section id="rnalysis-release-documentation">
-<h1>RNAlysis 3.2.1 documentation<a class="headerlink" href="#rnalysis-release-documentation" title="Permalink to this heading"></a></h1>
+<h1>RNAlysis 3.2.2 documentation<a class="headerlink" href="#rnalysis-release-documentation" title="Permalink to this heading"></a></h1>
 <a class="reference external image-reference" href="https://guyteichman.github.io/RNAlysis"><img alt="logo" src="https://raw.githubusercontent.com/GuyTeichman/RNAlysis/master/docs/source/logo.png" style="width: 400px;" /></a>
 <p><strong>Useful links:</strong> <a class="reference external" href="https://guyteichman.github.io/RNAlysis">Documentation</a> |
 <a class="reference external" href="https://github.com/GuyTeichman/RNAlysis">Source code</a> |
@@ -151,19 +151,20 @@ <h1>RNAlysis 3.2.1 documentation<a class="headerlink" href="#rnalysis-release-do
 <p class="caption" role="heading"><span class="caption-text">Change history:</span></p>
 <ul>
 <li class="toctree-l1"><a class="reference internal" href="history.html">History</a><ul>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id1">3.2.1 (2022-11-25)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id2">3.2.0 (2022-11-23)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id5">3.1.0 (2022-10-16)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id9">3.0.1 (2022-10-12)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id10">3.0.0 (2022-10-10)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id14">2.1.1 (2022-07-05)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id16">2.1.0 (2022-04-16)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id20">2.0.1 (2022-04-02)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id24">2.0.0 (2021-12-05)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id28">1.3.5 (2020-05-27)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id32">1.3.4 (2020-04-07)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id35">1.3.3 (2020-03-28)</a></li>
-<li class="toctree-l2"><a class="reference internal" href="history.html#id39">1.3.2 (2019-12-11)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id1">3.2.2 (2022-11-25)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id2">3.2.1 (2022-11-25)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id4">3.2.0 (2022-11-23)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id7">3.1.0 (2022-10-16)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id11">3.0.1 (2022-10-12)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id12">3.0.0 (2022-10-10)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id16">2.1.1 (2022-07-05)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id18">2.1.0 (2022-04-16)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id22">2.0.1 (2022-04-02)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id26">2.0.0 (2021-12-05)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id30">1.3.5 (2020-05-27)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id34">1.3.4 (2020-04-07)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id37">1.3.3 (2020-03-28)</a></li>
+<li class="toctree-l2"><a class="reference internal" href="history.html#id41">1.3.2 (2019-12-11)</a></li>
 </ul>
 </li>
 </ul>
diff --git a/docs/build/installation.html b/docs/build/installation.html
index 690d76c91..688252e00 100644
--- a/docs/build/installation.html
+++ b/docs/build/installation.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Installation &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Installation &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/objects.inv b/docs/build/objects.inv
index d5617b74d..38ae52d53 100644
Binary files a/docs/build/objects.inv and b/docs/build/objects.inv differ
diff --git a/docs/build/py-modindex.html b/docs/build/py-modindex.html
index 5cb3d06be..101fa5de1 100644
--- a/docs/build/py-modindex.html
+++ b/docs/build/py-modindex.html
@@ -3,7 +3,7 @@
 <head>
   <meta charset="utf-8" />
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Python Module Index &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Python Module Index &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/readme.html b/docs/build/readme.html
index 675f3f83f..ee87c9672 100644
--- a/docs/build/readme.html
+++ b/docs/build/readme.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>What is RNAlysis? &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>What is RNAlysis? &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
@@ -23,7 +23,7 @@
     <link rel="index" title="Index" href="genindex.html" />
     <link rel="search" title="Search" href="search.html" />
     <link rel="next" title="Installation" href="installation.html" />
-    <link rel="prev" title="RNAlysis 3.2.1 documentation" href="index.html" /> 
+    <link rel="prev" title="RNAlysis 3.2.2 documentation" href="index.html" /> 
 </head>
 
 <body class="wy-body-for-nav"> 
@@ -272,7 +272,7 @@ <h2>Contributors<a class="headerlink" href="#contributors" title="Permalink to t
            </div>
           </div>
           <footer><div class="rst-footer-buttons" role="navigation" aria-label="Footer">
-        <a href="index.html" class="btn btn-neutral float-left" title="RNAlysis 3.2.1 documentation" accesskey="p" rel="prev"><span class="fa fa-arrow-circle-left" aria-hidden="true"></span> Previous</a>
+        <a href="index.html" class="btn btn-neutral float-left" title="RNAlysis 3.2.2 documentation" accesskey="p" rel="prev"><span class="fa fa-arrow-circle-left" aria-hidden="true"></span> Previous</a>
         <a href="installation.html" class="btn btn-neutral float-right" title="Installation" accesskey="n" rel="next">Next <span class="fa fa-arrow-circle-right" aria-hidden="true"></span></a>
     </div>
 
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.biotypes.html b/docs/build/rnalysis.enrichment.FeatureSet.biotypes.html
index 38a5f0bc4..8273e0eb6 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.biotypes.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.biotypes.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.biotypes &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.biotypes &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.change_set_name.html b/docs/build/rnalysis.enrichment.FeatureSet.change_set_name.html
index d4066f515..e242699ce 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.change_set_name.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.change_set_name.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.change_set_name &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.change_set_name &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.difference.html b/docs/build/rnalysis.enrichment.FeatureSet.difference.html
index c60e2bb58..15c96ce7c 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.difference.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.enrich_hypergeometric.html b/docs/build/rnalysis.enrichment.FeatureSet.enrich_hypergeometric.html
index 25b58317f..2af59674e 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.enrich_hypergeometric.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.enrich_hypergeometric.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.enrich_hypergeometric &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.enrich_hypergeometric &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.enrich_randomization.html b/docs/build/rnalysis.enrichment.FeatureSet.enrich_randomization.html
index d7864c85d..b779292f1 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.enrich_randomization.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.enrich_randomization.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.enrich_randomization &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.enrich_randomization &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.go_enrichment.html b/docs/build/rnalysis.enrichment.FeatureSet.go_enrichment.html
index c34ac2c30..876400a1c 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.go_enrichment.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.go_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.go_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.go_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.html b/docs/build/rnalysis.enrichment.FeatureSet.html
index d21ce17e8..e963bc54e 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.intersection.html b/docs/build/rnalysis.enrichment.FeatureSet.intersection.html
index 2c2e7c201..bcc8b3614 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.intersection.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.kegg_enrichment.html b/docs/build/rnalysis.enrichment.FeatureSet.kegg_enrichment.html
index 4b6a279c0..075796adf 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.kegg_enrichment.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.kegg_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.kegg_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.kegg_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.non_categorical_enrichment.html b/docs/build/rnalysis.enrichment.FeatureSet.non_categorical_enrichment.html
index 54ef83dff..5a3328ba3 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.non_categorical_enrichment.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.non_categorical_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.non_categorical_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.non_categorical_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.save_txt.html b/docs/build/rnalysis.enrichment.FeatureSet.save_txt.html
index 9c0d6c5e4..1eace4fa1 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.save_txt.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.save_txt.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.save_txt &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.save_txt &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.symmetric_difference.html b/docs/build/rnalysis.enrichment.FeatureSet.symmetric_difference.html
index 8ce7028a4..bc9e1ac18 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.symmetric_difference.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.union.html b/docs/build/rnalysis.enrichment.FeatureSet.union.html
index f66fa91d9..567dd57f5 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.union.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.FeatureSet.user_defined_enrichment.html b/docs/build/rnalysis.enrichment.FeatureSet.user_defined_enrichment.html
index 2edad65be..15c98fcca 100644
--- a/docs/build/rnalysis.enrichment.FeatureSet.user_defined_enrichment.html
+++ b/docs/build/rnalysis.enrichment.FeatureSet.user_defined_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.FeatureSet.user_defined_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.FeatureSet.user_defined_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.biotypes.html b/docs/build/rnalysis.enrichment.RankedSet.biotypes.html
index af3f97c2c..5c4f8ef92 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.biotypes.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.biotypes.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.biotypes &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.biotypes &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.change_set_name.html b/docs/build/rnalysis.enrichment.RankedSet.change_set_name.html
index 3de02529c..83f6fbaf3 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.change_set_name.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.change_set_name.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.change_set_name &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.change_set_name &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.difference.html b/docs/build/rnalysis.enrichment.RankedSet.difference.html
index 52d91906c..de915e167 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.difference.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.enrich_hypergeometric.html b/docs/build/rnalysis.enrichment.RankedSet.enrich_hypergeometric.html
index ac1c43cb0..c6d332cdd 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.enrich_hypergeometric.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.enrich_hypergeometric.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.enrich_hypergeometric &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.enrich_hypergeometric &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.enrich_randomization.html b/docs/build/rnalysis.enrichment.RankedSet.enrich_randomization.html
index 83cbb539f..0644df20e 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.enrich_randomization.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.enrich_randomization.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.enrich_randomization &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.enrich_randomization &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.go_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.go_enrichment.html
index 7298d4136..d1aae3443 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.go_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.go_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.go_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.go_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.html b/docs/build/rnalysis.enrichment.RankedSet.html
index 7b541e801..1bfc4f494 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.intersection.html b/docs/build/rnalysis.enrichment.RankedSet.intersection.html
index dba2c4ca3..6bb2d6cf3 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.intersection.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.kegg_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.kegg_enrichment.html
index 4d8d51377..05078dc42 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.kegg_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.kegg_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.kegg_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.kegg_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.non_categorical_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.non_categorical_enrichment.html
index 919d52454..681db7df5 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.non_categorical_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.non_categorical_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.non_categorical_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.non_categorical_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.save_txt.html b/docs/build/rnalysis.enrichment.RankedSet.save_txt.html
index 4ddbc6f88..0be115083 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.save_txt.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.save_txt.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.save_txt &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.save_txt &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.single_set_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.single_set_enrichment.html
index 437bd2d20..2647e6675 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.single_set_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.single_set_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.single_set_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.single_set_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.single_set_go_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.single_set_go_enrichment.html
index ebab8a8eb..3a603fab9 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.single_set_go_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.single_set_go_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.single_set_go_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.single_set_go_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.html
index 4caca8b9c..59fe3aa39 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.single_set_kegg_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.single_set_kegg_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.symmetric_difference.html b/docs/build/rnalysis.enrichment.RankedSet.symmetric_difference.html
index f6ecf46dc..2bdcc33a4 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.symmetric_difference.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.union.html b/docs/build/rnalysis.enrichment.RankedSet.union.html
index 4d538de0e..121610f69 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.union.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.RankedSet.user_defined_enrichment.html b/docs/build/rnalysis.enrichment.RankedSet.user_defined_enrichment.html
index fad2090b9..30c319f0a 100644
--- a/docs/build/rnalysis.enrichment.RankedSet.user_defined_enrichment.html
+++ b/docs/build/rnalysis.enrichment.RankedSet.user_defined_enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.RankedSet.user_defined_enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.RankedSet.user_defined_enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.html b/docs/build/rnalysis.enrichment.html
index 8a68c46fe..602db4216 100644
--- a/docs/build/rnalysis.enrichment.html
+++ b/docs/build/rnalysis.enrichment.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.plot_enrichment_results.html b/docs/build/rnalysis.enrichment.plot_enrichment_results.html
index 6fe1a71d5..bee7bd539 100644
--- a/docs/build/rnalysis.enrichment.plot_enrichment_results.html
+++ b/docs/build/rnalysis.enrichment.plot_enrichment_results.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.plot_enrichment_results &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.plot_enrichment_results &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.upset_plot.html b/docs/build/rnalysis.enrichment.upset_plot.html
index a3cb69983..3b4fec2ae 100644
--- a/docs/build/rnalysis.enrichment.upset_plot.html
+++ b/docs/build/rnalysis.enrichment.upset_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.upset_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.upset_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.enrichment.venn_diagram.html b/docs/build/rnalysis.enrichment.venn_diagram.html
index 0a75f0202..42cdaf5d0 100644
--- a/docs/build/rnalysis.enrichment.venn_diagram.html
+++ b/docs/build/rnalysis.enrichment.venn_diagram.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.enrichment.venn_diagram &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.enrichment.venn_diagram &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.average_replicate_samples.html b/docs/build/rnalysis.filtering.CountFilter.average_replicate_samples.html
index 14ee74f31..46281bdd8 100644
--- a/docs/build/rnalysis.filtering.CountFilter.average_replicate_samples.html
+++ b/docs/build/rnalysis.filtering.CountFilter.average_replicate_samples.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.average_replicate_samples &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.average_replicate_samples &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.biotypes_from_gtf.html b/docs/build/rnalysis.filtering.CountFilter.biotypes_from_gtf.html
index 1e8d4cb7b..64d289857 100644
--- a/docs/build/rnalysis.filtering.CountFilter.biotypes_from_gtf.html
+++ b/docs/build/rnalysis.filtering.CountFilter.biotypes_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.biotypes_from_ref_table.html b/docs/build/rnalysis.filtering.CountFilter.biotypes_from_ref_table.html
index 731485c30..6af57b209 100644
--- a/docs/build/rnalysis.filtering.CountFilter.biotypes_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.CountFilter.biotypes_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.box_plot.html b/docs/build/rnalysis.filtering.CountFilter.box_plot.html
index 786dcc59b..97f8d4578 100644
--- a/docs/build/rnalysis.filtering.CountFilter.box_plot.html
+++ b/docs/build/rnalysis.filtering.CountFilter.box_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.box_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.box_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.clustergram.html b/docs/build/rnalysis.filtering.CountFilter.clustergram.html
index 229a94292..5eefba42c 100644
--- a/docs/build/rnalysis.filtering.CountFilter.clustergram.html
+++ b/docs/build/rnalysis.filtering.CountFilter.clustergram.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.clustergram &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.clustergram &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.describe.html b/docs/build/rnalysis.filtering.CountFilter.describe.html
index 897e9e92e..613448065 100644
--- a/docs/build/rnalysis.filtering.CountFilter.describe.html
+++ b/docs/build/rnalysis.filtering.CountFilter.describe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.describe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.describe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.difference.html b/docs/build/rnalysis.filtering.CountFilter.difference.html
index cde915ab0..a145462b8 100644
--- a/docs/build/rnalysis.filtering.CountFilter.difference.html
+++ b/docs/build/rnalysis.filtering.CountFilter.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.differential_expression_deseq2.html b/docs/build/rnalysis.filtering.CountFilter.differential_expression_deseq2.html
index 2bcb50d9f..6b16afb28 100644
--- a/docs/build/rnalysis.filtering.CountFilter.differential_expression_deseq2.html
+++ b/docs/build/rnalysis.filtering.CountFilter.differential_expression_deseq2.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.differential_expression_deseq2 &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.differential_expression_deseq2 &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.enhanced_box_plot.html b/docs/build/rnalysis.filtering.CountFilter.enhanced_box_plot.html
index b25489826..e946db2c5 100644
--- a/docs/build/rnalysis.filtering.CountFilter.enhanced_box_plot.html
+++ b/docs/build/rnalysis.filtering.CountFilter.enhanced_box_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.enhanced_box_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.enhanced_box_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_gtf.html b/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_gtf.html
index 2d559a834..8f24a5ef3 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_gtf.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.html b/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.html
index b0060398d..524b11a5f 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_by_attribute.html b/docs/build/rnalysis.filtering.CountFilter.filter_by_attribute.html
index 8e7a0250f..ca8a4dce9 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_by_attribute.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_by_go_annotations.html b/docs/build/rnalysis.filtering.CountFilter.filter_by_go_annotations.html
index eb633641f..28e29bec6 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_by_go_annotations.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_by_go_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_by_kegg_annotations.html b/docs/build/rnalysis.filtering.CountFilter.filter_by_kegg_annotations.html
index 89cb703db..d2ede6dfc 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_by_kegg_annotations.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_by_kegg_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_by_row_sum.html b/docs/build/rnalysis.filtering.CountFilter.filter_by_row_sum.html
index 08b4bac2f..0a4f2b793 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_by_row_sum.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_by_row_sum.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_by_row_sum &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_by_row_sum &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_low_reads.html b/docs/build/rnalysis.filtering.CountFilter.filter_low_reads.html
index eb9549faa..ecb890ef9 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_low_reads.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_low_reads.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_low_reads &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_low_reads &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_missing_values.html b/docs/build/rnalysis.filtering.CountFilter.filter_missing_values.html
index 588923a00..b162e80fc 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_missing_values.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_missing_values.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_missing_values &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_missing_values &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_percentile.html b/docs/build/rnalysis.filtering.CountFilter.filter_percentile.html
index 94fab78e3..b5719a645 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_percentile.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.filter_top_n.html b/docs/build/rnalysis.filtering.CountFilter.filter_top_n.html
index 48ff9da2c..123846ae0 100644
--- a/docs/build/rnalysis.filtering.CountFilter.filter_top_n.html
+++ b/docs/build/rnalysis.filtering.CountFilter.filter_top_n.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.filter_top_n &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.filter_top_n &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.fold_change.html b/docs/build/rnalysis.filtering.CountFilter.fold_change.html
index b2e87e6c2..ea133a52c 100644
--- a/docs/build/rnalysis.filtering.CountFilter.fold_change.html
+++ b/docs/build/rnalysis.filtering.CountFilter.fold_change.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.fold_change &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.fold_change &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.from_dataframe.html b/docs/build/rnalysis.filtering.CountFilter.from_dataframe.html
index e674d0d3c..a7e80c43e 100644
--- a/docs/build/rnalysis.filtering.CountFilter.from_dataframe.html
+++ b/docs/build/rnalysis.filtering.CountFilter.from_dataframe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.from_dataframe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.from_dataframe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.from_folder.html b/docs/build/rnalysis.filtering.CountFilter.from_folder.html
index b486a05c4..07d7f3be5 100644
--- a/docs/build/rnalysis.filtering.CountFilter.from_folder.html
+++ b/docs/build/rnalysis.filtering.CountFilter.from_folder.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.from_folder &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.from_folder &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.head.html b/docs/build/rnalysis.filtering.CountFilter.head.html
index 64eceed1c..5dc35ff69 100644
--- a/docs/build/rnalysis.filtering.CountFilter.head.html
+++ b/docs/build/rnalysis.filtering.CountFilter.head.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.head &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.head &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.html b/docs/build/rnalysis.filtering.CountFilter.html
index f2412811b..5b846224e 100644
--- a/docs/build/rnalysis.filtering.CountFilter.html
+++ b/docs/build/rnalysis.filtering.CountFilter.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.intersection.html b/docs/build/rnalysis.filtering.CountFilter.intersection.html
index d74c13a23..6e81da3fe 100644
--- a/docs/build/rnalysis.filtering.CountFilter.intersection.html
+++ b/docs/build/rnalysis.filtering.CountFilter.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.ma_plot.html b/docs/build/rnalysis.filtering.CountFilter.ma_plot.html
index 391157f20..3163d9e47 100644
--- a/docs/build/rnalysis.filtering.CountFilter.ma_plot.html
+++ b/docs/build/rnalysis.filtering.CountFilter.ma_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.ma_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.ma_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.majority_vote_intersection.html b/docs/build/rnalysis.filtering.CountFilter.majority_vote_intersection.html
index 932b720fa..15fe0b4b3 100644
--- a/docs/build/rnalysis.filtering.CountFilter.majority_vote_intersection.html
+++ b/docs/build/rnalysis.filtering.CountFilter.majority_vote_intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.majority_vote_intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.majority_vote_intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_median_of_ratios.html b/docs/build/rnalysis.filtering.CountFilter.normalize_median_of_ratios.html
index ba6b29969..07fb2f27a 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_median_of_ratios.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_median_of_ratios.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_median_of_ratios &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_median_of_ratios &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_rle.html b/docs/build/rnalysis.filtering.CountFilter.normalize_rle.html
index caadb825c..a6a79de68 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_rle.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_rle.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_rle &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_rle &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_tmm.html b/docs/build/rnalysis.filtering.CountFilter.normalize_tmm.html
index 3aad699ef..d2df4f482 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_tmm.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_tmm.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_tmm &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_tmm &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_to_quantile.html b/docs/build/rnalysis.filtering.CountFilter.normalize_to_quantile.html
index ed1be48a5..ed40d6cc4 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_to_quantile.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_to_quantile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_to_quantile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_to_quantile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm.html b/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm.html
index 2fc6bf339..7f62541c5 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_to_rpm &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_to_rpm &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.html b/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.html
index a1d0a9890..4542b2e38 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.normalize_with_scaling_factors.html b/docs/build/rnalysis.filtering.CountFilter.normalize_with_scaling_factors.html
index 88120acfa..a2815d207 100644
--- a/docs/build/rnalysis.filtering.CountFilter.normalize_with_scaling_factors.html
+++ b/docs/build/rnalysis.filtering.CountFilter.normalize_with_scaling_factors.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.normalize_with_scaling_factors &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.normalize_with_scaling_factors &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.number_filters.html b/docs/build/rnalysis.filtering.CountFilter.number_filters.html
index ab6677f4a..3a4c7b309 100644
--- a/docs/build/rnalysis.filtering.CountFilter.number_filters.html
+++ b/docs/build/rnalysis.filtering.CountFilter.number_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.number_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.number_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.pairplot.html b/docs/build/rnalysis.filtering.CountFilter.pairplot.html
index bc7182c7c..754638c09 100644
--- a/docs/build/rnalysis.filtering.CountFilter.pairplot.html
+++ b/docs/build/rnalysis.filtering.CountFilter.pairplot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.pairplot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.pairplot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.pca.html b/docs/build/rnalysis.filtering.CountFilter.pca.html
index 82902dfbf..c283c622a 100644
--- a/docs/build/rnalysis.filtering.CountFilter.pca.html
+++ b/docs/build/rnalysis.filtering.CountFilter.pca.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.pca &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.pca &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.plot_expression.html b/docs/build/rnalysis.filtering.CountFilter.plot_expression.html
index b0e55ed13..41263c93a 100644
--- a/docs/build/rnalysis.filtering.CountFilter.plot_expression.html
+++ b/docs/build/rnalysis.filtering.CountFilter.plot_expression.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.plot_expression &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.plot_expression &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.print_features.html b/docs/build/rnalysis.filtering.CountFilter.print_features.html
index fe2934e5f..5718af08d 100644
--- a/docs/build/rnalysis.filtering.CountFilter.print_features.html
+++ b/docs/build/rnalysis.filtering.CountFilter.print_features.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.print_features &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.print_features &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.save_csv.html b/docs/build/rnalysis.filtering.CountFilter.save_csv.html
index 737f44409..600fe311f 100644
--- a/docs/build/rnalysis.filtering.CountFilter.save_csv.html
+++ b/docs/build/rnalysis.filtering.CountFilter.save_csv.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.save_csv &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.save_csv &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.scatter_sample_vs_sample.html b/docs/build/rnalysis.filtering.CountFilter.scatter_sample_vs_sample.html
index 0da204bfc..d5c2b0dae 100644
--- a/docs/build/rnalysis.filtering.CountFilter.scatter_sample_vs_sample.html
+++ b/docs/build/rnalysis.filtering.CountFilter.scatter_sample_vs_sample.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.scatter_sample_vs_sample &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.scatter_sample_vs_sample &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.sort.html b/docs/build/rnalysis.filtering.CountFilter.sort.html
index 6308392d9..26b4d9584 100644
--- a/docs/build/rnalysis.filtering.CountFilter.sort.html
+++ b/docs/build/rnalysis.filtering.CountFilter.sort.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.sort &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.sort &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_by_attribute.html b/docs/build/rnalysis.filtering.CountFilter.split_by_attribute.html
index adacfebc8..2628df8c2 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_by_attribute.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_by_percentile.html b/docs/build/rnalysis.filtering.CountFilter.split_by_percentile.html
index 56832b2b6..b17a6ca5e 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_by_percentile.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_by_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_by_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_by_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_by_reads.html b/docs/build/rnalysis.filtering.CountFilter.split_by_reads.html
index 0fd101fd4..a7ca4bb02 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_by_reads.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_by_reads.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_by_reads &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_by_reads &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_clicom.html b/docs/build/rnalysis.filtering.CountFilter.split_clicom.html
index 00a1d99a9..51dfee101 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_clicom.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_clicom.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_clicom &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_clicom &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_hdbscan.html b/docs/build/rnalysis.filtering.CountFilter.split_hdbscan.html
index 59c33acb4..30148b6c1 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_hdbscan.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_hdbscan.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_hdbscan &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_hdbscan &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_hierarchical.html b/docs/build/rnalysis.filtering.CountFilter.split_hierarchical.html
index fc40d63bc..6d44a5c5b 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_hierarchical.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_hierarchical.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_hierarchical &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_hierarchical &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_kmeans.html b/docs/build/rnalysis.filtering.CountFilter.split_kmeans.html
index 28f517944..cb4981285 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_kmeans.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_kmeans.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_kmeans &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_kmeans &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.split_kmedoids.html b/docs/build/rnalysis.filtering.CountFilter.split_kmedoids.html
index f0a8a198d..e8aec89ac 100644
--- a/docs/build/rnalysis.filtering.CountFilter.split_kmedoids.html
+++ b/docs/build/rnalysis.filtering.CountFilter.split_kmedoids.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.split_kmedoids &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.split_kmedoids &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.symmetric_difference.html b/docs/build/rnalysis.filtering.CountFilter.symmetric_difference.html
index a79a0f226..d0c769d01 100644
--- a/docs/build/rnalysis.filtering.CountFilter.symmetric_difference.html
+++ b/docs/build/rnalysis.filtering.CountFilter.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.tail.html b/docs/build/rnalysis.filtering.CountFilter.tail.html
index f813e3380..0662f4f0b 100644
--- a/docs/build/rnalysis.filtering.CountFilter.tail.html
+++ b/docs/build/rnalysis.filtering.CountFilter.tail.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.tail &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.tail &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.text_filters.html b/docs/build/rnalysis.filtering.CountFilter.text_filters.html
index 2570ba669..0e0123f29 100644
--- a/docs/build/rnalysis.filtering.CountFilter.text_filters.html
+++ b/docs/build/rnalysis.filtering.CountFilter.text_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.text_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.text_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.transform.html b/docs/build/rnalysis.filtering.CountFilter.transform.html
index 1e3e2049b..2d5a491f4 100644
--- a/docs/build/rnalysis.filtering.CountFilter.transform.html
+++ b/docs/build/rnalysis.filtering.CountFilter.transform.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.transform &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.transform &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.translate_gene_ids.html b/docs/build/rnalysis.filtering.CountFilter.translate_gene_ids.html
index 7e8a71ea0..e29a4c468 100644
--- a/docs/build/rnalysis.filtering.CountFilter.translate_gene_ids.html
+++ b/docs/build/rnalysis.filtering.CountFilter.translate_gene_ids.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.translate_gene_ids &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.translate_gene_ids &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.union.html b/docs/build/rnalysis.filtering.CountFilter.union.html
index a63907cd2..515c5b06d 100644
--- a/docs/build/rnalysis.filtering.CountFilter.union.html
+++ b/docs/build/rnalysis.filtering.CountFilter.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.CountFilter.violin_plot.html b/docs/build/rnalysis.filtering.CountFilter.violin_plot.html
index 477add611..eecf95ec3 100644
--- a/docs/build/rnalysis.filtering.CountFilter.violin_plot.html
+++ b/docs/build/rnalysis.filtering.CountFilter.violin_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.CountFilter.violin_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.CountFilter.violin_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_gtf.html b/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_gtf.html
index 894ad7f69..67a9b32f3 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_gtf.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.html b/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.html
index d17808e3d..001fa26aa 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.describe.html b/docs/build/rnalysis.filtering.DESeqFilter.describe.html
index af7a2c7f5..a483af585 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.describe.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.describe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.describe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.describe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.difference.html b/docs/build/rnalysis.filtering.DESeqFilter.difference.html
index f8b04f822..97e2d07c4 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.difference.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.html
index 1ca68d39a..4d98dd4b2 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.html
index d08c2813b..00450e531 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.html
index f8733c5d4..9a555efc1 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_attribute.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_attribute.html
index 44e469693..2dabe55b2 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_attribute.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_go_annotations.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_go_annotations.html
index 454130942..2124ccd52 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_go_annotations.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_go_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.html
index 7a1eac131..94c159bcb 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_fold_change_direction.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_fold_change_direction.html
index c3b26b68e..8d54ccb38 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_fold_change_direction.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_fold_change_direction.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_fold_change_direction &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_fold_change_direction &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_missing_values.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_missing_values.html
index 7e60d8cb5..adc2b0b24 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_missing_values.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_missing_values.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_missing_values &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_missing_values &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_percentile.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_percentile.html
index 398b56330..3f2b4fa4a 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_percentile.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_significant.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_significant.html
index 67dc073ee..db683a040 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_significant.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_significant.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_significant &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_significant &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.filter_top_n.html b/docs/build/rnalysis.filtering.DESeqFilter.filter_top_n.html
index 8f137c7fc..cc4e4e85e 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.filter_top_n.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.filter_top_n.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.filter_top_n &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.filter_top_n &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.from_dataframe.html b/docs/build/rnalysis.filtering.DESeqFilter.from_dataframe.html
index ad6157ba9..5fc891026 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.from_dataframe.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.from_dataframe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.from_dataframe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.from_dataframe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.head.html b/docs/build/rnalysis.filtering.DESeqFilter.head.html
index 1ffc60f63..70c7f0ebd 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.head.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.head.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.head &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.head &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.html b/docs/build/rnalysis.filtering.DESeqFilter.html
index 335a8bdc6..e31375fd8 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.intersection.html b/docs/build/rnalysis.filtering.DESeqFilter.intersection.html
index cd72049ad..5bb2a8354 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.intersection.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.majority_vote_intersection.html b/docs/build/rnalysis.filtering.DESeqFilter.majority_vote_intersection.html
index dd3ba43cc..ae1dc3f21 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.majority_vote_intersection.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.majority_vote_intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.majority_vote_intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.majority_vote_intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.number_filters.html b/docs/build/rnalysis.filtering.DESeqFilter.number_filters.html
index 342a4576d..b31fd989c 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.number_filters.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.number_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.number_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.number_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.print_features.html b/docs/build/rnalysis.filtering.DESeqFilter.print_features.html
index 8b92a5114..1837c07fd 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.print_features.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.print_features.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.print_features &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.print_features &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.save_csv.html b/docs/build/rnalysis.filtering.DESeqFilter.save_csv.html
index 5f6f185c0..8c6dd2202 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.save_csv.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.save_csv.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.save_csv &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.save_csv &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.sort.html b/docs/build/rnalysis.filtering.DESeqFilter.sort.html
index 5db49b82e..47aa8a160 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.sort.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.sort.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.sort &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.sort &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.split_by_attribute.html b/docs/build/rnalysis.filtering.DESeqFilter.split_by_attribute.html
index c67b2413b..67aa2d4b8 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.split_by_attribute.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.split_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.split_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.split_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.split_by_percentile.html b/docs/build/rnalysis.filtering.DESeqFilter.split_by_percentile.html
index 716ad6c3b..2a4e2bc73 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.split_by_percentile.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.split_by_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.split_by_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.split_by_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.split_fold_change_direction.html b/docs/build/rnalysis.filtering.DESeqFilter.split_fold_change_direction.html
index 0eff6e0e5..3288bc042 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.split_fold_change_direction.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.split_fold_change_direction.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.split_fold_change_direction &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.split_fold_change_direction &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.symmetric_difference.html b/docs/build/rnalysis.filtering.DESeqFilter.symmetric_difference.html
index 3fccc7df4..d4e413374 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.symmetric_difference.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.tail.html b/docs/build/rnalysis.filtering.DESeqFilter.tail.html
index 190676397..0565b935b 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.tail.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.tail.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.tail &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.tail &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.text_filters.html b/docs/build/rnalysis.filtering.DESeqFilter.text_filters.html
index be402693d..9a368117f 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.text_filters.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.text_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.text_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.text_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.transform.html b/docs/build/rnalysis.filtering.DESeqFilter.transform.html
index 3cc593020..e688ad0e5 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.transform.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.transform.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.transform &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.transform &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.translate_gene_ids.html b/docs/build/rnalysis.filtering.DESeqFilter.translate_gene_ids.html
index 19877ef54..e8375aaeb 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.translate_gene_ids.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.translate_gene_ids.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.translate_gene_ids &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.translate_gene_ids &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.union.html b/docs/build/rnalysis.filtering.DESeqFilter.union.html
index 68fdd6c85..c2921cd65 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.union.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.DESeqFilter.volcano_plot.html b/docs/build/rnalysis.filtering.DESeqFilter.volcano_plot.html
index 4c8c86d85..3a8bb5a8e 100644
--- a/docs/build/rnalysis.filtering.DESeqFilter.volcano_plot.html
+++ b/docs/build/rnalysis.filtering.DESeqFilter.volcano_plot.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.DESeqFilter.volcano_plot &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.DESeqFilter.volcano_plot &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.biotypes_from_gtf.html b/docs/build/rnalysis.filtering.Filter.biotypes_from_gtf.html
index dcbfee2ca..cd7019422 100644
--- a/docs/build/rnalysis.filtering.Filter.biotypes_from_gtf.html
+++ b/docs/build/rnalysis.filtering.Filter.biotypes_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.biotypes_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.biotypes_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.biotypes_from_ref_table.html b/docs/build/rnalysis.filtering.Filter.biotypes_from_ref_table.html
index 0e96f2632..15b210ac1 100644
--- a/docs/build/rnalysis.filtering.Filter.biotypes_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.Filter.biotypes_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.biotypes_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.biotypes_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.describe.html b/docs/build/rnalysis.filtering.Filter.describe.html
index bf7372404..a553ee29a 100644
--- a/docs/build/rnalysis.filtering.Filter.describe.html
+++ b/docs/build/rnalysis.filtering.Filter.describe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.describe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.describe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.difference.html b/docs/build/rnalysis.filtering.Filter.difference.html
index f32f8047c..e434eca24 100644
--- a/docs/build/rnalysis.filtering.Filter.difference.html
+++ b/docs/build/rnalysis.filtering.Filter.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_biotype_from_gtf.html b/docs/build/rnalysis.filtering.Filter.filter_biotype_from_gtf.html
index b10a3dbb6..d29658adb 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_biotype_from_gtf.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_biotype_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_biotype_from_ref_table.html b/docs/build/rnalysis.filtering.Filter.filter_biotype_from_ref_table.html
index 3bcfb8a7d..68fc3f4a4 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_biotype_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_biotype_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_by_attribute.html b/docs/build/rnalysis.filtering.Filter.filter_by_attribute.html
index 6e41e81cc..653520626 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_by_attribute.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_by_go_annotations.html b/docs/build/rnalysis.filtering.Filter.filter_by_go_annotations.html
index 2036c3bb5..680cdfea0 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_by_go_annotations.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_by_go_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_by_go_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_by_go_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_by_kegg_annotations.html b/docs/build/rnalysis.filtering.Filter.filter_by_kegg_annotations.html
index 5ded43a54..0adbdfdeb 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_by_kegg_annotations.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_by_kegg_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_missing_values.html b/docs/build/rnalysis.filtering.Filter.filter_missing_values.html
index 4a3f32ed4..a3f4a94b5 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_missing_values.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_missing_values.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_missing_values &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_missing_values &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_percentile.html b/docs/build/rnalysis.filtering.Filter.filter_percentile.html
index f2cd71c9b..997c7494f 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_percentile.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.filter_top_n.html b/docs/build/rnalysis.filtering.Filter.filter_top_n.html
index 313d39973..72392c1a7 100644
--- a/docs/build/rnalysis.filtering.Filter.filter_top_n.html
+++ b/docs/build/rnalysis.filtering.Filter.filter_top_n.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.filter_top_n &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.filter_top_n &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.from_dataframe.html b/docs/build/rnalysis.filtering.Filter.from_dataframe.html
index 75852c263..45b709f5f 100644
--- a/docs/build/rnalysis.filtering.Filter.from_dataframe.html
+++ b/docs/build/rnalysis.filtering.Filter.from_dataframe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.from_dataframe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.from_dataframe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.head.html b/docs/build/rnalysis.filtering.Filter.head.html
index 54c3a8af0..4adf15be7 100644
--- a/docs/build/rnalysis.filtering.Filter.head.html
+++ b/docs/build/rnalysis.filtering.Filter.head.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.head &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.head &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.html b/docs/build/rnalysis.filtering.Filter.html
index 3d5384cca..0c51a2c16 100644
--- a/docs/build/rnalysis.filtering.Filter.html
+++ b/docs/build/rnalysis.filtering.Filter.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.intersection.html b/docs/build/rnalysis.filtering.Filter.intersection.html
index 167ee2a94..d9c045d92 100644
--- a/docs/build/rnalysis.filtering.Filter.intersection.html
+++ b/docs/build/rnalysis.filtering.Filter.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.majority_vote_intersection.html b/docs/build/rnalysis.filtering.Filter.majority_vote_intersection.html
index 386ebe6aa..2c2a0cdb7 100644
--- a/docs/build/rnalysis.filtering.Filter.majority_vote_intersection.html
+++ b/docs/build/rnalysis.filtering.Filter.majority_vote_intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.majority_vote_intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.majority_vote_intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.number_filters.html b/docs/build/rnalysis.filtering.Filter.number_filters.html
index 1817b5bae..8b778ed05 100644
--- a/docs/build/rnalysis.filtering.Filter.number_filters.html
+++ b/docs/build/rnalysis.filtering.Filter.number_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.number_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.number_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.print_features.html b/docs/build/rnalysis.filtering.Filter.print_features.html
index dc74360b0..7c7f91f0f 100644
--- a/docs/build/rnalysis.filtering.Filter.print_features.html
+++ b/docs/build/rnalysis.filtering.Filter.print_features.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.print_features &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.print_features &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.save_csv.html b/docs/build/rnalysis.filtering.Filter.save_csv.html
index ecbd6a762..2f61aaa90 100644
--- a/docs/build/rnalysis.filtering.Filter.save_csv.html
+++ b/docs/build/rnalysis.filtering.Filter.save_csv.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.save_csv &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.save_csv &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.sort.html b/docs/build/rnalysis.filtering.Filter.sort.html
index ba8cd24da..9d84d4578 100644
--- a/docs/build/rnalysis.filtering.Filter.sort.html
+++ b/docs/build/rnalysis.filtering.Filter.sort.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.sort &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.sort &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.split_by_attribute.html b/docs/build/rnalysis.filtering.Filter.split_by_attribute.html
index 432eca964..6f658b6c6 100644
--- a/docs/build/rnalysis.filtering.Filter.split_by_attribute.html
+++ b/docs/build/rnalysis.filtering.Filter.split_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.split_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.split_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.split_by_percentile.html b/docs/build/rnalysis.filtering.Filter.split_by_percentile.html
index 8ed16af5e..ac873ed67 100644
--- a/docs/build/rnalysis.filtering.Filter.split_by_percentile.html
+++ b/docs/build/rnalysis.filtering.Filter.split_by_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.split_by_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.split_by_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.symmetric_difference.html b/docs/build/rnalysis.filtering.Filter.symmetric_difference.html
index 94b87b132..c870cd60b 100644
--- a/docs/build/rnalysis.filtering.Filter.symmetric_difference.html
+++ b/docs/build/rnalysis.filtering.Filter.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.tail.html b/docs/build/rnalysis.filtering.Filter.tail.html
index 39151d40a..7dc71a636 100644
--- a/docs/build/rnalysis.filtering.Filter.tail.html
+++ b/docs/build/rnalysis.filtering.Filter.tail.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.tail &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.tail &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.text_filters.html b/docs/build/rnalysis.filtering.Filter.text_filters.html
index c82862e67..e1d8781f8 100644
--- a/docs/build/rnalysis.filtering.Filter.text_filters.html
+++ b/docs/build/rnalysis.filtering.Filter.text_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.text_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.text_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.transform.html b/docs/build/rnalysis.filtering.Filter.transform.html
index 17b89a114..b47a51f52 100644
--- a/docs/build/rnalysis.filtering.Filter.transform.html
+++ b/docs/build/rnalysis.filtering.Filter.transform.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.transform &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.transform &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.translate_gene_ids.html b/docs/build/rnalysis.filtering.Filter.translate_gene_ids.html
index eaaba64ef..381994b25 100644
--- a/docs/build/rnalysis.filtering.Filter.translate_gene_ids.html
+++ b/docs/build/rnalysis.filtering.Filter.translate_gene_ids.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.translate_gene_ids &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.translate_gene_ids &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Filter.union.html b/docs/build/rnalysis.filtering.Filter.union.html
index 5b3bca2df..858b60b2a 100644
--- a/docs/build/rnalysis.filtering.Filter.union.html
+++ b/docs/build/rnalysis.filtering.Filter.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Filter.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Filter.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.html b/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.html
index ac0dab5f3..0443dfbb8 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.html b/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.html
index d5bf20524..1b510549b 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.describe.html b/docs/build/rnalysis.filtering.FoldChangeFilter.describe.html
index 39806be9d..ef7d0663d 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.describe.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.describe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.describe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.describe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.difference.html b/docs/build/rnalysis.filtering.FoldChangeFilter.difference.html
index 24a4ff1fe..87e32b451 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.difference.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.html
index 420af9c0c..1305a37df 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.html
index 996f3d9b1..538a84ae3 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.html
index 30d9a525f..dcba56a6d 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_attribute.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_attribute.html
index 1cca48fbf..831921860 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_attribute.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.html
index 4fe3f0994..eb330bbf3 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.html
index 61d8f68cc..ae6f7e05c 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.html
index 7bea8c2dd..a3dc99c77 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_missing_values.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_missing_values.html
index 4e8862d9a..f7f6b1624 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_missing_values.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_missing_values.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_missing_values &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_missing_values &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_percentile.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_percentile.html
index 79c4ac6e5..67a9e0570 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_percentile.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_top_n.html b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_top_n.html
index c27ce405f..d08e52334 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.filter_top_n.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.filter_top_n.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.filter_top_n &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.filter_top_n &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.from_dataframe.html b/docs/build/rnalysis.filtering.FoldChangeFilter.from_dataframe.html
index 567e97692..d0f7e418d 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.from_dataframe.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.from_dataframe.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.from_dataframe &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.from_dataframe &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.head.html b/docs/build/rnalysis.filtering.FoldChangeFilter.head.html
index d5fe0a06c..b4cfdcbca 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.head.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.head.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.head &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.head &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.html b/docs/build/rnalysis.filtering.FoldChangeFilter.html
index 2e6e4c6ac..3da6e8356 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.intersection.html b/docs/build/rnalysis.filtering.FoldChangeFilter.intersection.html
index 9407695ae..c7556c6d7 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.intersection.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.html b/docs/build/rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.html
index 5d0d11658..7abee7a57 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.majority_vote_intersection &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.majority_vote_intersection &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.number_filters.html b/docs/build/rnalysis.filtering.FoldChangeFilter.number_filters.html
index bd207a51c..2027840ce 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.number_filters.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.number_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.number_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.number_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.print_features.html b/docs/build/rnalysis.filtering.FoldChangeFilter.print_features.html
index d9b37b071..b43ac3b59 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.print_features.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.print_features.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.print_features &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.print_features &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.randomization_test.html b/docs/build/rnalysis.filtering.FoldChangeFilter.randomization_test.html
index 273ae64ab..13ba4bbd7 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.randomization_test.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.randomization_test.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.randomization_test &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.randomization_test &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.save_csv.html b/docs/build/rnalysis.filtering.FoldChangeFilter.save_csv.html
index 6afaf82a2..e452c1d39 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.save_csv.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.save_csv.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.save_csv &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.save_csv &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.sort.html b/docs/build/rnalysis.filtering.FoldChangeFilter.sort.html
index 269b46cb4..82162c0ca 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.sort.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.sort.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.sort &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.sort &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_attribute.html b/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_attribute.html
index 20a252ba2..af4ba9097 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_attribute.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_attribute.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.split_by_attribute &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.split_by_attribute &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_percentile.html b/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_percentile.html
index 13f2b0846..ea881b028 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_percentile.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.split_by_percentile.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.split_by_percentile &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.split_by_percentile &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.html b/docs/build/rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.html
index dad58b300..bceac8a7e 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.split_fold_change_direction &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.split_fold_change_direction &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.symmetric_difference.html b/docs/build/rnalysis.filtering.FoldChangeFilter.symmetric_difference.html
index 4752f30b4..ef94ad5bf 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.symmetric_difference.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.symmetric_difference.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.symmetric_difference &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.symmetric_difference &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.tail.html b/docs/build/rnalysis.filtering.FoldChangeFilter.tail.html
index 05f645895..456498a53 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.tail.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.tail.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.tail &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.tail &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.text_filters.html b/docs/build/rnalysis.filtering.FoldChangeFilter.text_filters.html
index 651e28770..37ef21040 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.text_filters.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.text_filters.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.text_filters &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.text_filters &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.transform.html b/docs/build/rnalysis.filtering.FoldChangeFilter.transform.html
index 44f4814f5..2cc4ec1f5 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.transform.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.transform.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.transform &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.transform &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.translate_gene_ids.html b/docs/build/rnalysis.filtering.FoldChangeFilter.translate_gene_ids.html
index 6c2635d1b..21878f9a4 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.translate_gene_ids.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.translate_gene_ids.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.translate_gene_ids &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.translate_gene_ids &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.FoldChangeFilter.union.html b/docs/build/rnalysis.filtering.FoldChangeFilter.union.html
index 6ba30eea0..eeb18a663 100644
--- a/docs/build/rnalysis.filtering.FoldChangeFilter.union.html
+++ b/docs/build/rnalysis.filtering.FoldChangeFilter.union.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.FoldChangeFilter.union &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.FoldChangeFilter.union &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.add_function.html b/docs/build/rnalysis.filtering.Pipeline.add_function.html
index 7161ef459..ef558f911 100644
--- a/docs/build/rnalysis.filtering.Pipeline.add_function.html
+++ b/docs/build/rnalysis.filtering.Pipeline.add_function.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline.add_function &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline.add_function &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.apply_to.html b/docs/build/rnalysis.filtering.Pipeline.apply_to.html
index 4b23e936e..e1bea5033 100644
--- a/docs/build/rnalysis.filtering.Pipeline.apply_to.html
+++ b/docs/build/rnalysis.filtering.Pipeline.apply_to.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline.apply_to &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline.apply_to &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.export_pipeline.html b/docs/build/rnalysis.filtering.Pipeline.export_pipeline.html
index ebe9a4890..090039e15 100644
--- a/docs/build/rnalysis.filtering.Pipeline.export_pipeline.html
+++ b/docs/build/rnalysis.filtering.Pipeline.export_pipeline.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline.export_pipeline &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline.export_pipeline &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.html b/docs/build/rnalysis.filtering.Pipeline.html
index 2ac8c209b..7fdd09153 100644
--- a/docs/build/rnalysis.filtering.Pipeline.html
+++ b/docs/build/rnalysis.filtering.Pipeline.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.import_pipeline.html b/docs/build/rnalysis.filtering.Pipeline.import_pipeline.html
index 0d63d9e0a..3a686c0e1 100644
--- a/docs/build/rnalysis.filtering.Pipeline.import_pipeline.html
+++ b/docs/build/rnalysis.filtering.Pipeline.import_pipeline.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline.import_pipeline &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline.import_pipeline &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.Pipeline.remove_last_function.html b/docs/build/rnalysis.filtering.Pipeline.remove_last_function.html
index 94ea81098..f3b74c538 100644
--- a/docs/build/rnalysis.filtering.Pipeline.remove_last_function.html
+++ b/docs/build/rnalysis.filtering.Pipeline.remove_last_function.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.Pipeline.remove_last_function &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.Pipeline.remove_last_function &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.html b/docs/build/rnalysis.filtering.html
index 9f8308042..7f327e1bd 100644
--- a/docs/build/rnalysis.filtering.html
+++ b/docs/build/rnalysis.filtering.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.filtering.readable_name.html b/docs/build/rnalysis.filtering.readable_name.html
index 7b34e5401..c3f286cc4 100644
--- a/docs/build/rnalysis.filtering.readable_name.html
+++ b/docs/build/rnalysis.filtering.readable_name.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.filtering.readable_name &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.filtering.readable_name &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.html b/docs/build/rnalysis.general.html
index 488e9f48e..da3e7cb8c 100644
--- a/docs/build/rnalysis.general.html
+++ b/docs/build/rnalysis.general.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.parse_gene_name_string.html b/docs/build/rnalysis.general.parse_gene_name_string.html
index 027eed8a4..32eb3be13 100644
--- a/docs/build/rnalysis.general.parse_gene_name_string.html
+++ b/docs/build/rnalysis.general.parse_gene_name_string.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.parse_gene_name_string &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.parse_gene_name_string &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.parse_sequence_name_string.html b/docs/build/rnalysis.general.parse_sequence_name_string.html
index a04dd8a57..aa1fbb9fd 100644
--- a/docs/build/rnalysis.general.parse_sequence_name_string.html
+++ b/docs/build/rnalysis.general.parse_sequence_name_string.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.parse_sequence_name_string &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.parse_sequence_name_string &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.parse_wbgene_string.html b/docs/build/rnalysis.general.parse_wbgene_string.html
index 8ec8dc101..20be9a274 100644
--- a/docs/build/rnalysis.general.parse_wbgene_string.html
+++ b/docs/build/rnalysis.general.parse_wbgene_string.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.parse_wbgene_string &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.parse_wbgene_string &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.print_settings_file.html b/docs/build/rnalysis.general.print_settings_file.html
index f8f4ea982..84916ba4d 100644
--- a/docs/build/rnalysis.general.print_settings_file.html
+++ b/docs/build/rnalysis.general.print_settings_file.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.print_settings_file &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.print_settings_file &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.reset_settings_file.html b/docs/build/rnalysis.general.reset_settings_file.html
index 3ea6545d3..6a938f03c 100644
--- a/docs/build/rnalysis.general.reset_settings_file.html
+++ b/docs/build/rnalysis.general.reset_settings_file.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.reset_settings_file &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.reset_settings_file &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.save_to_csv.html b/docs/build/rnalysis.general.save_to_csv.html
index a636967d4..80994d9ad 100644
--- a/docs/build/rnalysis.general.save_to_csv.html
+++ b/docs/build/rnalysis.general.save_to_csv.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.save_to_csv &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.save_to_csv &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.set_attr_ref_table_path.html b/docs/build/rnalysis.general.set_attr_ref_table_path.html
index c4d827988..53597c17c 100644
--- a/docs/build/rnalysis.general.set_attr_ref_table_path.html
+++ b/docs/build/rnalysis.general.set_attr_ref_table_path.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.set_attr_ref_table_path &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.set_attr_ref_table_path &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.general.set_biotype_ref_table_path.html b/docs/build/rnalysis.general.set_biotype_ref_table_path.html
index 7a3a6e575..f9b71216d 100644
--- a/docs/build/rnalysis.general.set_biotype_ref_table_path.html
+++ b/docs/build/rnalysis.general.set_biotype_ref_table_path.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis.general.set_biotype_ref_table_path &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis.general.set_biotype_ref_table_path &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/rnalysis.html b/docs/build/rnalysis.html
index cb4124f98..58c0ee89d 100644
--- a/docs/build/rnalysis.html
+++ b/docs/build/rnalysis.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>rnalysis package &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>rnalysis package &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/search.html b/docs/build/search.html
index 5dca668b1..13614ab33 100644
--- a/docs/build/search.html
+++ b/docs/build/search.html
@@ -3,7 +3,7 @@
 <head>
   <meta charset="utf-8" />
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>Search &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>Search &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/searchindex.js b/docs/build/searchindex.js
index 1f6241994..f5cf8d541 100644
--- a/docs/build/searchindex.js
+++ b/docs/build/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"docnames": ["api_reference", "contributing", "genindex", "glossary", "history", "index", "installation", "readme", "rnalysis", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.biotypes", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric", "rnalysis.enrichment.FeatureSet.enrich_randomization", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.biotypes", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.enrich_hypergeometric", "rnalysis.enrichment.RankedSet.enrich_randomization", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.plot_enrichment_results", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.filtering.readable_name", "rnalysis.general", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "tutorial", "user_guide"], "filenames": ["api_reference.rst", "contributing.rst", "genindex.rst", "glossary.rst", "history.rst", "index.rst", "installation.rst", "readme.rst", "rnalysis.rst", "rnalysis.enrichment.rst", "rnalysis.enrichment.FeatureSet.rst", "rnalysis.enrichment.FeatureSet.biotypes.rst", "rnalysis.enrichment.FeatureSet.change_set_name.rst", "rnalysis.enrichment.FeatureSet.difference.rst", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric.rst", "rnalysis.enrichment.FeatureSet.enrich_randomization.rst", "rnalysis.enrichment.FeatureSet.go_enrichment.rst", "rnalysis.enrichment.FeatureSet.intersection.rst", "rnalysis.enrichment.FeatureSet.kegg_enrichment.rst", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment.rst", "rnalysis.enrichment.FeatureSet.save_txt.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference.rst", "rnalysis.enrichment.FeatureSet.union.rst", "rnalysis.enrichment.FeatureSet.user_defined_enrichment.rst", "rnalysis.enrichment.RankedSet.rst", "rnalysis.enrichment.RankedSet.biotypes.rst", "rnalysis.enrichment.RankedSet.change_set_name.rst", "rnalysis.enrichment.RankedSet.difference.rst", "rnalysis.enrichment.RankedSet.enrich_hypergeometric.rst", "rnalysis.enrichment.RankedSet.enrich_randomization.rst", "rnalysis.enrichment.RankedSet.go_enrichment.rst", "rnalysis.enrichment.RankedSet.intersection.rst", "rnalysis.enrichment.RankedSet.kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.non_categorical_enrichment.rst", "rnalysis.enrichment.RankedSet.save_txt.rst", "rnalysis.enrichment.RankedSet.single_set_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_go_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.symmetric_difference.rst", "rnalysis.enrichment.RankedSet.union.rst", "rnalysis.enrichment.RankedSet.user_defined_enrichment.rst", "rnalysis.enrichment.plot_enrichment_results.rst", "rnalysis.enrichment.upset_plot.rst", "rnalysis.enrichment.venn_diagram.rst", "rnalysis.filtering.rst", "rnalysis.filtering.CountFilter.rst", "rnalysis.filtering.CountFilter.average_replicate_samples.rst", "rnalysis.filtering.CountFilter.biotypes_from_gtf.rst", "rnalysis.filtering.CountFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.CountFilter.box_plot.rst", "rnalysis.filtering.CountFilter.clustergram.rst", "rnalysis.filtering.CountFilter.describe.rst", "rnalysis.filtering.CountFilter.difference.rst", "rnalysis.filtering.CountFilter.differential_expression_deseq2.rst", "rnalysis.filtering.CountFilter.enhanced_box_plot.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.CountFilter.filter_by_attribute.rst", "rnalysis.filtering.CountFilter.filter_by_go_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_row_sum.rst", "rnalysis.filtering.CountFilter.filter_low_reads.rst", "rnalysis.filtering.CountFilter.filter_missing_values.rst", "rnalysis.filtering.CountFilter.filter_percentile.rst", "rnalysis.filtering.CountFilter.filter_top_n.rst", "rnalysis.filtering.CountFilter.fold_change.rst", "rnalysis.filtering.CountFilter.from_dataframe.rst", "rnalysis.filtering.CountFilter.from_folder.rst", "rnalysis.filtering.CountFilter.head.rst", "rnalysis.filtering.CountFilter.intersection.rst", "rnalysis.filtering.CountFilter.ma_plot.rst", "rnalysis.filtering.CountFilter.majority_vote_intersection.rst", "rnalysis.filtering.CountFilter.normalize_median_of_ratios.rst", "rnalysis.filtering.CountFilter.normalize_rle.rst", "rnalysis.filtering.CountFilter.normalize_tmm.rst", "rnalysis.filtering.CountFilter.normalize_to_quantile.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.rst", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors.rst", "rnalysis.filtering.CountFilter.number_filters.rst", "rnalysis.filtering.CountFilter.pairplot.rst", "rnalysis.filtering.CountFilter.pca.rst", "rnalysis.filtering.CountFilter.plot_expression.rst", "rnalysis.filtering.CountFilter.print_features.rst", "rnalysis.filtering.CountFilter.save_csv.rst", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample.rst", "rnalysis.filtering.CountFilter.sort.rst", "rnalysis.filtering.CountFilter.split_by_attribute.rst", "rnalysis.filtering.CountFilter.split_by_percentile.rst", "rnalysis.filtering.CountFilter.split_by_reads.rst", "rnalysis.filtering.CountFilter.split_clicom.rst", "rnalysis.filtering.CountFilter.split_hdbscan.rst", "rnalysis.filtering.CountFilter.split_hierarchical.rst", "rnalysis.filtering.CountFilter.split_kmeans.rst", "rnalysis.filtering.CountFilter.split_kmedoids.rst", "rnalysis.filtering.CountFilter.symmetric_difference.rst", "rnalysis.filtering.CountFilter.tail.rst", "rnalysis.filtering.CountFilter.text_filters.rst", "rnalysis.filtering.CountFilter.transform.rst", "rnalysis.filtering.CountFilter.translate_gene_ids.rst", "rnalysis.filtering.CountFilter.union.rst", "rnalysis.filtering.CountFilter.violin_plot.rst", "rnalysis.filtering.DESeqFilter.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.describe.rst", "rnalysis.filtering.DESeqFilter.difference.rst", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.filter_by_attribute.rst", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.filter_missing_values.rst", "rnalysis.filtering.DESeqFilter.filter_percentile.rst", "rnalysis.filtering.DESeqFilter.filter_significant.rst", "rnalysis.filtering.DESeqFilter.filter_top_n.rst", "rnalysis.filtering.DESeqFilter.from_dataframe.rst", "rnalysis.filtering.DESeqFilter.head.rst", "rnalysis.filtering.DESeqFilter.intersection.rst", "rnalysis.filtering.DESeqFilter.majority_vote_intersection.rst", "rnalysis.filtering.DESeqFilter.number_filters.rst", "rnalysis.filtering.DESeqFilter.print_features.rst", "rnalysis.filtering.DESeqFilter.save_csv.rst", "rnalysis.filtering.DESeqFilter.sort.rst", "rnalysis.filtering.DESeqFilter.split_by_attribute.rst", "rnalysis.filtering.DESeqFilter.split_by_percentile.rst", "rnalysis.filtering.DESeqFilter.split_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.symmetric_difference.rst", "rnalysis.filtering.DESeqFilter.tail.rst", "rnalysis.filtering.DESeqFilter.text_filters.rst", "rnalysis.filtering.DESeqFilter.transform.rst", "rnalysis.filtering.DESeqFilter.translate_gene_ids.rst", "rnalysis.filtering.DESeqFilter.union.rst", "rnalysis.filtering.DESeqFilter.volcano_plot.rst", "rnalysis.filtering.Filter.rst", "rnalysis.filtering.Filter.biotypes_from_gtf.rst", "rnalysis.filtering.Filter.biotypes_from_ref_table.rst", "rnalysis.filtering.Filter.describe.rst", "rnalysis.filtering.Filter.difference.rst", "rnalysis.filtering.Filter.filter_biotype_from_gtf.rst", "rnalysis.filtering.Filter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.Filter.filter_by_attribute.rst", "rnalysis.filtering.Filter.filter_by_go_annotations.rst", "rnalysis.filtering.Filter.filter_by_kegg_annotations.rst", "rnalysis.filtering.Filter.filter_missing_values.rst", "rnalysis.filtering.Filter.filter_percentile.rst", "rnalysis.filtering.Filter.filter_top_n.rst", "rnalysis.filtering.Filter.from_dataframe.rst", "rnalysis.filtering.Filter.head.rst", "rnalysis.filtering.Filter.intersection.rst", "rnalysis.filtering.Filter.majority_vote_intersection.rst", "rnalysis.filtering.Filter.number_filters.rst", "rnalysis.filtering.Filter.print_features.rst", "rnalysis.filtering.Filter.save_csv.rst", "rnalysis.filtering.Filter.sort.rst", "rnalysis.filtering.Filter.split_by_attribute.rst", "rnalysis.filtering.Filter.split_by_percentile.rst", "rnalysis.filtering.Filter.symmetric_difference.rst", "rnalysis.filtering.Filter.tail.rst", "rnalysis.filtering.Filter.text_filters.rst", "rnalysis.filtering.Filter.transform.rst", "rnalysis.filtering.Filter.translate_gene_ids.rst", "rnalysis.filtering.Filter.union.rst", "rnalysis.filtering.FoldChangeFilter.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.describe.rst", "rnalysis.filtering.FoldChangeFilter.difference.rst", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.filter_missing_values.rst", "rnalysis.filtering.FoldChangeFilter.filter_percentile.rst", "rnalysis.filtering.FoldChangeFilter.filter_top_n.rst", "rnalysis.filtering.FoldChangeFilter.from_dataframe.rst", "rnalysis.filtering.FoldChangeFilter.head.rst", "rnalysis.filtering.FoldChangeFilter.intersection.rst", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.rst", "rnalysis.filtering.FoldChangeFilter.number_filters.rst", "rnalysis.filtering.FoldChangeFilter.print_features.rst", "rnalysis.filtering.FoldChangeFilter.randomization_test.rst", "rnalysis.filtering.FoldChangeFilter.save_csv.rst", "rnalysis.filtering.FoldChangeFilter.sort.rst", "rnalysis.filtering.FoldChangeFilter.split_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.split_by_percentile.rst", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.symmetric_difference.rst", "rnalysis.filtering.FoldChangeFilter.tail.rst", "rnalysis.filtering.FoldChangeFilter.text_filters.rst", "rnalysis.filtering.FoldChangeFilter.transform.rst", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids.rst", "rnalysis.filtering.FoldChangeFilter.union.rst", "rnalysis.filtering.Pipeline.rst", "rnalysis.filtering.Pipeline.add_function.rst", "rnalysis.filtering.Pipeline.apply_to.rst", "rnalysis.filtering.Pipeline.export_pipeline.rst", "rnalysis.filtering.Pipeline.import_pipeline.rst", "rnalysis.filtering.Pipeline.remove_last_function.rst", "rnalysis.filtering.readable_name.rst", "rnalysis.general.rst", "rnalysis.general.parse_gene_name_string.rst", "rnalysis.general.parse_sequence_name_string.rst", "rnalysis.general.parse_wbgene_string.rst", "rnalysis.general.print_settings_file.rst", "rnalysis.general.reset_settings_file.rst", "rnalysis.general.save_to_csv.rst", "rnalysis.general.set_attr_ref_table_path.rst", "rnalysis.general.set_biotype_ref_table_path.rst", "tutorial.rst", "user_guide.rst"], "titles": ["API Reference", "Contributing", "Index", "Glossary", "History", "RNAlysis 3.2.1 documentation", "Installation", "What is <em>RNAlysis?</em>", "rnalysis package", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.biotypes", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric", "rnalysis.enrichment.FeatureSet.enrich_randomization", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.biotypes", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.enrich_hypergeometric", "rnalysis.enrichment.RankedSet.enrich_randomization", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.plot_enrichment_results", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.filtering.readable_name", "rnalysis.general", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "A-to-Z tutorial - example analysis", "User guide"], "terms": {"privat": 0, "function": [0, 1, 3, 4, 7, 8, 9, 14, 15, 16, 18, 24, 28, 29, 30, 32, 36, 37, 41, 44, 45, 46, 49, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 81, 97, 98, 101, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 131, 132, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 161, 162, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 194, 195, 198, 199, 200, 203, 205, 214, 215], "ar": [0, 1, 4, 8, 13, 14, 15, 16, 18, 19, 23, 27, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 45, 57, 59, 61, 62, 65, 72, 74, 87, 90, 91, 102, 110, 112, 114, 126, 135, 136, 143, 145, 146, 157, 165, 173, 175, 177, 189, 215], "meant": [0, 45], "us": [0, 1, 3, 4, 5, 6, 8, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 44, 45, 46, 47, 48, 49, 50, 53, 54, 55, 56, 57, 65, 70, 72, 73, 74, 75, 77, 78, 84, 85, 87, 90, 91, 92, 93, 94, 101, 102, 103, 104, 108, 109, 110, 124, 126, 135, 136, 137, 138, 141, 142, 143, 155, 157, 165, 166, 167, 171, 172, 173, 186, 187, 189, 199, 209, 214], "out": [0, 4, 6, 7, 8, 42, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 74, 79, 88, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 127, 131, 141, 142, 143, 145, 146, 147, 148, 153, 158, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 190, 194, 215], "context": 0, "do": [0, 4, 5, 8, 16, 18, 30, 32, 36, 37, 55, 56, 59, 108, 109, 112, 141, 142, 145, 171, 172, 175, 199, 214, 215], "so": [0, 8, 72, 74, 214, 215], "mai": [0, 8, 43, 214, 215], "lead": [0, 4, 5, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 90, 91, 165, 214, 215], "unexpect": 0, "result": [0, 4, 8, 9, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 53, 62, 87, 88, 89, 90, 91, 92, 93, 94, 98, 114, 126, 127, 128, 132, 146, 157, 158, 162, 177, 186, 189, 190, 191, 195, 200, 205, 214], "thi": [0, 1, 3, 4, 6, 7, 8, 9, 13, 14, 15, 16, 17, 18, 21, 22, 23, 27, 28, 29, 30, 31, 32, 38, 39, 40, 42, 44, 45, 49, 53, 54, 64, 67, 72, 73, 74, 75, 86, 90, 92, 101, 117, 125, 148, 156, 165, 179, 188, 205, 210, 214, 215], "can": [0, 1, 3, 4, 5, 6, 8, 9, 15, 16, 20, 24, 29, 30, 34, 44, 45, 49, 52, 54, 57, 59, 67, 69, 80, 81, 82, 90, 101, 102, 106, 110, 112, 120, 140, 143, 145, 151, 169, 173, 175, 182, 198, 199, 206, 207, 208, 214, 215], "normal": [0, 3, 4, 7, 8, 44, 45, 49, 54, 67, 72, 73, 74, 75, 76, 77, 78, 90, 101, 199, 214], "intersect": [0, 4, 8, 9, 42, 44, 52, 57, 58, 59, 71, 106, 110, 111, 112, 121, 140, 143, 144, 145, 152, 169, 173, 174, 175, 183, 214], "visual": [0, 3, 4, 6, 7, 8, 9, 44, 81, 90, 91, 92, 93, 94], "tabular": [0, 3, 7, 8, 44, 214, 215], "data": [0, 3, 4, 5, 7, 8, 44, 47, 48, 55, 56, 67, 80, 82, 84, 90, 91, 92, 93, 94, 98, 103, 104, 108, 109, 124, 132, 135, 137, 138, 141, 142, 155, 162, 166, 167, 171, 172, 187, 195], "read": [0, 4, 7, 8, 16, 30, 36, 44, 49, 54, 57, 61, 67, 72, 74, 75, 76, 77, 78, 82, 85, 89, 90, 101, 110, 143, 173, 205], "count": [0, 3, 4, 7, 8, 10, 11, 24, 25, 44, 45, 46, 47, 48, 51, 52, 53, 56, 57, 60, 61, 64, 67, 71, 72, 73, 74, 75, 76, 77, 78, 82, 83, 85, 86, 87, 89, 95, 98, 100, 103, 104, 105, 106, 109, 110, 117, 121, 123, 125, 126, 129, 132, 134, 136, 137, 138, 139, 140, 142, 143, 148, 152, 154, 156, 157, 159, 162, 164, 166, 167, 168, 169, 172, 173, 179, 183, 185, 188, 189, 192, 195, 197, 214], "differenti": [0, 3, 4, 5, 7, 8, 44, 53, 74, 102, 215], "express": [0, 3, 4, 5, 7, 8, 24, 44, 46, 53, 61, 72, 73, 74, 75, 82, 89, 90, 91, 92, 93, 94, 102, 206, 207], "ani": [0, 1, 3, 4, 8, 16, 24, 30, 36, 44, 50, 58, 90, 98, 111, 132, 144, 162, 174, 195, 200, 206, 207, 208, 214, 215], "save": [0, 4, 8, 9, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 44, 45, 62, 67, 84, 87, 88, 89, 90, 91, 92, 93, 94, 98, 102, 114, 124, 126, 127, 128, 132, 136, 146, 155, 157, 158, 162, 165, 177, 186, 187, 189, 190, 191, 195, 200, 201, 205, 211, 214], "csv": [0, 3, 4, 8, 9, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 44, 45, 48, 51, 52, 53, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 84, 86, 87, 88, 89, 95, 96, 97, 98, 100, 102, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 164, 165, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 211, 214], "format": [0, 3, 4, 8, 16, 30, 36, 43, 44, 47, 48, 55, 67, 103, 104, 108, 137, 138, 141, 166, 167, 171, 206, 207, 208, 214, 215], "import": [0, 4, 7, 8, 10, 11, 13, 17, 21, 22, 24, 25, 27, 31, 38, 39, 44, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 165, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 202, 203, 206, 207, 208, 209, 212, 213], "perform": [0, 3, 4, 7, 8, 9, 16, 19, 30, 33, 36, 44, 50, 63, 81, 86, 88, 115, 125, 127, 147, 156, 158, 178, 186, 188, 190, 214], "variou": [0, 3, 4, 8, 10, 24, 44, 45, 102, 214, 215], "oper": [0, 1, 4, 8, 44, 45, 79, 86, 97, 102, 122, 125, 131, 136, 153, 156, 161, 165, 184, 188, 194, 200, 214], "your": [0, 1, 3, 4, 6, 7, 8, 16, 18, 30, 32, 36, 37, 42, 43, 44, 47, 55, 59, 90, 103, 108, 112, 137, 141, 145, 166, 171, 175, 214], "set": [0, 1, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 50, 52, 56, 69, 71, 74, 92, 95, 100, 102, 106, 109, 120, 121, 129, 134, 136, 140, 142, 151, 152, 159, 164, 165, 169, 172, 182, 183, 186, 192, 197, 205, 206, 207, 208, 209, 210, 212, 213], "union": [0, 4, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 62, 64, 65, 66, 69, 70, 71, 74, 77, 78, 80, 81, 82, 84, 85, 86, 87, 90, 91, 92, 93, 94, 95, 98, 99, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111, 112, 114, 117, 118, 120, 121, 124, 125, 126, 129, 132, 133, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 148, 149, 151, 152, 155, 156, 157, 159, 162, 163, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 177, 179, 180, 182, 183, 187, 188, 189, 192, 195, 196, 198, 199, 200, 201, 202, 211, 214, 215], "etc": [0, 3, 4, 8, 9, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 40, 44, 53, 55, 56, 61, 67, 77, 85, 89, 108, 109, 141, 142, 171, 172, 205, 214, 215], "run": [0, 1, 3, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 44, 53, 90, 93, 94, 186, 215], "basic": [0, 3, 4, 6, 7, 8, 44, 214, 215], "exploratori": [0, 7, 8, 44], "analys": [0, 3, 7, 8, 9, 10, 24, 44, 165, 214, 215], "plot": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 44, 49, 50, 54, 70, 80, 81, 82, 85, 90, 91, 92, 93, 94, 101, 135, 199, 214], "pca": [0, 4, 8, 44, 214, 215], "clustergram": [0, 4, 8, 44, 215], "violin": [0, 8, 44, 101], "scatter": [0, 8, 44, 49, 54, 85, 214], "comput": [0, 4, 6, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 44, 58, 111, 144, 174, 214, 215], "more": [0, 1, 3, 4, 7, 8, 14, 16, 28, 30, 36, 42, 44, 51, 57, 59, 80, 90, 91, 105, 110, 112, 139, 143, 145, 168, 173, 175, 214], "when": [0, 1, 4, 8, 15, 29, 44, 45, 57, 59, 102, 110, 112, 136, 143, 145, 165, 173, 175, 199, 214, 215], "you": [0, 1, 3, 4, 6, 7, 8, 15, 16, 29, 30, 44, 47, 55, 72, 73, 74, 75, 90, 103, 108, 137, 141, 166, 171, 212, 213, 214], "modifi": [0, 4, 8, 44, 45, 86, 90, 102, 125, 136, 156, 165, 188, 214, 215], "its": [0, 3, 8, 44, 70, 82, 87, 90, 91, 92, 93, 94, 126, 157, 189, 214, 215], "new": [0, 1, 4, 8, 12, 13, 17, 21, 22, 26, 27, 31, 38, 39, 44, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 72, 73, 74, 75, 76, 77, 78, 79, 87, 88, 89, 90, 91, 92, 93, 94, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 126, 127, 128, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 157, 158, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 189, 190, 191, 194, 195, 200, 214], "file": [0, 1, 3, 4, 7, 8, 9, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 44, 45, 47, 53, 55, 56, 67, 77, 78, 84, 102, 103, 108, 109, 124, 136, 137, 141, 142, 155, 165, 166, 171, 172, 186, 187, 201, 202, 205, 209, 210, 211, 212, 213], "name": [0, 1, 3, 4, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 53, 54, 55, 56, 58, 59, 62, 63, 64, 65, 66, 67, 70, 72, 74, 78, 79, 80, 81, 82, 84, 85, 86, 87, 88, 97, 98, 99, 101, 102, 103, 104, 108, 109, 111, 112, 114, 115, 117, 118, 122, 124, 125, 126, 127, 131, 132, 133, 136, 137, 138, 141, 142, 144, 145, 146, 147, 148, 149, 153, 155, 156, 157, 158, 161, 162, 163, 165, 166, 167, 170, 171, 172, 174, 175, 176, 177, 178, 179, 180, 184, 186, 187, 188, 189, 190, 191, 194, 195, 196, 199, 202, 204, 206, 207, 211, 214], "includ": [0, 1, 4, 6, 7, 8, 9, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 40, 42, 43, 44, 48, 51, 67, 74, 80, 89, 104, 105, 138, 139, 167, 168, 199, 205, 214, 215], "default": [0, 3, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 124, 125, 129, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 155, 156, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 186, 187, 188, 192, 193, 194, 195, 197, 198, 200, 214], "all": [0, 1, 4, 6, 7, 8, 14, 15, 16, 17, 18, 19, 22, 23, 24, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 42, 44, 45, 46, 49, 50, 51, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 67, 69, 70, 72, 74, 75, 80, 81, 82, 88, 89, 90, 91, 92, 93, 94, 98, 101, 102, 105, 107, 108, 109, 110, 112, 114, 115, 116, 120, 127, 132, 136, 139, 141, 142, 143, 145, 146, 147, 151, 158, 162, 165, 168, 170, 171, 172, 173, 175, 177, 178, 182, 190, 195, 199, 200, 214, 215], "order": [0, 3, 4, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 44, 45, 60, 61, 64, 83, 86, 87, 89, 117, 123, 125, 126, 148, 154, 156, 157, 179, 185, 188, 189, 199, 214, 215], "thei": [0, 1, 8, 44, 49, 54, 65, 71, 72, 74, 80, 81, 82, 85, 90, 101, 113, 121, 152, 176, 183, 200, 214, 215], "were": [0, 4, 8, 14, 28, 44, 45, 63, 87, 90, 91, 102, 115, 126, 136, 147, 157, 165, 178, 189, 214, 215], "allow": [0, 7, 8, 44, 90, 214, 215], "easi": [0, 8, 44, 214, 215], "traceback": [0, 8, 44], "class": [0, 4, 8, 9, 10, 24, 44, 45, 102, 136, 165, 198, 215], "countfilt": [0, 3, 4, 8, 10, 24, 106, 129, 140, 159, 169, 192, 198, 200], "fname": [0, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 102, 136, 165, 186, 215], "str": [0, 4, 8, 10, 11, 12, 14, 15, 16, 18, 19, 20, 23, 24, 25, 26, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 74, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 88, 90, 91, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 106, 108, 109, 110, 111, 112, 114, 115, 117, 118, 120, 121, 122, 124, 125, 126, 127, 129, 131, 132, 133, 134, 135, 136, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 163, 164, 165, 166, 167, 169, 171, 172, 173, 174, 175, 177, 178, 179, 180, 182, 183, 184, 186, 187, 188, 189, 190, 192, 194, 195, 196, 197, 198, 199, 201, 202, 204, 206, 207, 208, 211, 212, 213], "path": [0, 8, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 42, 43, 45, 47, 48, 53, 55, 56, 57, 59, 66, 67, 77, 78, 84, 87, 102, 103, 104, 108, 109, 110, 112, 118, 124, 126, 136, 137, 138, 141, 142, 143, 145, 149, 155, 157, 165, 166, 167, 171, 172, 173, 175, 180, 186, 187, 189, 201, 202, 211, 212, 213, 214], "tupl": [0, 8, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 45, 53, 81, 87, 88, 89, 90, 91, 92, 93, 94, 102, 126, 127, 128, 136, 157, 158, 165, 189, 190, 191, 200, 215], "drop_column": [0, 8, 45, 102, 136], "option": [0, 3, 4, 8, 10, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 41, 42, 43, 45, 57, 67, 74, 85, 91, 92, 93, 94, 102, 110, 135, 136, 143, 173, 186, 200, 201, 212, 213, 214], "list": [0, 1, 3, 4, 7, 8, 10, 14, 15, 16, 18, 19, 20, 23, 24, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 43, 45, 46, 49, 50, 51, 54, 55, 56, 57, 58, 59, 62, 64, 65, 70, 72, 80, 81, 82, 85, 86, 87, 90, 91, 92, 93, 94, 98, 101, 102, 105, 108, 109, 110, 111, 112, 114, 117, 125, 126, 132, 136, 139, 141, 142, 143, 144, 145, 146, 148, 156, 157, 162, 165, 168, 171, 172, 173, 174, 175, 177, 179, 188, 189, 195, 198, 214], "none": [0, 8, 10, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 57, 67, 74, 84, 85, 86, 91, 92, 93, 94, 102, 110, 124, 125, 135, 136, 143, 155, 156, 173, 186, 187, 188, 200, 201, 212, 213, 214], "is_norm": [0, 8, 45, 66], "bool": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 86, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120, 122, 125, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 153, 156, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 184, 186, 188, 194, 195, 196, 200], "fals": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 45, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 66, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 83, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120, 121, 122, 123, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 152, 153, 154, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 194, 195, 196, 199, 200, 214, 215], "base": [0, 3, 4, 7, 8, 16, 18, 30, 32, 36, 37, 50, 53, 58, 59, 89, 90, 91, 92, 93, 94, 98, 99, 111, 112, 128, 132, 133, 144, 145, 162, 163, 174, 175, 191, 195, 196, 215], "A": [0, 1, 3, 5, 8, 21, 38, 45, 49, 50, 54, 65, 70, 74, 80, 81, 82, 87, 89, 101, 102, 126, 136, 157, 165, 186, 189, 198, 206, 207, 215], "receiv": [0, 8, 10, 24, 41, 45, 78, 102, 206, 207, 208, 215], "matrix": [0, 4, 8, 42, 45, 46, 53, 72, 73, 74, 75, 76, 77, 90, 214], "accord": [0, 4, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 45, 57, 59, 63, 67, 84, 88, 102, 110, 112, 113, 115, 116, 124, 127, 143, 145, 147, 155, 158, 173, 175, 176, 178, 187, 190, 215], "characterist": [0, 8, 45, 102, 214], "attribut": [0, 3, 4, 7, 8, 9, 14, 15, 19, 23, 28, 29, 33, 35, 36, 40, 41, 42, 43, 45, 47, 55, 57, 59, 87, 102, 103, 108, 110, 112, 126, 136, 137, 141, 143, 145, 157, 165, 166, 171, 173, 175, 189, 198, 209, 212], "df": [0, 8, 45, 66, 102, 118, 136, 149, 165, 180, 211], "panda": [0, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41, 45, 47, 48, 51, 68, 96, 102, 103, 104, 105, 119, 130, 136, 137, 138, 139, 150, 160, 165, 166, 167, 168, 181, 186, 193, 211, 215], "datafram": [0, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 45, 47, 48, 51, 63, 66, 67, 68, 80, 88, 96, 102, 103, 104, 105, 115, 118, 119, 127, 130, 136, 137, 138, 139, 147, 149, 150, 158, 160, 165, 166, 167, 168, 178, 180, 181, 186, 190, 193, 211, 215], "contain": [0, 3, 4, 8, 41, 45, 47, 52, 53, 55, 67, 69, 77, 78, 87, 88, 89, 90, 91, 97, 102, 103, 106, 108, 120, 126, 127, 128, 131, 136, 137, 140, 141, 151, 157, 158, 161, 165, 166, 169, 171, 182, 186, 189, 190, 191, 194, 202, 205, 206, 207, 208, 214, 215], "content": [0, 8, 45, 102, 136, 165, 214, 215], "The": [0, 1, 3, 4, 6, 7, 8, 13, 14, 15, 16, 17, 18, 19, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 39, 40, 45, 47, 48, 49, 50, 51, 53, 54, 55, 56, 60, 61, 63, 67, 70, 71, 80, 81, 82, 88, 89, 90, 91, 92, 93, 94, 98, 101, 102, 103, 104, 105, 107, 108, 109, 115, 121, 127, 128, 132, 135, 136, 137, 138, 139, 141, 142, 147, 152, 158, 162, 165, 166, 167, 168, 170, 171, 172, 178, 183, 186, 190, 191, 195, 198, 206, 207, 208, 215], "i": [0, 1, 3, 4, 5, 8, 11, 14, 15, 16, 18, 19, 21, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 38, 40, 41, 42, 43, 45, 47, 48, 49, 51, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 81, 85, 86, 90, 91, 92, 93, 94, 97, 98, 101, 102, 103, 104, 105, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 121, 122, 125, 131, 132, 135, 136, 137, 138, 139, 141, 142, 143, 145, 146, 147, 148, 152, 153, 156, 161, 162, 165, 166, 167, 168, 170, 171, 172, 173, 175, 176, 177, 178, 179, 183, 184, 186, 188, 194, 195, 201, 203, 206, 207, 208, 210, 214], "upon": [0, 8, 45, 102, 136, 165], "usag": [0, 4, 8, 45, 102, 136, 165, 214, 215], "shape": [0, 8, 45, 51, 102, 105, 136, 139, 165, 168, 215], "row": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 45, 47, 48, 55, 56, 57, 60, 61, 62, 63, 64, 68, 79, 86, 96, 97, 102, 103, 104, 107, 108, 109, 110, 113, 114, 115, 116, 117, 119, 122, 125, 130, 131, 136, 137, 138, 141, 142, 143, 146, 147, 148, 150, 153, 156, 160, 161, 165, 166, 167, 170, 171, 172, 173, 176, 177, 178, 179, 181, 184, 186, 188, 193, 194, 214, 215], "column": [0, 3, 4, 8, 41, 42, 43, 45, 46, 47, 48, 51, 53, 57, 61, 62, 63, 64, 65, 68, 70, 72, 74, 76, 77, 78, 79, 86, 88, 96, 97, 98, 102, 103, 104, 105, 110, 114, 115, 117, 119, 122, 125, 127, 130, 131, 132, 136, 137, 138, 139, 143, 146, 147, 148, 150, 153, 156, 158, 160, 161, 162, 165, 166, 167, 168, 173, 177, 178, 179, 181, 184, 186, 188, 190, 193, 194, 195, 214, 215], "dimens": [0, 8, 45, 102, 136, 165, 214, 215], "pathlib": [0, 8, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 42, 43, 45, 57, 67, 78, 84, 102, 110, 124, 136, 143, 155, 165, 173, 186, 187, 201, 202], "filenam": [0, 3, 4, 8, 20, 34, 45, 57, 87, 102, 110, 126, 136, 143, 157, 165, 173, 189, 201, 202, 211, 215], "purpos": [0, 8, 45, 102, 136, 165, 205, 214], "updat": [0, 1, 4, 8, 45, 102, 136, 165, 205, 212, 213, 214], "automat": [0, 4, 7, 8, 45, 46, 49, 50, 54, 65, 67, 70, 74, 80, 81, 84, 85, 90, 91, 92, 93, 94, 101, 102, 124, 135, 136, 155, 165, 187, 214, 215], "appli": [0, 3, 4, 8, 24, 45, 46, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 90, 91, 92, 93, 94, 97, 98, 102, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 131, 132, 136, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 161, 162, 165, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 194, 195, 198, 199, 200], "index_set": [0, 8, 45, 102, 136, 165, 215], "indic": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 49, 52, 54, 55, 56, 57, 59, 69, 71, 74, 83, 95, 100, 101, 102, 106, 107, 108, 109, 110, 112, 120, 121, 123, 129, 134, 136, 140, 141, 142, 143, 145, 151, 152, 154, 159, 164, 165, 169, 170, 171, 172, 173, 175, 182, 183, 185, 186, 192, 197, 205, 206, 207, 208, 214], "current": [0, 4, 6, 8, 13, 17, 21, 22, 27, 31, 38, 39, 45, 46, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 83, 84, 97, 98, 102, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 123, 124, 131, 132, 136, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 154, 155, 161, 162, 165, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 185, 187, 194, 195, 209, 215], "which": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 46, 47, 48, 51, 55, 56, 57, 59, 61, 63, 64, 67, 74, 75, 77, 78, 88, 89, 90, 91, 92, 98, 102, 103, 104, 105, 108, 109, 110, 112, 113, 115, 116, 117, 127, 132, 136, 137, 138, 139, 141, 142, 143, 145, 147, 148, 158, 162, 165, 166, 167, 168, 171, 172, 173, 175, 176, 178, 179, 186, 190, 195, 198, 214], "remov": [0, 7, 8, 45, 60, 61, 62, 63, 102, 114, 115, 116, 136, 146, 147, 165, 177, 178, 203, 215], "previous": [0, 8, 45, 102, 136, 165, 214, 215], "method": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 45, 50, 72, 73, 74, 75, 84, 90, 91, 92, 93, 94, 102, 124, 136, 155, 165, 187, 214], "index_str": [0, 4, 8, 45, 102, 136, 165, 215], "string": [0, 4, 8, 10, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 40, 45, 52, 55, 56, 57, 64, 69, 71, 82, 84, 85, 87, 90, 95, 100, 102, 106, 108, 109, 110, 117, 120, 121, 124, 126, 129, 134, 136, 140, 141, 142, 143, 148, 151, 152, 155, 157, 159, 164, 165, 169, 171, 172, 173, 179, 182, 183, 187, 189, 192, 197, 201, 202, 206, 207, 208, 215], "featur": [0, 3, 4, 6, 7, 8, 9, 10, 14, 15, 16, 18, 19, 20, 23, 24, 28, 29, 30, 32, 33, 34, 36, 37, 40, 42, 43, 45, 47, 48, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 82, 83, 85, 87, 88, 89, 90, 91, 92, 93, 94, 95, 97, 98, 100, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 121, 122, 123, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 140, 141, 142, 143, 145, 146, 147, 148, 151, 152, 153, 154, 157, 158, 159, 161, 162, 164, 165, 166, 167, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 183, 184, 185, 186, 189, 190, 191, 192, 194, 195, 197, 200, 205, 214], "separ": [0, 4, 7, 8, 45, 46, 67, 83, 90, 102, 123, 136, 154, 165, 185, 214, 215], "newlin": [0, 8, 45, 83, 102, 123, 136, 154, 165, 185, 215], "triplic": [0, 8, 45], "return": [0, 4, 8, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 125, 126, 127, 128, 129, 130, 131, 132, 134, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 156, 157, 158, 159, 160, 161, 162, 164, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 201, 202, 206, 207, 208, 214, 215], "nest": [0, 8, 45, 46, 72, 80, 90], "group": [0, 4, 8, 45, 46, 49, 54, 72, 80, 81, 82, 90, 101, 186, 214, 215], "alphabet": [0, 4, 8, 45], "For": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 50, 51, 53, 59, 63, 80, 90, 91, 92, 94, 105, 107, 112, 115, 139, 145, 147, 168, 170, 175, 178, 186, 199, 214, 215], "exampl": [0, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 203, 206, 207, 208, 209, 212, 213, 215], "a_rep1": [0, 8, 45], "a_rep2": [0, 8, 45], "a_rep3": [0, 8, 45], "b_rep1": [0, 8, 45], "b_rep2": [0, 8, 45], "_b_rep3": [0, 8, 45], "_avg_subsampl": 0, "sample_group": [0, 8, 46, 72], "liter": [0, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 62, 69, 70, 71, 74, 79, 80, 81, 82, 85, 87, 90, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 106, 108, 109, 110, 111, 112, 113, 114, 120, 121, 122, 126, 129, 131, 132, 133, 134, 135, 137, 138, 140, 141, 142, 143, 144, 145, 146, 151, 152, 153, 157, 159, 161, 162, 163, 164, 166, 167, 169, 171, 172, 173, 174, 175, 176, 177, 182, 183, 184, 189, 192, 194, 195, 196, 197], "mean": [0, 4, 8, 46, 48, 50, 51, 65, 70, 72, 73, 74, 90, 93, 104, 105, 138, 139, 167, 168, 214], "median": [0, 4, 8, 46, 49, 50, 54, 63, 72, 73, 101, 115, 147, 178, 214, 215], "geometric_mean": [0, 8, 46], "new_column_nam": [0, 8, 46], "auto": [0, 8, 16, 18, 30, 32, 36, 37, 46, 49, 50, 53, 54, 58, 59, 70, 74, 80, 81, 85, 92, 93, 94, 99, 101, 111, 112, 133, 135, 144, 145, 163, 174, 175, 196, 214], "avarag": 0, "subsampl": 0, "replic": [0, 3, 4, 8, 46, 49, 53, 54, 72, 80, 81, 82, 85, 90, 101, 214, 215], "specifi": [0, 4, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 49, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 74, 79, 80, 81, 82, 85, 86, 87, 88, 89, 90, 92, 97, 98, 101, 102, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 125, 126, 127, 131, 132, 136, 141, 142, 143, 145, 146, 147, 148, 153, 156, 157, 158, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 188, 189, 190, 194, 195, 211, 214, 215], "sampl": [0, 7, 8, 19, 33, 46, 49, 50, 53, 54, 61, 72, 73, 74, 75, 78, 80, 81, 82, 85, 89, 91, 101, 214, 215], "everi": [0, 1, 3, 4, 8, 57, 59, 81, 85, 90, 110, 112, 143, 145, 173, 175, 186, 214, 215], "member": [0, 8, 91], "should": [0, 1, 4, 6, 7, 8, 45, 46, 47, 51, 53, 55, 60, 61, 72, 74, 90, 98, 102, 103, 105, 108, 132, 137, 139, 141, 162, 165, 166, 168, 171, 195, 214, 215], "either": [0, 4, 8, 14, 15, 16, 18, 19, 21, 23, 28, 29, 30, 32, 33, 38, 40, 42, 43, 57, 69, 95, 110, 120, 129, 143, 151, 159, 173, 182, 192, 214, 215], "singl": [0, 3, 4, 7, 8, 49, 50, 54, 67, 80, 92, 93, 94, 101, 165, 214], "multipl": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 39, 40, 42, 49, 54, 57, 59, 64, 65, 80, 81, 82, 86, 87, 90, 91, 92, 93, 94, 100, 101, 110, 112, 117, 125, 126, 134, 143, 145, 148, 156, 157, 164, 173, 175, 179, 188, 189, 197, 214], "averag": [0, 8, 46, 49, 50, 54, 65, 80, 82, 85, 90, 91, 92, 101, 214, 215], "paramet": [0, 4, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 38, 39, 40, 41, 42, 43, 45, 46, 47, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 105, 106, 107, 108, 109, 110, 112, 113, 115, 116, 117, 119, 120, 121, 122, 124, 125, 126, 127, 129, 130, 131, 132, 134, 135, 136, 137, 139, 140, 141, 142, 143, 145, 147, 148, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 161, 162, 164, 165, 166, 168, 169, 170, 171, 172, 173, 175, 176, 178, 179, 181, 182, 183, 184, 186, 187, 188, 189, 190, 192, 193, 194, 195, 197, 198, 200, 201, 202, 203, 214], "pass": [0, 1, 215], "user": [0, 3, 4, 5, 7, 8, 9, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 47, 48, 53, 55, 56, 57, 91, 92, 94, 103, 104, 108, 109, 110, 137, 138, 141, 142, 143, 166, 167, 171, 172, 173, 214], "must": [0, 8, 49, 53, 54, 64, 72, 80, 81, 82, 86, 90, 92, 101, 117, 125, 148, 156, 179, 188, 200, 215], "present": [0, 8, 49, 54, 80, 81, 82, 101, 214], "object": [0, 3, 4, 8, 10, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 137, 138, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 165, 166, 167, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 205, 211], "To": [0, 1, 6, 7, 8, 16, 30, 36, 49, 53, 54, 57, 72, 73, 74, 75, 80, 81, 82, 90, 101, 110, 143, 173, 214, 215], "same": [0, 3, 8, 43, 45, 46, 49, 54, 64, 70, 72, 80, 81, 82, 86, 87, 90, 91, 92, 93, 94, 101, 102, 117, 125, 126, 136, 148, 156, 157, 179, 188, 189, 214], "condit": [0, 3, 8, 45, 46, 49, 53, 54, 65, 72, 80, 81, 82, 101, 113, 165, 176, 214, 215], "an": [0, 1, 3, 4, 7, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 41, 42, 43, 47, 49, 53, 54, 55, 57, 59, 67, 70, 72, 74, 80, 81, 82, 91, 92, 93, 94, 101, 103, 108, 110, 112, 136, 137, 141, 143, 145, 166, 171, 173, 175, 214], "inner": [0, 8, 49, 54, 80, 81, 82, 101], "input": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 40, 49, 50, 54, 67, 80, 81, 82, 84, 101, 124, 155, 187, 214, 215], "sample1a": [0, 8, 49, 54, 80, 81, 82, 101], "sample1b": [0, 8, 49, 54, 80, 81, 82, 101], "sample1c": [0, 8, 49, 54, 80, 81, 82, 101], "sample2a": [0, 8, 49, 54, 80, 81, 82, 101], "sample2b": [0, 8, 49, 54, 80, 81, 82, 101], "sample2c": [0, 8, 49, 54, 80, 81, 82, 101], "sample3": [0, 8, 49, 54, 80, 81, 82, 101, 215], "sample6": [0, 8, 49, 54, 80, 81, 82, 101], "output": [0, 3, 8, 20, 34, 41, 51, 55, 56, 57, 59, 60, 61, 62, 63, 64, 77, 79, 93, 94, 97, 102, 105, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 136, 139, 141, 142, 143, 145, 146, 147, 148, 153, 161, 168, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 200, 214], "follow": [0, 6, 7, 8, 53, 90, 214, 215], "sample1": [0, 8, 85, 215], "sample2": [0, 8, 85, 215], "sample_list": 0, "static": 0, "_from_str": 0, "msg": 0, "delimit": [0, 4, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197], "n": [0, 4, 7, 8, 14, 28, 64, 68, 96, 117, 119, 130, 148, 150, 160, 179, 181, 193, 200, 214, 215], "take": [0, 8, 42, 90, 214, 215], "manual": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 215], "from": [0, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 47, 48, 51, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 102, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 202, 203, 206, 207, 208, 209, 212, 213, 214], "split": [0, 3, 4, 8, 87, 88, 89, 90, 91, 92, 93, 94, 126, 127, 128, 157, 158, 189, 190, 191, 199, 214, 215], "valu": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 46, 47, 48, 49, 51, 54, 61, 62, 63, 64, 67, 72, 73, 74, 75, 76, 77, 78, 79, 85, 86, 90, 91, 92, 93, 94, 97, 98, 101, 102, 103, 104, 105, 113, 114, 115, 116, 117, 122, 125, 131, 132, 135, 137, 138, 139, 146, 147, 148, 153, 156, 161, 162, 165, 166, 167, 168, 176, 177, 178, 179, 184, 186, 188, 194, 195, 199, 214, 215], "param": [0, 8, 15, 16, 29, 30, 36, 37, 47, 48, 49, 59, 62, 70, 80, 81, 101, 103, 104, 112, 114, 135, 137, 138, 145, 146, 166, 167, 175, 177, 198, 199, 206, 207, 208, 211, 212, 213], "promprt": 0, "print": [0, 4, 8, 13, 17, 21, 22, 27, 31, 38, 39, 83, 123, 154, 185, 206, 207, 208, 209, 214, 215], "comma": [0, 7, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197, 214], "seper": [0, 215], "insert": 0, "_inplac": 0, "new_df": 0, "opposit": [0, 8, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 144, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 184, 194, 199, 214, 215], "inplac": [0, 4, 8, 46, 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 67, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 86, 90, 91, 92, 93, 94, 97, 98, 99, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 120, 121, 122, 125, 131, 132, 133, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 152, 153, 156, 161, 162, 163, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 182, 183, 184, 186, 188, 194, 195, 196, 199, 200, 214, 215], "suffix": [0, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 67, 186], "printout_oper": 0, "filter_update_kwarg": 0, "execut": [0, 215], "": [0, 1, 4, 7, 8, 10, 13, 16, 17, 22, 27, 30, 31, 36, 39, 42, 43, 45, 51, 53, 72, 73, 74, 75, 77, 84, 90, 102, 105, 124, 136, 139, 155, 165, 168, 187, 214, 215], "choic": [0, 4, 214, 215], "whether": [0, 1, 8, 45, 47, 55, 90, 103, 108, 137, 141, 166, 171, 186, 200, 214, 215], "place": [0, 4, 8, 52, 69, 86, 106, 120, 125, 140, 151, 156, 169, 182, 188, 200, 203], "creat": [0, 1, 4, 7, 8, 41, 90, 200], "instanc": [0, 8, 41, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 72, 73, 74, 75, 76, 77, 78, 79, 80, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 195], "pd": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41], "post": [0, 1], "determin": [0, 4, 7, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 36, 40, 41, 42, 43, 47, 48, 49, 50, 54, 55, 56, 70, 71, 80, 81, 85, 90, 91, 92, 93, 94, 101, 103, 104, 108, 109, 116, 121, 135, 137, 138, 141, 142, 152, 166, 167, 171, 172, 183, 200, 214, 215], "filtrat": 0, "ad": [0, 8, 74, 80, 199, 200, 203, 214, 215], "If": [0, 1, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 46, 49, 50, 52, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 84, 85, 86, 90, 91, 92, 93, 94, 95, 97, 98, 100, 101, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 121, 122, 124, 125, 129, 131, 132, 134, 135, 140, 141, 142, 143, 145, 146, 147, 148, 151, 152, 153, 155, 156, 159, 161, 162, 164, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 183, 184, 186, 187, 188, 192, 194, 195, 197, 200, 214, 215], "_is_norm": 0, "properti": [0, 8], "_numeric_column": 0, "numer": [0, 4, 8, 53, 65, 165, 170, 176, 180, 186, 191, 214, 215], "int": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 58, 59, 64, 68, 70, 72, 81, 90, 91, 92, 93, 94, 96, 97, 107, 111, 112, 117, 119, 130, 131, 144, 145, 148, 150, 160, 161, 170, 174, 175, 179, 181, 186, 193, 194], "float": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 49, 50, 51, 54, 60, 61, 63, 70, 71, 74, 75, 79, 80, 81, 85, 88, 89, 90, 91, 92, 97, 101, 105, 107, 115, 116, 121, 122, 127, 131, 135, 139, 147, 152, 153, 158, 161, 168, 170, 178, 183, 184, 186, 190, 194], "_plot_pca": 0, "final_df": 0, "pc1_var": 0, "pc2_var": 0, "label": [0, 4, 8, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "titl": [0, 4, 8, 41, 42, 43, 49, 50, 54, 57, 70, 80, 81, 85, 101, 110, 135, 143, 173, 214, 215], "title_fonts": [0, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "label_fonts": [0, 8, 49, 54, 70, 80, 81, 85, 101, 135], "tick_fonts": [0, 8, 49, 50, 54, 70, 80, 81, 85, 101, 135], "intern": [0, 214], "varianc": [0, 8, 74, 81], "explain": [0, 1, 8, 81, 214, 215], "first": [0, 4, 6, 7, 8, 13, 27, 42, 43, 52, 53, 64, 68, 69, 72, 73, 74, 75, 81, 85, 86, 88, 89, 95, 106, 117, 119, 120, 125, 127, 128, 129, 140, 148, 150, 151, 156, 158, 159, 165, 169, 179, 181, 182, 188, 190, 191, 192, 199, 214, 215], "pc": [0, 214], "second": [0, 8, 21, 38, 42, 43, 81, 85, 88, 89, 95, 127, 128, 129, 158, 159, 165, 190, 191, 192, 214, 215], "draw": [0, 8, 14, 28, 41, 81, 214, 215], "color": [0, 8, 42, 43, 81, 135, 214, 215], "axi": [0, 8, 19, 33, 49, 54, 70, 80, 81, 82, 85, 101, 135, 215], "_set_op": 0, "other": [0, 1, 3, 8, 10, 13, 17, 21, 22, 24, 27, 31, 38, 39, 50, 52, 69, 71, 81, 88, 90, 95, 100, 106, 120, 121, 127, 128, 129, 134, 140, 151, 152, 158, 159, 164, 169, 182, 183, 190, 191, 192, 197, 214, 215], "return_typ": [0, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197], "op": 0, "kwarg": [0, 8, 199], "suppli": [0, 4, 8, 42, 43, 47, 48, 53, 55, 56, 90, 98, 103, 104, 108, 109, 132, 137, 138, 141, 142, 162, 166, 167, 171, 172, 195, 214, 215], "differ": [0, 3, 4, 8, 21, 38, 78, 81, 90, 93, 94, 95, 129, 159, 186, 192, 214], "symmetr": [0, 4, 8, 21, 38, 95, 129, 159, 192, 215], "type": [0, 3, 4, 7, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 43, 47, 49, 50, 51, 52, 54, 55, 59, 62, 65, 69, 70, 71, 81, 87, 88, 89, 95, 96, 100, 101, 103, 105, 106, 108, 112, 114, 120, 121, 126, 127, 128, 129, 130, 134, 137, 139, 140, 141, 145, 146, 151, 152, 157, 158, 159, 160, 164, 166, 168, 169, 171, 175, 177, 182, 183, 186, 189, 190, 191, 192, 193, 197, 198, 199, 200, 202, 205, 206, 207, 208, 211, 212, 213, 214], "symmetric_differ": [0, 8], "addit": [0, 4, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 47, 48, 91, 98, 103, 104, 132, 137, 138, 162, 166, 167, 195, 200, 214, 215], "keyword": [0, 8, 98, 132, 162, 195, 199, 215], "argument": [0, 3, 4, 8, 65, 98, 132, 162, 195, 199, 215], "_sort": 0, "ascend": [0, 8, 64, 83, 86, 117, 123, 125, 148, 154, 156, 179, 185, 188, 199], "true": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 67, 69, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 86, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 120, 122, 125, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 153, 156, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 182, 184, 186, 188, 194, 195, 196, 199, 200, 214, 215], "na_posit": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 199], "last": [0, 8, 64, 86, 96, 117, 125, 130, 148, 156, 160, 179, 188, 193, 203, 214, 215], "sort": [0, 4, 8, 24, 35, 36, 37, 64, 83, 117, 123, 148, 154, 179, 185, 199, 200, 214], "v": [0, 8, 64, 86, 117, 125, 135, 148, 156, 179, 188, 214], "descend": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188], "have": [0, 1, 3, 4, 6, 8, 20, 34, 45, 60, 61, 64, 75, 79, 86, 89, 91, 97, 102, 113, 117, 122, 125, 131, 148, 153, 156, 161, 176, 179, 184, 188, 194, 214, 215], "length": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 214, 215], "put": [0, 1, 8, 64, 86, 117, 125, 148, 156, 179, 188], "nan": [0, 4, 8, 51, 62, 64, 86, 105, 114, 117, 125, 139, 146, 148, 156, 168, 177, 179, 188, 214, 215], "begin": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 214], "end": [0, 4, 8, 64, 86, 97, 117, 125, 131, 148, 156, 161, 179, 188, 194, 214, 215], "otherwis": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 47, 48, 70, 82, 86, 90, 91, 92, 93, 94, 103, 104, 125, 137, 138, 156, 166, 167, 188, 200, 214, 215], "copi": [0, 1, 6, 8, 86, 125, 156, 188, 214, 215], "without": [0, 3, 4, 7, 8, 14, 28, 35, 36, 37, 86, 90, 125, 156, 188, 199, 214], "origin": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 52, 56, 57, 60, 61, 62, 63, 64, 67, 69, 79, 86, 87, 88, 89, 90, 91, 92, 93, 94, 97, 106, 107, 109, 110, 113, 114, 115, 116, 117, 120, 122, 125, 126, 127, 128, 131, 140, 142, 143, 146, 147, 148, 151, 153, 156, 157, 158, 161, 169, 170, 172, 173, 176, 177, 178, 179, 182, 184, 186, 188, 189, 190, 191, 194, 200, 214, 215], "average_replicate_sampl": [0, 4, 8], "gene": [0, 3, 4, 7, 8, 9, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 36, 37, 40, 45, 46, 47, 48, 55, 58, 59, 72, 73, 74, 75, 82, 90, 91, 99, 102, 103, 104, 108, 111, 112, 116, 133, 137, 138, 141, 144, 145, 163, 165, 166, 167, 171, 174, 175, 186, 196, 206], "each": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 42, 46, 47, 48, 53, 70, 72, 73, 74, 75, 76, 77, 78, 80, 82, 87, 90, 91, 92, 93, 94, 102, 103, 104, 126, 137, 138, 157, 166, 167, 189, 214, 215], "e": [0, 4, 7, 8, 46, 53, 214, 215], "g": [0, 4, 7, 8, 43, 46, 53, 214, 215], "biolog": [0, 8, 24, 46, 214, 215], "technic": [0, 8, 46, 214, 215], "conta": [0, 8, 46, 72], "given": [0, 1, 4, 8, 9, 14, 28, 46, 50, 57, 59, 65, 67, 69, 71, 75, 87, 110, 112, 120, 121, 126, 143, 145, 151, 152, 157, 173, 175, 182, 183, 186, 189, 200, 206, 207, 208, 215], "match": [0, 4, 8, 16, 18, 30, 32, 36, 37, 46, 47, 55, 56, 59, 87, 103, 108, 109, 112, 126, 137, 141, 142, 145, 157, 166, 171, 172, 175, 189, 214, 215], "within": [0, 8, 46, 72, 73, 75, 214, 215], "affect": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 72, 73, 74, 75, 76, 77, 78, 79, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 195, 214, 215], "biotypes_from_gtf": [0, 8], "gtf_path": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "attribute_nam": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "biotyp": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 47, 48, 55, 56, 103, 104, 108, 109, 137, 138, 141, 142, 166, 167, 171, 172, 209, 213], "gene_biotyp": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript_biotyp": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "gene_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "feature_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript": [0, 7, 8, 16, 18, 30, 32, 36, 37, 47, 55, 58, 59, 99, 103, 108, 111, 112, 133, 137, 141, 144, 145, 163, 166, 171, 174, 175, 196, 214], "long_format": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167], "describ": [0, 7, 8, 47, 48, 55, 103, 104, 108, 137, 138, 141, 166, 167, 171, 214, 215], "tabl": [0, 3, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 40, 42, 43, 45, 47, 48, 53, 55, 56, 57, 59, 67, 77, 78, 87, 102, 103, 104, 108, 109, 110, 112, 126, 136, 137, 138, 141, 142, 143, 145, 157, 165, 166, 167, 171, 172, 173, 175, 189, 205, 209, 212, 213, 214], "about": [0, 1, 3, 4, 8, 16, 30, 36, 47, 48, 55, 56, 57, 72, 77, 88, 90, 102, 103, 104, 108, 109, 110, 127, 137, 138, 141, 142, 143, 158, 165, 166, 167, 171, 172, 173, 190, 214, 215], "drawn": [0, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 47, 48, 55, 56, 103, 104, 108, 109, 137, 138, 141, 142, 166, 167, 171, 172, 214], "gtf": [0, 4, 8, 47, 55, 103, 108, 137, 141, 166, 171, 214], "transfer": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "id": [0, 3, 4, 8, 16, 18, 30, 32, 36, 37, 47, 55, 58, 59, 99, 103, 108, 111, 112, 133, 137, 141, 144, 145, 163, 166, 171, 174, 175, 196, 214], "individu": [0, 8, 47, 53, 55, 67, 70, 103, 108, 137, 141, 166, 171, 214, 215], "short": [0, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214], "long": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214, 215], "form": [0, 3, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 215], "state": [0, 8, 47, 48, 103, 104, 137, 138, 166, 167, 199], "also": [0, 3, 4, 7, 8, 24, 47, 48, 67, 90, 103, 104, 137, 138, 166, 167, 200, 214, 215], "provid": [0, 8, 47, 48, 91, 103, 104, 116, 137, 138, 166, 167, 214], "descript": [0, 1, 4, 8, 9, 44, 47, 48, 51, 103, 104, 105, 137, 138, 139, 166, 167, 168, 205, 214, 215], "statist": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41, 47, 48, 51, 92, 93, 94, 103, 104, 105, 137, 138, 139, 165, 166, 167, 168, 214], "per": [0, 4, 8, 45, 47, 48, 67, 72, 76, 77, 82, 92, 93, 94, 103, 104, 137, 138, 166, 167, 214, 215], "rtype": [0, 8, 15, 16, 29, 30, 36, 47, 48, 103, 104, 137, 138, 166, 167], "show": [0, 8, 16, 30, 36, 42, 47, 48, 51, 68, 80, 96, 103, 104, 105, 119, 130, 137, 138, 139, 150, 160, 166, 167, 168, 181, 193, 214, 215], "number": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 47, 48, 58, 59, 61, 68, 72, 75, 79, 89, 90, 91, 92, 93, 94, 96, 97, 99, 103, 104, 111, 112, 119, 122, 130, 131, 133, 137, 138, 144, 145, 150, 153, 160, 161, 163, 166, 167, 174, 175, 181, 184, 186, 193, 194, 196, 214, 215], "belong": [0, 8, 14, 28, 47, 48, 57, 59, 87, 90, 103, 104, 110, 112, 126, 137, 138, 143, 145, 157, 166, 167, 173, 175, 189, 214, 215], "well": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214, 215], "biotypes_from_ref_t": [0, 3, 4, 8, 215], "ref": [0, 8, 11, 25, 48, 56, 57, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 186, 189, 215], "predefin": [0, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 40, 42, 43, 48, 56, 57, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 189, 215], "ce11": [0, 8, 48, 104, 138, 167], "packag": [0, 4, 7, 48, 104, 138, 167, 214, 215], "d": [0, 7, 8, 11, 25, 48, 52, 63, 68, 69, 71, 88, 95, 96, 100, 104, 106, 107, 113, 115, 116, 119, 120, 121, 127, 128, 129, 130, 134, 136, 138, 140, 147, 150, 151, 152, 158, 159, 160, 164, 167, 169, 178, 181, 182, 183, 190, 192, 193, 197, 200, 215], "test": [0, 1, 4, 7, 8, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 214], "test_fil": [0, 8, 10, 11, 24, 25, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 215], "test_deseq": [0, 8, 11, 25, 48, 52, 63, 68, 69, 71, 79, 88, 95, 96, 100, 104, 106, 115, 119, 120, 121, 122, 127, 128, 129, 130, 134, 138, 140, 147, 150, 151, 152, 153, 158, 159, 160, 164, 167, 169, 178, 181, 182, 183, 184, 190, 192, 193, 197, 215], "view": [0, 8, 48, 104, 138, 167, 214], "biotype_ref_table_for_test": [0, 8, 11, 25, 48, 56, 104, 109, 138, 142, 167, 172, 186, 215], "protein_cod": [0, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 40, 48, 55, 56, 104, 108, 109, 138, 141, 142, 167, 171, 172, 186, 215], "26": [0, 8, 11, 25, 48, 51, 52, 62, 69, 79, 104, 105, 106, 113, 114, 120, 122, 128, 138, 139, 140, 146, 151, 153, 167, 168, 169, 177, 182, 184, 215], "pseudogen": [0, 3, 8, 11, 25, 48, 55, 56, 104, 108, 109, 138, 141, 142, 167, 171, 172, 215], "1": [0, 7, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 48, 49, 51, 53, 54, 62, 63, 68, 71, 72, 74, 75, 80, 81, 86, 88, 90, 91, 96, 98, 101, 104, 105, 107, 114, 115, 116, 119, 121, 125, 127, 130, 132, 135, 138, 139, 146, 147, 150, 152, 156, 158, 160, 162, 167, 168, 170, 177, 178, 181, 183, 186, 188, 190, 193, 195, 199, 206, 215], "unknown": [0, 8, 11, 25, 48, 104, 138, 167, 215], "basemean": [0, 8, 48, 62, 68, 79, 96, 104, 114, 119, 122, 130, 138, 146, 150, 153, 160, 167, 177, 181, 184, 193, 200, 215], "padj": [0, 8, 48, 68, 96, 102, 104, 118, 119, 130, 138, 150, 160, 167, 181, 193, 200, 215], "75": [0, 8, 48, 49, 51, 54, 63, 75, 88, 90, 91, 96, 101, 104, 105, 115, 127, 130, 138, 139, 147, 158, 160, 167, 168, 178, 190, 193, 214, 215], "max": [0, 8, 41, 48, 51, 104, 105, 138, 139, 167, 168, 215], "0": [0, 5, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 48, 51, 56, 63, 68, 71, 72, 74, 75, 86, 88, 90, 91, 104, 105, 107, 109, 115, 116, 119, 121, 125, 127, 135, 138, 139, 142, 147, 150, 152, 156, 158, 165, 167, 168, 170, 172, 178, 181, 183, 186, 188, 190, 191, 199, 206, 207, 214, 215], "1823": [0, 8, 48, 104, 138, 167, 215], "089609": [0, 8, 48, 104, 138, 167, 215], "005060e": [0, 8, 48, 104, 138, 167, 215], "90": [0, 8, 48, 51, 96, 104, 105, 130, 138, 139, 160, 167, 168, 193, 215], "9": [0, 4, 8, 48, 51, 56, 68, 96, 104, 105, 109, 119, 130, 138, 139, 142, 150, 160, 167, 168, 172, 181, 186, 193, 206, 207, 214, 215], "290000e": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "68": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "2688": [0, 8, 48, 104, 138, 167, 215], "043701": [0, 8, 48, 104, 138, 167, 215], "800000e": [0, 8, 48, 68, 104, 119, 138, 150, 167, 181, 215], "94": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "2085": [0, 8, 48, 104, 138, 167, 215], "995094": [0, 8, 48, 104, 138, 167, 215], "3": [0, 1, 7, 8, 43, 48, 51, 57, 62, 68, 71, 74, 81, 90, 93, 94, 96, 104, 105, 110, 113, 114, 119, 121, 130, 138, 139, 143, 146, 150, 152, 160, 167, 168, 173, 177, 181, 183, 193, 200, 206, 214, 215], "070000e": [0, 8, 48, 68, 104, 119, 138, 150, 167, 181, 215], "152": [0, 8, 48, 104, 138, 167, 215], "x": [0, 8, 14, 28, 48, 49, 50, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 68, 70, 74, 79, 80, 81, 85, 96, 97, 98, 101, 104, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 122, 130, 131, 132, 135, 138, 141, 142, 143, 145, 146, 147, 148, 150, 153, 160, 161, 162, 167, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 184, 186, 193, 194, 195, 214, 215], "48": [0, 8, 48, 104, 138, 167, 215], "box_plot": [0, 4, 8], "notch": [0, 8, 49], "ylabel": [0, 8, 41, 49, 54, 85, 101], "log10": [0, 8, 49, 54, 85, 98, 101, 132, 135, 162, 195], "20": [0, 8, 42, 49, 50, 51, 54, 70, 81, 85, 86, 87, 101, 105, 125, 126, 135, 139, 156, 157, 168, 188, 189, 214, 215], "16": [0, 5, 8, 49, 54, 61, 80, 81, 85, 89, 90, 101, 135, 207, 215], "12": [0, 5, 7, 8, 43, 49, 50, 54, 64, 70, 80, 81, 85, 90, 101, 117, 135, 148, 176, 179, 191, 215], "ax": [0, 8, 42, 43, 49, 54, 70, 101, 214], "box": [0, 6, 7, 8, 49, 54, 90, 91, 92, 93, 94, 98, 101, 132, 162, 195, 214], "scale": [0, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 49, 54, 72, 73, 74, 75, 78, 101, 214, 215], "both": [0, 3, 8, 14, 15, 16, 18, 21, 23, 28, 29, 30, 32, 35, 36, 38, 40, 49, 54, 57, 80, 90, 95, 101, 110, 129, 143, 159, 173, 192, 214, 215], "It": [0, 4, 8, 49, 54, 101, 214, 215], "recommend": [0, 5, 8, 15, 29, 49, 54, 101, 186, 215], "absolut": [0, 8, 49, 54, 67, 101, 107, 135, 170, 214, 215], "25": [0, 5, 7, 8, 49, 51, 54, 62, 63, 101, 105, 114, 115, 116, 139, 146, 147, 168, 177, 178, 200, 215], "percentil": [0, 4, 8, 49, 51, 54, 63, 88, 101, 105, 115, 127, 139, 147, 158, 168, 178, 190, 215], "white": [0, 8, 49, 54, 101], "dot": [0, 8, 49, 54, 85, 101], "add": [0, 1, 8, 43, 49, 54, 199, 214, 215], "confid": [0, 8, 49], "interv": [0, 8, 49], "top": [0, 8, 49, 54, 64, 74, 117, 148, 179, 214, 215], "y": [0, 8, 19, 33, 41, 49, 50, 54, 70, 74, 80, 81, 82, 85, 101, 135, 215], "30": [0, 8, 49, 50, 51, 54, 70, 80, 81, 85, 101, 105, 135, 139, 168], "font": [0, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "size": [0, 4, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 90, 91, 101, 135, 186, 214, 215], "graph": [0, 4, 8, 16, 30, 36, 41, 49, 50, 54, 70, 80, 81, 85, 101, 135, 214], "15": [0, 7, 8, 49, 51, 54, 57, 70, 80, 81, 85, 86, 87, 90, 101, 105, 110, 125, 126, 135, 139, 143, 156, 157, 168, 173, 188, 189, 215], "tick": [0, 8, 49, 50, 54, 70, 80, 81, 85, 101, 135], "matplotlib": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 49, 54, 70, 81, 85, 101, 215], "add_scatt": [0, 8, 49, 54], "sample_nam": [0, 8, 50], "metric": [0, 8, 50, 90, 91, 92, 94, 214, 215], "euclidean": [0, 8, 50, 90, 91, 92, 94, 214, 215], "linkag": [0, 8, 50, 90, 92, 214, 215], "complet": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 43, 50, 53, 92, 214], "ward": [0, 8, 50, 90, 92, 214], "weight": [0, 8, 16, 30, 36, 43, 50, 72, 74, 215], "centroid": [0, 8, 50, 93, 94], "hierarch": [0, 4, 7, 8, 50, 90, 92, 214], "cluster": [0, 4, 7, 8, 50, 90, 91, 92, 93, 94], "2": [0, 7, 8, 42, 43, 50, 51, 52, 53, 62, 68, 69, 71, 79, 86, 87, 90, 96, 105, 106, 107, 113, 114, 119, 120, 121, 122, 125, 126, 128, 130, 139, 140, 146, 150, 151, 152, 153, 156, 157, 160, 168, 169, 170, 177, 181, 182, 183, 184, 186, 188, 189, 193, 206, 215], "log": [0, 4, 8, 50, 73, 98, 132, 162, 195, 214, 215], "relev": [0, 4, 8, 50, 214, 215], "condition1_rep1": [0, 8, 50], "condition1_rep2": [0, 8, 50], "condition1_rep3": [0, 8, 50], "condition2_rep1": [0, 8, 50], "condition3_rep1": [0, 8, 50], "condition3_rep2": [0, 8, 50], "ham": [0, 8, 50, 91, 94], "correl": [0, 8, 50, 80, 214, 215], "distanc": [0, 8, 50, 91, 92, 94, 215], "avail": [0, 8, 16, 18, 23, 30, 32, 40, 50, 90, 214], "scipi": [0, 7, 8, 50], "spatial": [0, 8, 50, 214, 215], "pdist": [0, 8, 50], "possibl": [0, 1, 8, 50, 215], "see": [0, 3, 4, 8, 16, 18, 30, 32, 36, 37, 50, 51, 53, 59, 68, 80, 90, 91, 92, 94, 96, 105, 112, 119, 130, 139, 145, 150, 160, 168, 175, 181, 193, 214, 215], "document": [0, 4, 7, 8, 50, 51, 68, 80, 96, 105, 119, 130, 139, 150, 160, 168, 181, 193, 214, 215], "onlin": [0, 8, 50, 215], "hierarchi": [0, 8, 50, 214, 215], "10": [0, 5, 7, 8, 15, 29, 43, 50, 51, 54, 64, 67, 76, 77, 81, 85, 90, 105, 117, 139, 148, 168, 176, 179, 186, 191, 214, 215], "seaborn": [0, 7, 8, 50, 80], "clustermap": [0, 8, 50], "01": [0, 8, 51, 105, 139, 168], "5": [0, 5, 8, 51, 60, 61, 63, 68, 71, 74, 89, 90, 96, 97, 105, 115, 119, 121, 130, 131, 139, 147, 150, 152, 160, 161, 168, 178, 181, 183, 186, 193, 194, 199, 207, 208, 214, 215], "99": [0, 8, 51, 105, 139, 168], "summar": [0, 8, 51, 105, 139, 168, 214], "central": [0, 8, 51, 105, 139, 168], "tendenc": [0, 8, 51, 105, 139, 168], "dispers": [0, 7, 8, 51, 105, 139, 168, 214], "dataset": [0, 8, 42, 51, 80, 105, 139, 168], "distribut": [0, 8, 51, 105, 139, 168, 214, 215], "exclud": [0, 8, 16, 30, 36, 51, 75, 105, 139, 168, 214, 215], "inform": [0, 3, 4, 8, 51, 72, 77, 80, 105, 139, 168, 214, 215], "like": [0, 3, 8, 51, 74, 105, 139, 168, 201, 202, 206, 214, 215], "fall": [0, 8, 51, 105, 139, 168], "between": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 51, 63, 65, 69, 71, 72, 73, 74, 75, 80, 81, 88, 90, 91, 92, 94, 100, 105, 107, 113, 115, 116, 120, 121, 127, 134, 135, 139, 147, 151, 152, 158, 164, 165, 168, 170, 176, 178, 182, 183, 186, 190, 197], "25th": [0, 8, 51, 63, 105, 115, 139, 147, 168, 178], "50th": [0, 8, 51, 105, 139, 168], "75th": [0, 8, 51, 63, 105, 115, 139, 147, 168, 178], "summari": [0, 4, 8, 51, 105, 139, 168, 214, 215], "seri": [0, 3, 4, 5, 8, 51, 105, 139, 165, 168, 215], "numpi": [0, 7, 8, 51, 91, 105, 139, 168, 215], "np": [0, 8, 51, 105, 139, 168], "cond1": [0, 8, 51, 64, 72, 83, 86, 98, 105, 117, 123, 125, 132, 139, 148, 154, 156, 162, 168, 179, 185, 188, 195, 215], "cond2": [0, 8, 51, 64, 72, 86, 105, 117, 125, 139, 148, 156, 168, 179, 188, 215], "cond3": [0, 8, 51, 72, 86, 105, 125, 139, 156, 168, 188, 215], "cond4": [0, 8, 51, 72, 86, 98, 105, 125, 132, 139, 156, 162, 168, 188, 195, 215], "22": [0, 8, 51, 56, 57, 60, 61, 64, 72, 73, 74, 75, 76, 77, 78, 87, 89, 90, 97, 98, 105, 109, 110, 117, 126, 131, 132, 139, 142, 143, 148, 157, 161, 162, 168, 170, 172, 173, 176, 179, 186, 189, 191, 194, 195, 200, 215], "000000": [0, 8, 51, 105, 139, 168], "2515": [0, 8, 51, 105, 139, 168], "590909": [0, 8, 51, 105, 139, 168], "2209": [0, 8, 51, 105, 139, 168], "227273": [0, 8, 51, 105, 139, 168], "4230": [0, 8, 51, 105, 139, 168], "3099": [0, 8, 51, 105, 139, 168], "818182": [0, 8, 51, 105, 139, 168], "std": [0, 8, 51, 105, 139, 168], "4820": [0, 8, 51, 105, 139, 168], "512674": [0, 8, 51, 105, 139, 168], "4134": [0, 8, 51, 105, 139, 168], "948493": [0, 8, 51, 105, 139, 168], "7635": [0, 8, 51, 105, 139, 168], "832664": [0, 8, 51, 105, 139, 168], "5520": [0, 8, 51, 105, 139, 168], "394522": [0, 8, 51, 105, 139, 168], "min": [0, 8, 41, 51, 105, 139, 168], "6": [0, 8, 51, 61, 68, 76, 77, 89, 96, 105, 119, 130, 139, 150, 160, 168, 181, 186, 193, 207, 214, 215], "250000": [0, 8, 51, 105, 139, 168], "50": [0, 8, 19, 33, 51, 90, 93, 105, 139, 168, 214], "57": [0, 8, 51, 86, 91, 105, 125, 139, 156, 168, 188, 215], "500000": [0, 8, 51, 105, 139, 168], "52": [0, 8, 51, 105, 139, 168, 215], "23": [0, 5, 8, 51, 86, 105, 125, 139, 156, 168, 188, 215], "21": [0, 8, 51, 63, 88, 105, 115, 127, 139, 147, 158, 168, 178, 190, 214, 215], "2637": [0, 8, 51, 105, 139, 168], "2479": [0, 8, 51, 105, 139, 168], "6030": [0, 8, 51, 105, 139, 168], "4669": [0, 8, 51, 105, 139, 168], "750000": [0, 8, 51, 105, 139, 168], "15054": [0, 8, 51, 105, 139, 168], "950000": [0, 8, 51, 105, 139, 168], "12714": [0, 8, 51, 105, 139, 168], "290000": [0, 8, 51, 105, 139, 168], "21955": [0, 8, 51, 105, 139, 168], "390000": [0, 8, 51, 105, 139, 168], "15603": [0, 8, 51, 105, 139, 168], "510000": [0, 8, 51, 105, 139, 168], "15056": [0, 8, 51, 105, 139, 168], "12746": [0, 8, 51, 105, 139, 168], "22027": [0, 8, 51, 105, 139, 168], "15639": [0, 8, 51, 105, 139, 168], "decil": [0, 8, 51, 105, 139, 168], "arang": [0, 8, 51, 105, 139, 168], "200000": [0, 8, 51, 105, 139, 168], "400000": [0, 8, 51, 105, 139, 168], "700000": [0, 8, 51, 105, 139, 168], "600000": [0, 8, 51, 105, 139, 168], "40": [0, 8, 51, 90, 92, 105, 139, 168], "28": [0, 5, 8, 51, 52, 62, 63, 69, 79, 88, 105, 106, 107, 114, 115, 120, 122, 127, 128, 139, 140, 146, 147, 151, 153, 158, 168, 169, 177, 178, 182, 184, 190, 200, 215], "800000": [0, 8, 51, 105, 139, 168], "14": [0, 6, 7, 8, 43, 51, 57, 91, 93, 94, 105, 110, 139, 143, 168, 173, 176, 191], "60": [0, 8, 51, 86, 90, 105, 125, 139, 156, 168, 188, 215], "82": [0, 8, 51, 91, 96, 105, 130, 139, 160, 168, 193, 215], "106": [0, 8, 51, 105, 139, 168], "44": [0, 8, 51, 105, 139, 168], "33": [0, 8, 51, 105, 139, 168], "70": [0, 8, 51, 96, 105, 130, 139, 160, 168, 193, 215], "484": [0, 8, 51, 105, 139, 168], "395": [0, 8, 51, 105, 139, 168], "305": [0, 8, 51, 105, 139, 168], "302": [0, 8, 51, 68, 105, 119, 139, 150, 168, 181, 215], "80": [0, 8, 51, 91, 92, 105, 139, 168], "3398": [0, 8, 51, 105, 139, 168], "3172": [0, 8, 51, 105, 139, 168], "7981": [0, 8, 51, 105, 139, 168], "6213": [0, 8, 51, 105, 139, 168], "8722": [0, 8, 51, 105, 139, 168], "100000": [0, 8, 51, 105, 139, 168], "7941": [0, 8, 51, 105, 139, 168], "16449": [0, 8, 51, 105, 139, 168], "12129": [0, 8, 51, 105, 139, 168], "900000": [0, 8, 51, 105, 139, 168], "keep": [0, 1, 8, 52, 56, 57, 59, 61, 63, 64, 69, 79, 97, 106, 107, 109, 110, 112, 113, 115, 116, 117, 120, 122, 131, 140, 142, 143, 145, 147, 148, 151, 153, 161, 169, 170, 172, 173, 175, 176, 178, 179, 182, 184, 186, 194, 214, 215], "onli": [0, 3, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 52, 56, 57, 59, 61, 63, 64, 68, 69, 71, 79, 87, 89, 92, 97, 106, 107, 109, 110, 112, 113, 115, 116, 117, 119, 120, 121, 122, 126, 128, 131, 140, 142, 143, 145, 147, 148, 150, 151, 152, 153, 157, 161, 169, 170, 172, 173, 175, 176, 178, 179, 181, 182, 183, 184, 186, 189, 191, 194, 214, 215], "exist": [0, 8, 17, 22, 31, 39, 52, 69, 95, 100, 106, 120, 129, 134, 140, 151, 159, 164, 169, 182, 192, 197, 214], "NOT": [0, 8, 13, 27, 52, 67, 95, 106, 129, 140, 159, 169, 192, 215], "done": [0, 1, 4, 8, 52, 57, 59, 69, 90, 106, 110, 112, 120, 140, 143, 145, 151, 169, 173, 175, 182, 214, 215], "calcul": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 52, 65, 69, 71, 72, 73, 74, 75, 78, 80, 81, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 165, 169, 182, 183, 186, 192, 197, 214], "wbgene": [0, 4, 8, 52, 71, 95, 100, 106, 121, 129, 134, 140, 152, 159, 164, 169, 183, 192, 197, 206, 207, 208], "deseqfilt": [0, 3, 8, 52, 53, 95, 140, 159, 169, 192, 198, 200], "a_set": [0, 8, 52, 69, 71, 106, 120, 121, 140, 151, 152, 169, 182, 183, 215], "wbgene00000001": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 52, 69, 71, 106, 120, 121, 140, 151, 152, 169, 182, 183, 215], "wbgene00000002": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 52, 68, 69, 71, 95, 100, 106, 119, 120, 121, 129, 134, 140, 150, 151, 152, 159, 164, 169, 181, 182, 183, 192, 197, 215], "wbgene00000003": [0, 8, 13, 17, 22, 27, 31, 39, 52, 68, 69, 71, 95, 100, 106, 119, 120, 121, 129, 134, 140, 150, 151, 152, 159, 164, 169, 181, 182, 183, 192, 197, 215], "wbgene00007063": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007064": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007066": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007067": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007069": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007071": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007074": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007075": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007076": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007077": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007078": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007079": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00014997": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043987": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043988": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043989": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043990": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00044022": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00044951": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077502": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077503": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077504": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "leav": [0, 8, 52, 56, 57, 60, 61, 62, 63, 64, 69, 79, 87, 88, 89, 90, 91, 92, 93, 94, 97, 106, 107, 109, 110, 113, 114, 115, 116, 117, 120, 122, 126, 127, 128, 131, 140, 142, 143, 146, 147, 148, 151, 153, 157, 158, 161, 169, 170, 172, 173, 176, 177, 178, 179, 182, 184, 186, 189, 190, 191, 194, 200, 214, 215], "differential_expression_deseq2": [0, 4, 8], "design_matrix": [0, 8, 53], "comparison": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 53, 186, 214, 215], "iter": [0, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 53, 58, 67, 85, 93, 94, 111, 144, 174], "r_installation_fold": [0, 8, 53], "analysi": [0, 3, 4, 5, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 53, 81], "deseq2": [0, 3, 7, 8, 53, 73], "algorithm": [0, 8, 53, 90, 91, 92, 93, 94, 214, 215], "design": [0, 8, 53, 214], "least": [0, 4, 8, 22, 39, 53, 57, 59, 61, 71, 89, 90, 100, 110, 112, 121, 134, 143, 145, 152, 164, 173, 175, 183, 197, 214, 215], "two": [0, 3, 8, 21, 38, 53, 67, 71, 88, 89, 107, 113, 121, 127, 128, 152, 158, 165, 170, 176, 183, 190, 191, 214, 215], "experiment": [0, 8, 16, 30, 36, 53, 58, 72, 111, 144, 174, 214, 215], "factor": [0, 4, 8, 53, 72, 73, 74, 75, 78, 215], "guid": [0, 3, 4, 5, 6, 7, 8, 16, 30, 36, 53, 57, 91, 92, 94, 110, 143, 173, 214], "formula": [0, 8, 15, 29, 53, 214, 215], "version": [0, 1, 4, 6, 7, 8, 53, 90, 214, 215], "r": [0, 7, 8, 41, 43, 53, 73, 74, 75, 80, 214, 215], "instal": [0, 1, 4, 5, 8, 53, 214, 215], "experi": [0, 8, 53, 214, 215], "numerator_valu": [0, 8, 53], "denominator_valu": [0, 8, 53], "what": [0, 5, 8, 14, 28, 53, 71, 121, 152, 183, 214], "build": [0, 7, 8, 53, 215], "exactli": [0, 8, 21, 38, 53, 95, 129, 159, 165, 192, 208, 214, 215], "three": [0, 8, 53, 214, 215], "element": [0, 4, 8, 13, 17, 21, 22, 27, 31, 38, 39, 53, 81], "level": [0, 8, 24, 53, 89, 214, 215], "fold": [0, 3, 4, 7, 8, 24, 41, 53, 65, 102, 107, 113, 128, 135, 165, 170, 176, 186, 191, 214], "chang": [0, 1, 3, 7, 8, 12, 24, 26, 53, 65, 102, 107, 113, 116, 128, 135, 165, 170, 176, 186, 191, 214], "denomin": [0, 8, 53, 65, 165, 170, 176, 180, 186, 191, 214, 215], "folder": [0, 8, 53, 67, 214], "c": [0, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 53, 59, 60, 61, 65, 67, 72, 73, 74, 75, 76, 77, 78, 89, 112, 145, 175, 186, 214], "program": [0, 8, 53, 214], "4": [0, 5, 8, 43, 53, 60, 68, 86, 96, 116, 119, 125, 130, 150, 156, 160, 170, 181, 188, 193, 206, 207, 215], "one": [0, 4, 7, 8, 19, 22, 33, 39, 42, 45, 53, 57, 59, 61, 87, 88, 89, 92, 93, 94, 95, 100, 110, 112, 126, 127, 129, 134, 143, 145, 157, 158, 159, 164, 173, 175, 189, 190, 192, 197, 214], "enhanced_box_plot": [0, 4, 8], "enhanc": [0, 1, 8, 54], "rpm": [0, 8, 54, 61, 67, 76, 77, 85, 89, 215], "filter_biotype_from_ref_t": [0, 3, 4, 8, 186, 215], "lincrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "mirna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "ncrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "pirna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "rrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "snorna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "snrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "trna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "legal": [0, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 214], "defin": [0, 3, 4, 7, 8, 9, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 56, 57, 109, 110, 142, 143, 172, 173, 212, 213], "yaml": [0, 4, 8, 56, 109, 142, 172, 201, 202, 215], "instead": [0, 3, 4, 7, 8, 14, 15, 28, 29, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 199, 201, 214, 215], "anyth": [0, 1, 8, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 214], "BUT": [0, 8, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194], "expect": [0, 8, 19, 33, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 194, 214, 215], "whose": [0, 8, 56, 60, 61, 62, 63, 70, 74, 81, 107, 109, 114, 115, 116, 142, 146, 147, 170, 172, 177, 178, 214, 215], "13": [0, 8, 56, 86, 92, 109, 125, 142, 156, 172, 186, 188, 214, 215], "filter_by_attribut": [0, 3, 4, 8, 186, 215], "mode": [0, 4, 8, 57, 58, 59, 110, 111, 112, 143, 144, 145, 173, 174, 175], "where": [0, 3, 4, 8, 19, 33, 42, 43, 57, 59, 85, 110, 112, 143, 145, 173, 175, 211, 214, 215], "learn": [0, 7, 8, 57, 110, 143, 173, 214, 215], "genom": [0, 3, 7, 8, 9, 10, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 36, 37, 40, 45, 57, 58, 59, 99, 110, 111, 112, 133, 143, 144, 145, 163, 173, 174, 175, 186, 196, 205, 214, 215], "doe": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 57, 59, 67, 90, 110, 112, 143, 145, 165, 173, 175, 214, 215], "attribute1": [0, 8, 57, 87, 110, 126, 143, 157, 173, 186, 189, 215], "attr_ref_table_for_exampl": [0, 8, 57, 87, 110, 126, 143, 157, 173, 186, 189, 215], "7": [0, 1, 8, 57, 63, 68, 87, 88, 90, 110, 115, 119, 126, 127, 143, 147, 150, 157, 158, 173, 178, 181, 186, 189, 190, 214, 215], "OR": [0, 8, 57, 95, 110, 129, 143, 159, 173, 192], "attribute3": [0, 8, 57, 110, 143, 173, 215], "8": [0, 1, 4, 7, 8, 57, 68, 96, 110, 119, 130, 143, 150, 160, 173, 176, 181, 191, 193, 208, 214, 215], "AND": [0, 8, 57, 110, 143, 173], "19": [0, 8, 57, 90, 110, 143, 173, 215], "don": [0, 4, 6, 8, 57, 110, 143, 173, 214, 215], "t": [0, 4, 6, 8, 19, 20, 33, 34, 57, 95, 110, 129, 143, 159, 173, 192, 214, 215], "filter_by_kegg_annot": [0, 4, 8], "kegg_id": [0, 8, 59, 112, 145, 175], "organ": [0, 4, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214], "arabodopsi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "thaliana": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "caenorhabd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214, 215], "elegan": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214], "danio": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "rerio": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "drosophila": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "melanogast": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "escherichia": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "coli": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "homo": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "sapien": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "mu": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "musculu": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "saccharomyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "cerevisia": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "schizosaccharomyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "pomb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "gene_id_typ": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 215], "uniprotkb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 215], "ac": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniparc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref50": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref90": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref100": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "crc64": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ensembl": [0, 4, 8, 16, 18, 30, 32, 36, 37, 58, 59, 90, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 215], "protein": [0, 3, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 36, 37, 40, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 186, 196, 215], "geneid": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "kegg": [0, 4, 7, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214], "patric": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ucsc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "wbparasit": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "arachnoserv": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "araport": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "conoserv": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "dictybas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "echobas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "euhcvdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "flybas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genecard": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genereview": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "hgnc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "legiolist": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "leproma": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "maizegdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "mgi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "mim": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "nextprot": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "opentarget": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "orphanet": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pharmgkb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pombas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pseudocap": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "rgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "sgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "tuberculist": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "veupathdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "vgnc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "wormbas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214, 215], "xenbas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "zfin": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "eggnog": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genetre": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "hogenom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "oma": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214], "orthodb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "treefam": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ccd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "embl": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genbank": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ddbj": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cd": [0, 1, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "gi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pir": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "refseq": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "nucleotid": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "chitar": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genewiki": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genomernai": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "phi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "collectf": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "biocyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "plantreactom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "reactom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "unipathwai": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cptac": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "proteomicsdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pathwai": [0, 4, 7, 8, 18, 32, 37, 59, 112, 145, 175, 214], "specif": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 59, 112, 145, 165, 175, 186, 215], "would": [0, 1, 3, 4, 8, 59, 112, 145, 175, 214, 215], "cel04020": [0, 8, 59, 112, 145, 175], "calcium": [0, 8, 59, 112, 145, 175], "signal": [0, 8, 59, 112, 145, 175, 214, 215], "ncbi": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "taxon": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "fetch": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "go": [0, 4, 7, 8, 16, 18, 30, 32, 36, 37, 41, 59, 112, 145, 175, 214], "annot": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214], "identifi": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214], "featureset": [0, 3, 4, 8, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 42, 43, 59, 112, 145, 175], "rnacentr": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "entrez": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "server": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "attempt": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "map": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "full": [0, 6, 7, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 59, 67, 91, 92, 94, 102, 112, 136, 145, 165, 175, 186, 211, 214, 215], "uniprot": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "websit": [0, 1, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "http": [0, 1, 7, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 215], "www": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "org": [0, 7, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 215], "help": [0, 1, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "api_idmap": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "filter_by_row_sum": [0, 8], "threshold": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 60, 61, 71, 89, 91, 92, 107, 116, 121, 135, 152, 170, 183, 186, 214, 215], "sum": [0, 8, 60, 215], "belov": [0, 8, 60], "minim": [0, 4, 8, 60, 61, 89, 90, 92, 214, 215], "18": [0, 8, 60, 170, 215], "filter_low_read": [0, 8, 90, 91, 92, 93, 94, 215], "lowli": [0, 8, 61, 89], "rpkm": [0, 8, 61, 85, 89, 215], "tpm": [0, 8, 61, 85, 89, 214], "filter_missing_valu": [0, 4, 8, 199, 200, 203, 215], "miss": [0, 8, 62, 114, 146, 177, 214], "check": [0, 1, 8, 62, 114, 146, 177, 214], "filt": [0, 8, 62, 79, 97, 98, 114, 122, 131, 132, 146, 153, 161, 162, 177, 184, 194, 195], "test_deseq_with_nan": [0, 8, 62, 114, 146, 177, 200, 215], "filt_no_nan": [0, 8, 62, 114, 146, 177], "filt_no_nan_basemean": [0, 8, 62, 114, 146, 177], "27": [0, 5, 8, 62, 113, 114, 146, 177, 215], "filt_no_nan_basemean_pv": [0, 8, 62, 114, 146, 177], "pval": [0, 8, 62, 114, 146, 177, 186, 215], "filter_percentil": [0, 4, 8, 215], "entri": [0, 1, 8, 42, 43, 63, 115, 147, 178, 215], "abov": [0, 8, 63, 88, 92, 115, 127, 147, 158, 178, 190, 214, 215], "pvalu": [0, 8, 63, 68, 96, 115, 119, 130, 147, 150, 160, 178, 181, 193, 215], "wa": [0, 4, 7, 8, 45, 63, 67, 115, 147, 178, 203, 214, 215], "log2foldchang": [0, 8, 63, 68, 88, 96, 102, 113, 115, 118, 119, 127, 128, 130, 147, 150, 158, 160, 176, 178, 181, 190, 193, 215], "below": [0, 4, 8, 63, 88, 89, 91, 107, 115, 127, 147, 158, 170, 178, 190, 214, 215], "vuls": [0, 8, 63, 115, 147, 178], "filter_top_n": [0, 4, 8, 200, 215], "100": [0, 4, 8, 64, 71, 90, 91, 92, 93, 94, 117, 121, 148, 152, 179, 183, 214, 215], "how": [0, 1, 5, 8, 15, 16, 18, 23, 29, 30, 32, 40, 64, 117, 148, 179, 186, 214], "mani": [0, 1, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 64, 117, 148, 179, 186, 214, 215], "highest": [0, 8, 64, 117, 148, 179, 214], "lowest": [0, 8, 64, 117, 148, 179, 214], "fold_chang": [0, 4, 8, 215], "numer_nam": [0, 8, 65], "denom_nam": [0, 8, 65], "foldchangefilt": [0, 3, 8, 65, 198, 200], "give": [0, 4, 8, 65, 74, 214], "generar": [0, 8, 65], "counted_fold_chang": [0, 8, 65, 215], "cond1_rep1": [0, 8, 65, 215], "cond1_rep2": [0, 8, 65, 215], "cond2_rep1": [0, 8, 65, 215], "cond_2rep2": [0, 8, 65], "f": [0, 7, 8, 16, 30, 36, 65, 170, 176, 186, 191, 215], "cond2_rep2": [0, 8, 65, 215], "classmethod": [0, 8, 66, 67, 118, 149, 180, 202], "from_fold": [0, 4, 8, 215], "folder_path": [0, 8, 67], "norm_to_rpm": [0, 8, 67, 215], "save_csv": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 67, 186, 215], "counted_fnam": [0, 8, 67, 215], "uncounted_fnam": [0, 8, 67, 215], "input_format": [0, 8, 67], "txt": [0, 4, 8, 20, 34, 67], "over": [0, 4, 8, 15, 16, 29, 30, 67, 89, 215], "htseq": [0, 7, 8, 67, 77], "combin": [0, 8, 16, 30, 36, 67, 90, 214, 215], "them": [0, 1, 4, 8, 10, 24, 67, 214, 215], "uncount": [0, 8, 67, 77, 215], "million": [0, 4, 8, 67, 76, 77, 82, 214, 215], "note": [0, 8, 16, 18, 23, 30, 32, 40, 67, 214, 215], "alwai": [0, 1, 8, 67, 214, 215], "regardless": [0, 8, 67, 214], "htcount": [0, 8, 67], "defualt": [0, 8, 67], "fill": [0, 8, 67], "joint": [0, 8, 67], "unalign": [0, 8, 67, 215], "align": [0, 8, 67, 77, 92, 214, 215], "uniqu": [0, 8, 67], "under": [0, 4, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 67, 82, 186, 214, 215], "need": [0, 8, 67, 89, 214, 215], "test_count_from_fold": [0, 8, 67, 215], "name_for_reads_csv_fil": [0, 8, 67, 215], "name_for_uncounted_reads_csv_fil": [0, 8, 67, 215], "head": [0, 8, 86, 125, 156, 188, 215], "posit": [0, 8, 15, 29, 68, 96, 113, 119, 128, 130, 150, 160, 176, 181, 191, 193, 214, 215], "6820": [0, 8, 68, 119, 150, 181, 215], "755327": [0, 8, 68, 119, 150, 181, 215], "567762": [0, 8, 68, 119, 150, 181, 215], "000000e": [0, 8, 68, 119, 150, 181, 215], "00": [0, 8, 68, 90, 119, 150, 181, 215], "3049": [0, 8, 68, 119, 150, 181, 215], "625670": [0, 8, 68, 119, 150, 181, 215], "138071": [0, 8, 68, 119, 150, 181, 215], "660000e": [0, 8, 68, 119, 150, 181, 215], "280000e": [0, 8, 68, 119, 150, 181, 215], "298": [0, 8, 68, 119, 150, 181, 215], "wbgene00000004": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 68, 71, 95, 100, 119, 121, 129, 134, 150, 152, 159, 164, 181, 183, 192, 197, 215], "1432": [0, 8, 68, 119, 150, 181, 215], "911791": [0, 8, 68, 119, 150, 181, 215], "111737": [0, 8, 68, 119, 150, 181, 215], "400000e": [0, 8, 68, 96, 119, 130, 150, 160, 181, 193, 215], "237": [0, 8, 68, 119, 150, 181, 215], "920000e": [0, 8, 68, 119, 150, 181, 215], "233": [0, 8, 68, 119, 150, 181, 215], "wbgene00000005": [0, 8, 22, 39, 68, 95, 100, 119, 129, 134, 150, 159, 164, 181, 192, 197, 215], "4028": [0, 8, 68, 119, 150, 181, 215], "154186": [0, 8, 68, 119, 150, 181, 215], "534112": [0, 8, 68, 119, 150, 181, 215], "700000e": [0, 8, 68, 96, 119, 130, 150, 160, 181, 193, 215], "228": [0, 8, 68, 119, 150, 181, 215], "225": [0, 8, 68, 119, 150, 181, 215], "wbgene00000006": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 68, 95, 100, 119, 129, 134, 150, 159, 164, 181, 192, 197, 215], "1230": [0, 8, 68, 119, 150, 181, 215], "585240": [0, 8, 68, 119, 150, 181, 215], "157428": [0, 8, 68, 119, 150, 181, 215], "216": [0, 8, 68, 92, 119, 150, 181, 215], "590000e": [0, 8, 68, 119, 150, 181, 215], "213": [0, 8, 68, 119, 150, 181, 215], "duplic": [0, 8], "appear": [0, 4, 8, 13, 14, 15, 16, 18, 21, 23, 27, 28, 29, 30, 32, 35, 36, 37, 38, 40, 41, 71, 121, 152, 183, 206, 207, 208, 214, 215], "than": [0, 8, 15, 16, 18, 19, 23, 29, 30, 32, 33, 40, 74, 79, 107, 122, 153, 170, 184, 186, 199, 214, 215], "onc": [0, 6, 8, 90, 214, 215], "correspond": [0, 3, 8, 78, 85, 87, 90, 91, 92, 93, 94, 126, 157, 189, 215], "index": [0, 4, 5, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 72, 208, 214], "myset": [0, 8], "nwbgene00000003": [0, 8], "nwbgene12345678": [0, 8], "mystr": [0, 8], "ma_plot": [0, 4, 8], "ref_column": [0, 8, 70, 74], "split_plot": [0, 8, 70, 82, 90, 91, 92, 93, 94], "ma": [0, 4, 8, 70], "chosen": [0, 8, 70, 74, 215], "upper": [0, 8, 70, 74, 215], "quartil": [0, 8, 70, 74], "closest": [0, 8, 70, 74], "own": [0, 8, 42, 43, 70, 82, 90, 91, 92, 93, 94, 214, 215], "figur": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 70, 81, 82, 85, 90, 91, 92, 93, 94, 135, 214, 215], "majority_vote_intersect": [0, 4, 8], "majority_threshold": [0, 8, 71, 121, 152, 183], "majority_threhold": [0, 4, 8, 71, 121, 152, 183], "major": [0, 1, 8, 71, 121, 152, 183, 214], "vote": [0, 8, 71, 121, 152, 183, 214], "equival": [0, 8, 21, 38, 71, 121, 152, 183], "uphold": [0, 8, 71, 121, 152, 183], "b_set": [0, 8, 71, 121, 152, 183], "normalize_median_of_ratio": [0, 8], "reference_group": [0, 8, 72], "ratio": [0, 4, 8, 72, 73, 214, 215], "mrn": [0, 4, 8, 72, 215], "maza": [0, 8, 72], "et": [0, 4, 7, 8, 16, 30, 36, 72, 75, 214], "al": [0, 4, 7, 8, 16, 30, 36, 72, 75, 214], "2013": [0, 8, 72], "those": [0, 8, 72, 75, 90, 91, 92, 93, 94, 205, 214, 215], "pick": [0, 8, 15, 16, 29, 30, 72, 73, 91, 92, 93, 94, 214, 215], "multipli": [0, 8, 72, 74], "total": [0, 8, 42, 43, 72, 75, 76, 77, 215], "final": [0, 5, 8, 72, 74, 93, 94, 215], "adjust": [0, 8, 72, 74, 102, 116, 214, 215], "symmetri": [0, 8, 72, 74], "integ": [0, 4, 8, 15, 16, 29, 30, 72], "normalize_rl": [0, 8, 215], "rel": [0, 4, 8, 16, 30, 36, 73, 214, 215], "rle": [0, 4, 8, 73, 215], "ander": [0, 7, 8, 73], "huber": [0, 7, 8, 73], "2010": [0, 8, 73, 74, 75, 93], "pseudo": [0, 8, 73], "geometr": [0, 8, 73], "across": [0, 4, 8, 73, 214, 215], "wise": [0, 8, 73, 214], "normalize_tmm": [0, 8, 215], "log_ratio_trim": [0, 8, 74], "sum_trim": [0, 8, 74], "05": [0, 5, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 74, 186], "a_cutoff": [0, 8, 74], "10000000000": [0, 8, 74], "trim": [0, 4, 7, 8, 74, 215], "m": [0, 1, 4, 7, 8, 14, 16, 28, 30, 36, 74, 215], "tmm": [0, 4, 8, 74, 215], "robinson": [0, 8, 74], "oshlack": [0, 8, 74], "edger": [0, 8, 74, 215], "log2": [0, 4, 8, 74, 80, 98, 102, 107, 113, 128, 132, 135, 162, 165, 170, 176, 191, 195, 214, 215], "minu": [0, 8, 74], "extrem": [0, 8, 74, 214], "non": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 74, 88, 89, 90, 91, 92, 93, 94, 113, 127, 128, 135, 158, 176, 190, 191, 214], "bottom": [0, 8, 74, 214, 215], "smaller": [0, 8, 74, 214, 215], "cutuff": [0, 8, 74], "avoid": [0, 8, 74, 215], "inf": [0, 8, 74, 165, 215], "next": [0, 8, 74, 214, 215], "being": [0, 4, 8, 74, 91, 214, 215], "invers": [0, 8, 74, 214], "approxim": [0, 8, 74], "fraction": [0, 8, 74, 214], "direct": [0, 8, 74, 113, 128, 176, 191, 214, 215], "1e10": [0, 8, 74], "lower": [0, 4, 8, 74, 107, 170, 214], "bound": [0, 8, 74], "normalize_to_quantil": [0, 8], "quantil": [0, 4, 8, 75, 215], "bullard": [0, 8, 75], "limma": [0, 8, 75, 215], "divid": [0, 8, 75, 76, 77, 78, 90, 214, 215], "yield": [0, 8, 75], "normalize_to_rpm": [0, 4, 8, 215], "normalize_to_rpm_htseqcount": [0, 4, 8, 215], "special_counter_fnam": [0, 8, 77], "ambigu": [0, 8, 77, 215], "rna": [0, 5, 7, 8, 45, 77, 215], "librari": [0, 4, 8, 45, 77, 78, 214], "normalize_with_scaling_factor": [0, 4, 8, 215], "scaling_factor_fnam": [0, 8, 78], "pre": [0, 7, 8, 45, 78, 214], "scaling_factor": [0, 8, 78, 215], "number_filt": [0, 8, 199, 215], "greater": [0, 6, 7, 8, 79, 122, 153, 184, 199, 215], "equal": [0, 8, 79, 88, 97, 122, 127, 131, 153, 158, 161, 184, 190, 194], "lesser": [0, 8, 79, 122, 153, 184, 214], "applai": [0, 8, 79, 97, 122, 131, 153, 161, 184, 194], "particular": [0, 4, 7, 8, 15, 16, 29, 30, 79, 97, 122, 131, 153, 161, 184, 194, 214, 215], "gt": [0, 8, 79, 122, 153, 184, 215], "eq": [0, 8, 79, 97, 122, 131, 153, 161, 184, 194], "lt": [0, 8, 79, 122, 153, 184], "5900": [0, 8, 79, 122, 153, 184], "pairplot": [0, 4, 8, 215], "show_corr": [0, 8, 80], "pairgrid": [0, 8, 80], "pairwis": [0, 8, 80, 214, 215], "relationship": [0, 7, 8, 80, 214, 215], "pseudocount": [0, 4, 8, 80], "raw": [0, 8, 45, 80, 214], "spearman": [0, 8, 80, 90, 91, 92, 94, 214, 215], "coeffici": [0, 8, 80], "pair": [0, 4, 8, 80, 90, 92, 214, 215], "n_compon": [0, 8, 81, 214], "power_transform": [0, 8, 81, 90, 91, 92, 93, 94, 214], "princip": [0, 4, 8, 81, 215], "compon": [0, 4, 8, 16, 30, 36, 81, 215], "most": [0, 3, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 81, 91, 214, 215], "sklearn": [0, 8, 81], "decomposit": [0, 8, 81], "plot_express": [0, 4, 8, 215], "count_unit": [0, 8, 82], "standard": [0, 8, 82, 98, 132, 162, 195, 214], "error": [0, 4, 8, 82, 214, 215], "unit": [0, 8, 82, 214], "Will": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 82, 186], "displai": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 82, 214, 215], "print_featur": [0, 8], "alt_filenam": [0, 8, 84, 124, 155, 187], "myfilenam": [0, 8, 84, 124, 155, 187], "scatter_sample_vs_sampl": [0, 4, 8], "xlabel": [0, 8, 85], "highlight": [0, 4, 8, 85, 214], "avarg": [0, 8, 85], "point": [0, 4, 8, 85, 91, 92, 94, 135, 214, 215], "red": [0, 8, 85, 135], "633": [0, 8, 86, 125, 156, 188, 215], "451": [0, 8, 86, 125, 156, 188, 215], "365": [0, 8, 86, 96, 125, 130, 156, 160, 188, 193, 215], "388": [0, 8, 86, 125, 156, 188, 215], "55": [0, 8, 86, 125, 156, 188, 215], "266": [0, 8, 86, 125, 156, 188, 215], "46": [0, 8, 86, 125, 156, 188, 215], "39": [0, 8, 86, 125, 156, 188, 215], "split_by_attribut": [0, 4, 8], "attribute2": [0, 8, 87, 126, 157, 189, 215], "split_by_percentil": [0, 8], "overlap": [0, 8, 19, 33, 88, 89, 90, 91, 92, 93, 94, 127, 128, 158, 190, 191, 214, 215], "specfieid": [0, 8, 88, 127, 158, 190], "split_by_read": [0, 8], "maximum": [0, 8, 89, 92, 93, 94], "highli": [0, 4, 8, 89, 214], "ha": [0, 8, 89, 128, 191, 214, 215], "low_express": [0, 8, 89], "high_express": [0, 8, 89], "split_clicom": [0, 4, 8], "parameter_dict": [0, 8, 90], "dict": [0, 4, 8, 42, 43, 90, 200], "replicate_group": [0, 8, 90], "ungroup": [0, 8, 90], "evidence_threshold": [0, 8, 90, 214, 215], "6666666666666666": [0, 8, 90], "cluster_unclustered_featur": [0, 8, 90, 214, 215], "min_cluster_s": [0, 8, 90, 91, 214, 215], "plot_styl": [0, 8, 19, 33, 90, 91, 92, 93, 94, 215], "std_area": [0, 8, 90, 91, 92, 93, 94, 215], "std_bar": [0, 8, 90, 91, 92, 93, 94, 215], "gui_mod": [0, 8, 16, 18, 19, 23, 30, 32, 33, 35, 36, 37, 40, 90, 91, 92, 93, 94], "clicom": [0, 4, 8, 90], "mimaroglu": [0, 4, 8, 90], "yagci": [0, 4, 8, 90], "2012": [0, 4, 8, 90], "incorpor": [0, 8, 90, 214, 215], "solut": [0, 8, 90, 214, 215], "come": [0, 8, 90, 214, 215], "due": [0, 8, 90, 215], "natur": [0, 8, 90, 199, 214], "classifi": [0, 8, 90, 91, 214, 215], "nois": [0, 8, 90, 91, 214, 215], "discov": [0, 7, 8, 90, 91, 92, 93, 94, 214, 215], "setup": [0, 1, 6, 8, 90, 214], "influenc": [0, 8, 90, 214, 215], "batch": [0, 4, 8, 90, 214, 215], "effect": [0, 8, 90, 214, 215], "advantag": [0, 8, 90, 214, 215], "repeat": [0, 8, 15, 29, 90, 214], "measur": [0, 8, 90, 214, 215], "improv": [0, 4, 7, 8, 90], "accuraci": [0, 8, 90, 214, 215], "theori": [0, 8, 90], "behind": [0, 8, 90], "public": [0, 6, 8, 90, 214, 215], "doi": [0, 7, 8, 90, 215], "1093": [0, 8, 90], "bib": [0, 8, 90], "bbs057": [0, 8, 90], "power": [0, 4, 8, 90, 91, 92, 93, 94, 214, 215], "transform": [0, 4, 8, 90, 91, 92, 93, 94, 214, 215], "cox": [0, 8, 90, 91, 92, 93, 94, 98, 132, 162, 195, 214], "prior": [0, 4, 8, 90, 91, 92, 93, 94], "initi": [0, 8, 15, 16, 29, 30, 90, 93, 94], "twice": [0, 8, 90], "reliabl": [0, 8, 90], "togeth": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 43, 90, 214, 215], "consid": [0, 4, 8, 90, 91, 214, 215], "forc": [0, 8, 90, 214, 215], "part": [0, 1, 8, 90, 214, 215], "even": [0, 1, 4, 8, 90], "larger": [0, 8, 15, 16, 18, 19, 23, 29, 30, 32, 33, 40, 90, 91, 186, 214, 215], "fewer": [0, 8, 90, 91, 214, 215], "minimum": [0, 8, 35, 36, 37, 90, 91, 214, 215], "seek": [0, 8, 90, 91, 92, 93, 94], "dictionari": [0, 8, 42, 43, 90, 200, 215], "field": [0, 8, 90, 214], "support": [0, 1, 3, 4, 7, 8, 16, 18, 23, 30, 32, 40, 90, 91, 92, 94, 165, 199, 214, 215], "k": [0, 4, 8, 90, 93, 94], "medoid": [0, 4, 8, 90, 93, 94], "hdbscan": [0, 4, 7, 8, 90, 91], "prefer": [0, 4, 8, 90, 214, 215], "yoi": [0, 8, 90], "n_cluster": [0, 8, 90, 92, 93, 94, 214, 215], "cosin": [0, 8, 90, 91, 92, 94, 215], "four": [0, 8, 90], "time": [0, 4, 5, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 90, 93, 94], "style": [0, 4, 8, 43, 90, 91, 92, 93, 94, 214, 215], "dev_stag": [0, 8, 90, 91, 92, 93, 94], "elegans_developmental_stag": [0, 8, 90, 91, 92, 93, 94], "tsv": [0, 4, 8, 90, 91, 92, 93, 94, 214], "44072": [0, 8, 90, 91, 92, 93, 94], "2326": [0, 8, 90, 91, 92, 93, 94], "46398": [0, 8, 90, 91, 92, 93, 94], "140": [0, 8, 90, 93], "ys1": [0, 8, 90, 91, 92, 94, 215], "yr1": [0, 8, 90, 91, 92, 94, 214, 215], "jackknif": [0, 8, 90, 91, 92, 94, 214, 215], "kmedoid": [0, 8, 90], "found": [0, 8, 90, 91, 214], "49": [0, 8, 90], "similar": [0, 4, 8, 90, 91, 92, 94, 215], "32": [0, 8, 90, 215], "651": [0, 8, 90], "06it": [0, 8, 90], "find": [0, 7, 8, 90, 91, 214, 215], "cliqu": [0, 8, 90], "42436": [0, 8, 90], "61385": [0, 8, 90], "87it": [0, 8, 90], "153": [0, 8, 90, 91], "unclust": [0, 8, 90, 91, 214, 215], "95": [0, 8, 90], "1864": [0, 8, 90], "462": [0, 8, 90], "2115": [0, 8, 90], "211": [0, 8, 90], "2122": [0, 8, 90, 91], "204": [0, 8, 90, 91], "2123": [0, 8, 90], "203": [0, 8, 90], "2128": [0, 8, 90], "198": [0, 8, 90], "2167": [0, 8, 90], "159": [0, 8, 90], "2179": [0, 8, 90], "147": [0, 8, 90], "2200": [0, 8, 90, 91, 93], "126": [0, 8, 90, 91, 93], "2204": [0, 8, 90], "122": [0, 8, 90], "2229": [0, 8, 90, 94], "97": [0, 8, 90, 94, 96, 130, 160, 193, 215], "2234": [0, 8, 90, 91], "92": [0, 8, 90, 91], "2238": [0, 8, 90, 91, 92], "88": [0, 8, 90, 91, 92], "2241": [0, 8, 90, 91, 93], "85": [0, 8, 90, 91, 93], "2263": [0, 8, 90], "63": [0, 8, 90], "2279": [0, 8, 90], "47": [0, 8, 90], "split_hdbscan": [0, 4, 8], "min_sampl": [0, 8, 91], "pearson": [0, 8, 91, 92, 94, 215], "manhattan": [0, 8, 91, 92, 94, 215], "l1": [0, 8, 91, 92, 94, 214, 215], "l2": [0, 8, 91, 92, 94, 215], "cluster_selection_epsilon": [0, 8, 91], "cluster_selection_method": [0, 8, 91], "eom": [0, 8, 91], "leaf": [0, 8, 91], "return_prob": [0, 8, 91], "ndarrai": [0, 8, 24, 91], "neighbourhood": [0, 8, 91], "core": [0, 8, 91], "higher": [0, 8, 15, 29, 91, 186, 214, 215], "conserv": [0, 8, 15, 29, 91], "merg": [0, 8, 91, 92, 214, 215], "select": [0, 8, 91, 214, 215], "condens": [0, 8, 91], "tree": [0, 8, 16, 30, 36, 91, 214, 215], "excess": [0, 8, 91], "mass": [0, 8, 91], "persist": [0, 8, 91], "fine": [0, 8, 91], "grain": [0, 8, 91, 214], "homogen": [0, 8, 91], "arrai": [0, 8, 91, 214, 215], "probabl": [0, 8, 14, 28, 91, 214, 215], "assign": [0, 8, 91], "categor": [0, 4, 8, 19, 33, 91, 214], "otherswis": [0, 8, 91], "141": [0, 8, 91, 93], "344": [0, 8, 91], "79": [0, 8, 91], "2019": [0, 5, 8, 91], "307": [0, 8, 91], "2146": [0, 8, 91], "180": [0, 8, 91], "2168": [0, 8, 91], "158": [0, 8, 91], "2173": [0, 8, 91], "2176": [0, 8, 91], "150": [0, 8, 91, 214], "2183": [0, 8, 91], "143": [0, 8, 91], "2192": [0, 8, 91, 94], "134": [0, 8, 91, 94], "2244": [0, 8, 91], "2246": [0, 8, 91, 92], "split_hierarch": [0, 4, 8], "gap": [0, 8, 92, 93, 94, 214, 215], "silhouett": [0, 8, 92, 93, 94, 214, 215], "distance_threshold": [0, 8, 92], "max_n_clusters_estim": [0, 8, 92, 93, 94], "slihouett": [0, 8, 92, 93, 94], "deriv": [0, 8, 92, 215], "accept": [0, 4, 8, 92, 215], "criterion": [0, 8, 92, 214, 215], "observ": [0, 8, 92, 186, 214, 215], "try": [0, 4, 8, 92, 93, 94, 214], "optim": [0, 7, 8, 92, 93, 94, 214, 215], "appropri": [0, 8, 92, 93, 94, 214, 215], "1718": [0, 8, 92], "608": [0, 8, 92], "1979": [0, 8, 92], "347": [0, 8, 92], "2094": [0, 8, 92], "232": [0, 8, 92], "2110": [0, 8, 92], "2156": [0, 8, 92], "170": [0, 8, 92], "2191": [0, 8, 92], "135": [0, 8, 92], "2195": [0, 8, 92], "131": [0, 8, 92], "2223": [0, 8, 92], "103": [0, 8, 92], "2224": [0, 8, 92], "102": [0, 8, 92], "2252": [0, 8, 92, 94], "74": [0, 8, 92, 94, 96, 130, 160, 193, 215], "2286": [0, 8, 92], "center": [0, 8, 41, 92, 214, 215], "split_kmean": [0, 4, 8, 215], "n_init": [0, 8, 93, 94], "max_it": [0, 8, 93, 94], "300": [0, 8, 93, 94], "random_se": [0, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 93, 94, 186, 214, 215], "random": [0, 4, 7, 8, 15, 16, 18, 23, 29, 30, 32, 40, 93, 94, 186, 214], "make": [0, 1, 4, 8, 93, 94, 214], "determinist": [0, 8, 93, 94, 214], "seed": [0, 8, 15, 16, 29, 30, 93, 94, 214, 215], "best": [0, 1, 8, 93, 94, 215], "consecut": [0, 8, 93, 94], "term": [0, 3, 4, 7, 8, 16, 30, 36, 41, 93, 94, 214], "inertia": [0, 8, 93, 94], "1801": [0, 8, 93], "525": [0, 7, 8, 93], "316": [0, 8, 93], "2059": [0, 8, 93], "267": [0, 8, 93], "2102": [0, 8, 93], "224": [0, 8, 93], "2185": [0, 8, 93], "2186": [0, 8, 93], "2219": [0, 8, 93], "107": [0, 8, 93], "2225": [0, 8, 93], "101": [0, 8, 93], "2250": [0, 8, 93], "76": [0, 8, 93], "2259": [0, 8, 93], "67": [0, 8, 93], "2276": [0, 8, 93], "split_kmedoid": [0, 4, 8], "1967": [0, 8, 94], "359": [0, 8, 94], "2020": [0, 5, 8, 94], "306": [0, 8, 94], "2071": [0, 8, 94], "255": [0, 8, 94], "2131": [0, 8, 94], "195": [0, 8, 94], "2145": [0, 8, 94], "181": [0, 8, 94], "2157": [0, 8, 94], "169": [0, 8, 94], "2159": [0, 8, 94], "167": [0, 8, 94], "2182": [0, 8, 94], "144": [0, 8, 94], "2190": [0, 8, 94], "136": [0, 8, 94], "2268": [0, 8, 94], "58": [0, 8, 94], "2275": [0, 8, 94], "51": [0, 8, 94], "wbgene00000017": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000024": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000010": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000020": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000029": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000019": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000023": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000025": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000014": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000027": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000021": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000012": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000026": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000007": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000008": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000013": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000011": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000015": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000018": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000016": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000028": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000022": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000009": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "tail": [0, 8, 215], "2236": [0, 8, 96, 130, 160, 193, 215], "185837": [0, 8, 96, 130, 160, 193, 215], "477374": [0, 8, 96, 130, 160, 193, 215], "910000e": [0, 8, 96, 130, 160, 193, 215], "81": [0, 8, 96, 130, 160, 193, 215], "460000e": [0, 8, 96, 130, 160, 193, 215], "78": [0, 8, 96, 130, 160, 193, 215], "343": [0, 8, 96, 130, 160, 193, 215], "648987": [0, 8, 96, 130, 160, 193, 215], "037191": [0, 8, 96, 130, 160, 193, 215], "320000e": [0, 8, 96, 130, 160, 193, 215], "72": [0, 8, 96, 130, 160, 193, 215], "175": [0, 8, 96, 130, 160, 193, 215], "142856": [0, 8, 96, 130, 160, 193, 215], "352044": [0, 8, 96, 130, 160, 193, 215], "580000e": [0, 8, 96, 130, 160, 193, 215], "120000e": [0, 8, 96, 130, 160, 193, 215], "71": [0, 8, 96, 130, 160, 193, 215], "219": [0, 8, 96, 130, 160, 193, 215], "163200": [0, 8, 96, 130, 160, 193, 215], "913657": [0, 8, 96, 130, 160, 193, 215], "420000e": [0, 8, 96, 130, 160, 193, 215], "69": [0, 8, 96, 130, 160, 193, 215], "1066": [0, 8, 96, 130, 160, 193, 215], "242402": [0, 8, 96, 130, 160, 193, 215], "811281": [0, 8, 96, 130, 160, 193, 215], "813048": [0, 8, 96, 130, 160, 193, 215], "101303": [0, 8, 96, 130, 160, 193, 215], "740000e": [0, 8, 96, 130, 160, 193, 215], "3168": [0, 8, 96, 130, 160, 193, 215], "566714": [0, 8, 96, 130, 160, 193, 215], "906719": [0, 8, 96, 130, 160, 193, 215], "600000e": [0, 8, 96, 130, 160, 193, 215], "93": [0, 8, 96, 130, 160, 193, 215], "340000e": [0, 8, 96, 130, 160, 193, 215], "221": [0, 8, 96, 130, 160, 193, 215], "925724": [0, 8, 96, 130, 160, 193, 215], "801676": [0, 8, 96, 130, 160, 193, 215], "230000e": [0, 8, 96, 130, 160, 193, 215], "84": [0, 8, 96, 130, 160, 193, 215], "820000e": [0, 8, 96, 130, 160, 193, 215], "text_filt": [0, 8], "start": [0, 4, 8, 97, 131, 161, 194, 214, 215], "text": [0, 8, 43, 97, 131, 161, 194, 215], "ct": [0, 8, 97, 131, 161, 194], "sw": [0, 8, 97, 131, 161, 194], "ew": [0, 8, 97, 131, 161, 194], "ac3": [0, 8, 97, 131, 161, 194], "17": [0, 7, 8, 97, 131, 161, 194, 215], "ln": [0, 8, 98, 132, 162, 195, 214], "callabl": [0, 8, 98, 132, 162, 195], "function_kwarg": [0, 8, 98, 132, 162, 195], "logx": [0, 8, 98, 132, 162, 195], "taken": [0, 8, 98, 132, 162, 195, 215], "filt_log10": [0, 8, 98, 132, 162, 195], "lambda": [0, 8, 98, 132, 162, 195], "violin_plot": [0, 4, 8], "log_10": [0, 8, 101], "insid": [0, 7, 8, 101], "log2fc_col": [0, 8, 102, 118, 215], "padj_col": [0, 8, 102, 118, 215], "suppress_warn": [0, 8, 66, 102, 118, 165, 180], "deseq": [0, 8, 102, 136], "filter_abs_log2_fold_chang": [0, 8, 215], "abslog2fc": [0, 8, 107, 170], "log2fc": [0, 8, 107, 170], "went": [0, 8, 107, 170], "up": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 107, 135, 170, 214, 215], "less": [0, 8, 14, 28, 107, 170, 214, 215], "down": [0, 8, 107, 135, 170, 214, 215], "sample_deseq": [0, 8, 107, 113, 116], "29": [0, 8, 107, 113, 116], "filter_fold_change_direct": [0, 8, 215], "po": [0, 8, 113, 128, 176], "neg": [0, 8, 15, 16, 29, 30, 113, 128, 135, 176, 191, 214, 215], "filter_signific": [0, 8, 215], "alpha": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 116, 135, 186], "did": [0, 8, 116, 214, 215], "significantli": [0, 8, 116, 135, 186, 214, 215], "signific": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 116, 135, 186, 214, 215], "p": [0, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 102, 116, 135, 186, 214, 215], "split_fold_change_direct": [0, 8, 215], "filteirng": [0, 8, 128], "volcano_plot": [0, 8, 215], "log2fc_threshold": [0, 8, 135], "volcano": [0, 8, 135, 214], "adj": [0, 8, 135], "upregul": [0, 8, 135, 214, 215], "downregul": [0, 8, 135, 214], "blue": [0, 8, 135, 214], "paint": [0, 8, 135], "regul": [0, 8, 135, 214, 215], "numerator_nam": [0, 8, 165, 180], "denominator_nam": [0, 8, 165, 180], "repres": [0, 3, 8, 165, 214, 215], "could": [0, 1, 8, 165, 214, 215], "incorrect": [0, 8, 165], "fc_1": [0, 8, 170, 176, 186, 191, 215], "randomization_test": [0, 8, 215], "rep": [0, 8, 15, 29, 186], "10000": [0, 8, 15, 16, 18, 23, 29, 30, 32, 40, 186], "examin": [0, 8, 186], "background": [0, 3, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "score": [0, 8, 14, 16, 18, 23, 28, 30, 32, 40, 41, 186, 214, 215], "repetit": [0, 8, 15, 29, 186, 215], "000": [0, 8, 15, 29, 186, 215], "dir": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "No": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "requir": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 214, 215], "request": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 215], "prompt": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 214, 215], "f_background": [0, 8, 186, 215], "code": [0, 3, 4, 5, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 36, 40, 186, 214], "f_test": [0, 8, 186, 215], "rand_test_r": [0, 8, 186, 215], "806873": [0, 8, 186, 215], "360264": [0, 8, 186, 215], "ignor": [0, 8, 191, 215], "pos_log2fc": [0, 8, 191], "neg_log2fc": [0, 8, 191], "pipelin": [0, 3, 4, 7, 8], "filter_typ": [0, 8, 198, 200, 215], "collect": [0, 8, 198], "sequenti": [0, 8, 198, 200, 214], "_apply_filter_norm_sort": 0, "func": [0, 8, 199], "filter_object": [0, 8, 200], "arg": [0, 8, 199], "_apply_oth": 0, "other_output": 0, "other_cnt": 0, "counter": [0, 215], "alreadi": [0, 4, 45, 214], "call": [0, 4, 7, 214, 215], "_apply_split": 0, "_func_signatur": 0, "signatur": [0, 4], "_param_str": 0, "argumentss": 0, "add_funct": [0, 8, 200, 203, 215], "correspod": [0, 8, 199], "columnnam": [0, 8, 199], "virtual": [0, 8, 199], "apply_to": [0, 4, 8, 199, 215], "unkeyword": [0, 8, 199], "pipe": [0, 8, 198, 199, 200, 203, 215], "col1": [0, 8, 199], "ident": [0, 8, 200, 214], "noth": [0, 8, 200], "load": [0, 3, 4, 8, 45, 102, 136, 165, 200, 214], "d_filter": [0, 8, 200, 215], "export_pipelin": [0, 8], "export": [0, 4, 8, 201, 214], "import_pipelin": [0, 8], "remove_last_funct": [0, 8, 215], "These": [0, 8, 9, 214], "ontologi": [0, 4, 7, 8, 9, 16, 30, 36, 214, 215], "tissu": [0, 8, 9, 214], "phenotyp": [0, 8, 9], "gene_set": [0, 8, 10, 24, 215], "set_nam": [0, 4, 8, 10, 12, 24, 26, 215], "preform": [0, 8, 10, 24], "self": 0, "anoth": [0, 4, 102, 214, 215], "en": [0, 8, 11, 13, 17, 21, 22, 25, 27, 31, 38, 39, 215], "change_set_nam": [0, 4, 8], "new_nam": [0, 8, 12, 26], "rankedset": [0, 3, 4, 8, 13, 17, 21], "against": [0, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 38, 39, 40, 215], "compar": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 215], "en2": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39], "enrich_hypergeometr": [0, 4, 8, 215], "background_gen": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 215], "attr_ref_path": [0, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 215], "biotype_ref_path": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40], "return_nonsignific": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214], "return_fig": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 215], "plot_horizont": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "parallel": [0, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214], "deprac": [0, 8, 14, 15, 28, 29], "pleas": [0, 1, 7, 8, 14, 15, 28, 29], "user_defined_enrich": [0, 4, 8, 14, 15, 28, 29], "deplet": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 215], "hypergeometr": [0, 4, 8, 14, 16, 18, 23, 28, 30, 32, 35, 36, 37, 40, 214, 215], "variabl": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 214, 215], "success": [0, 8, 14, 15, 28, 29, 215], "we": [0, 8, 14, 28, 215], "randomli": [0, 4, 8, 14, 28, 215], "replac": [0, 4, 8, 14, 28, 215], "case": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214, 215], "correct": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "benjamini": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "hochberg": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "step": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 214], "procedur": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 214], "fdr": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "In": [0, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214, 215], "clariti": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41], "linear": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 215], "smallest": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 214, 215], "rais": [0, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40], "cannot": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 214, 215], "ones": [0, 8, 14, 15, 18, 23, 28, 29, 32, 35, 40], "horizont": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "bar": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 214, 215], "vertic": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "process": [0, 6, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214, 215], "shorter": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214], "return_figur": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40], "enrich_random": [0, 4, 8, 41, 215], "bias": [0, 8, 15, 29], "estim": [0, 7, 8, 15, 29, 214, 215], "real": [0, 8, 15, 29, 214, 215], "approach": [0, 8, 15, 29, 215], "infin": [0, 8, 15, 29], "unbias": [0, 8, 15, 29], "pseudorandom": [0, 8, 15, 16, 29, 30], "By": [0, 8, 15, 16, 29, 30, 214, 215], "get": [0, 7, 8, 15, 16, 29, 30, 214, 215], "consist": [0, 4, 8, 15, 16, 29, 30, 206, 207, 214, 215], "go_enrich": [0, 4, 8, 215], "statistical_test": [0, 8, 16, 18, 23, 30, 32, 40, 215], "fisher": [0, 8, 16, 18, 23, 30, 32, 40, 215], "propagate_annot": [0, 8, 16, 30, 36, 58, 111, 144, 174], "classic": [0, 8, 16, 30, 36, 215], "elim": [0, 8, 16, 30, 36, 215], "aspect": [0, 4, 8, 16, 30, 36, 214], "biological_process": [0, 8, 16, 30, 36], "molecular": [0, 8, 16, 30, 36, 214, 215], "cellular": [0, 8, 16, 30, 36, 214, 215], "evidence_typ": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "phylogenet": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "author": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "curat": [0, 8, 16, 18, 30, 32, 36, 37, 58, 111, 144, 174, 214, 215], "electron": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "excluded_evidence_typ": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "databas": [0, 8, 16, 30, 36, 58, 111, 144, 174], "excluded_databas": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "qualifi": [0, 8, 16, 30, 36, 58, 111, 144, 174], "contributes_to": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "colocalizes_with": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "excluded_qualifi": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "plot_ontology_graph": [0, 8, 16, 30, 36, 215], "ontology_graph_format": [0, 8, 16, 30, 36, 215], "pdf": [0, 8, 16, 30, 36, 37, 215], "svg": [0, 8, 16, 30, 215], "png": [0, 8, 16, 30, 215], "randomization_rep": [0, 8, 16, 18, 23, 30, 32, 40, 215], "via": [0, 6, 7, 8, 16, 30, 36, 215], "solr": [0, 8, 16, 30, 36], "search": [0, 8, 16, 30, 36], "engin": [0, 8, 16, 30, 36], "golr": [0, 8, 16, 30, 36], "some": [0, 4, 7, 8, 16, 18, 23, 30, 32, 40, 214, 215], "propag": [0, 8, 16, 18, 23, 30, 32, 36, 40, 214], "dag": [0, 8, 16, 30, 36, 215], "root": [0, 8, 16, 30, 36], "termin": [0, 6, 7, 8, 16, 30, 36, 215], "node": [0, 8, 16, 30, 36, 215], "manner": [0, 8, 16, 30, 36], "children": [0, 8, 16, 30, 36], "parent": [0, 8, 16, 30, 36, 215], "allm": [0, 8, 16, 30, 36], "proopag": [0, 8, 16, 30, 36], "alexa": [0, 8, 16, 30, 36], "pubm": [0, 8, 16, 30, 36, 215], "nlm": [0, 8, 16, 30, 36, 215], "nih": [0, 8, 16, 30, 36, 215], "gov": [0, 8, 16, 30, 36, 215], "16606683": [0, 8, 16, 30, 36, 215], "molecular_funct": [0, 8, 16, 30, 36], "cellular_compon": [0, 8, 16, 30, 36], "evid": [0, 8, 16, 30, 36, 214], "categori": [0, 8, 16, 30, 36, 214, 215], "consortium": [0, 8, 16, 30, 36, 215], "geneontologi": [0, 8, 16, 30, 36, 215], "doc": [0, 1, 8, 16, 30, 36, 215], "amigo": [0, 8, 16, 30, 36], "xref": [0, 8, 16, 30, 36], "spefici": [0, 4, 8, 16, 30, 36], "depict": [0, 8, 16, 30, 36, 214, 215], "repitit": [0, 8, 16, 18, 23, 30, 32, 40, 215], "common": [0, 8, 17, 31, 205, 214], "kegg_enrich": [0, 8, 215], "kyoto": [0, 8, 18, 32, 37], "encyclopedia": [0, 8, 18, 32, 37], "non_categorical_enrich": [0, 8, 215], "parametric_test": [0, 8, 19, 33, 215], "plot_log_scal": [0, 8, 19, 33, 215], "interleav": [0, 8, 19, 33, 215], "n_bin": [0, 8, 19, 33], "sign": [0, 8, 19, 33, 215], "parametr": [0, 8, 19, 33, 215], "logarithm": [0, 4, 8, 19, 33, 214, 215], "histogram": [0, 8, 19, 33, 214, 215], "semi": [0, 8, 19, 33, 214], "transpar": [0, 8, 19, 33, 43], "obsrev": [0, 8, 19, 33], "bin": [0, 8, 19, 33], "save_txt": [0, 8, 215], "doesn": [0, 8, 20, 34, 214], "ONE": [0, 8, 21, 38], "neither": [0, 8, 21, 38], "b": [0, 1, 8, 21, 38, 43, 214], "ranked_gen": [0, 8, 24, 215], "rank": [0, 3, 4, 7, 8, 24, 215], "meaning": [0, 8, 24, 214, 215], "vector": [0, 8], "single_set_enrich": [0, 4, 8, 215], "xl": [0, 4, 7, 8, 35, 36, 37, 215], "mhg": [0, 4, 7, 8, 35, 36, 37, 215], "develop": [0, 1, 5, 8, 35, 36, 37, 214, 215], "prof": [0, 8, 35, 36, 37], "zohar": [0, 8, 35, 36, 37], "yakhini": [0, 7, 8, 35, 36, 37], "colleagu": [0, 8, 35, 36, 37], "florian": [0, 8, 35, 36, 37], "wagner": [0, 4, 7, 8, 35, 36, 37], "single_set_go_enrich": [0, 4, 8, 215], "single_set_kegg_enrich": [0, 8, 215], "plot_pathway_graph": [0, 8, 37], "pathway_graphs_format": [0, 8, 37], "_fetch_set": 0, "obj": [0, 4, 8, 42, 43], "upset_plot": [0, 4, 8, 215], "venn_diagram": [0, 4, 8, 215], "turn": 0, "python": [0, 1, 4, 6, 7, 8, 42, 43, 215], "kei": [0, 8, 42, 43, 215], "plot_enrichment_result": [0, 8, 215], "results_df": [0, 8, 41], "en_score_col": [0, 8, 41], "log2_fold_enrich": [0, 8, 41, 215], "name_col": [0, 8, 41], "center_bar": [0, 8, 41], "log_2": [0, 8, 41], "asterisk": [0, 8, 41, 215], "around": [0, 8, 41, 214, 215], "ylim": [0, 8, 41], "set_color": [0, 8, 42, 43], "black": [0, 8, 42, 43], "upset": [0, 4, 8, 42, 214], "show_percentag": [0, 8, 42], "attr_ref_table_path": [0, 8, 42, 43], "fig": [0, 8, 42, 43], "gene1": [0, 8, 10, 24, 42, 43, 215], "gene2": [0, 8, 10, 24, 42, 43, 215], "gene3": [0, 8, 42, 43, 215], "name_of_attribute_from_reference_t": [0, 8, 42, 43], "iif": [0, 8, 42], "subset": [0, 1, 8, 42, 43, 215], "mix": [0, 8, 42], "percentag": [0, 8, 42, 214], "entir": [0, 8, 42, 214], "onto": [0, 8, 42, 43], "shade": [0, 8, 42], "add_outlin": [0, 8, 43], "linecolor": [0, 8, 43], "linestyl": [0, 8, 43], "solid": [0, 8, 43], "dash": [0, 8, 43], "linewidth": [0, 8, 43], "set_fonts": [0, 8, 43], "subset_fonts": [0, 8, 43], "normalize_to": [0, 8, 43], "venn": [0, 4, 7, 8, 43], "diagram": [0, 4, 8, 43], "circl": [0, 4, 8, 43, 214], "opac": [0, 8, 43], "while": [0, 4, 8, 43, 214, 215], "opaqu": [0, 8, 43], "area": [0, 8, 43, 214], "outlin": [0, 4, 8, 43], "widdth": [0, 8, 43], "sometim": [0, 4, 8, 43], "tune": [0, 8, 43, 215], "overal": [0, 8, 43], "fitur": [0, 8, 43], "fit": [0, 8, 43, 214, 215], "better": [0, 4, 8, 43, 215], "venndiagram": [0, 8, 43], "patch": [0, 1, 8, 43], "pars": [0, 4, 8, 205, 206, 207, 208], "parse_gene_name_str": [0, 8], "daf": [0, 8, 206, 207, 215], "lin15b": [0, 8, 206], "sequenc": [0, 4, 5, 7, 8, 206, 207], "z": [0, 5, 7, 8, 206, 207], "charact": [0, 8, 206, 207], "saeg": [0, 8, 206], "lin": [0, 8, 206, 215], "15b": [0, 8, 206, 215], "cyp": [0, 8, 206], "23a1lin": [0, 8, 206], "15a": [0, 8, 206], "wbgene12345678": [0, 8, 206, 208], "ghf5h": [0, 8, 206], "23a1": [0, 8, 206], "parse_sequence_name_str": [0, 8], "y55d5a": [0, 8, 207, 215], "digit": [0, 8, 207, 208], "cele_y55d5a": [0, 8, 207], "5t23g5": [0, 8, 207], "6wbgene00000000": [0, 8, 207], "zk662": [0, 8, 207], "t23g5": [0, 8, 207, 215], "parse_wbgene_str": [0, 8, 215], "wbgene98765432wbgene00000000": [0, 8, 208], "genewbgene44444444daf": [0, 8, 208], "16a5ghb": [0, 8, 208], "wbgene55555555": [0, 8, 208], "wbgene44444444": [0, 8, 208], "wbgene98765432": [0, 8, 208], "wbgene00000000": [0, 8, 208], "print_settings_fil": [0, 8], "configur": [0, 8, 209], "my_attribute_reference_table_path": [0, 8, 209, 212], "my_biotype_reference_table_path": [0, 8, 209, 213], "reset_settings_fil": [0, 8], "reset": [0, 8, 210], "local": [0, 1, 8, 210, 214], "delet": [0, 8, 210, 214], "warn": [0, 8, 45, 102, 165, 210, 214], "action": [0, 8, 210, 214, 215], "irrevers": [0, 8, 210], "save_to_csv": [0, 8], "control": [0, 8, 211], "directori": [0, 4, 8, 211, 215], "set_attr_ref_table_path": [0, 3, 8, 215], "wish": [0, 8, 212, 213, 214], "set_biotype_ref_table_path": [0, 3, 8, 215], "mainli": 0, "refer": [3, 4, 5, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 40, 42, 43, 48, 56, 57, 70, 72, 74, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 186, 189, 209, 212, 213, 214], "intestin": [3, 215], "epigenet": [3, 214, 215], "paralog": [3, 214, 215], "abut": 3, "gener": [3, 4, 5, 7, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 46, 49, 50, 51, 54, 70, 73, 75, 80, 81, 84, 85, 90, 93, 94, 101, 105, 124, 135, 139, 155, 168, 187, 214], "filter": [3, 4, 5, 7, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 40, 205, 211], "enrich": [3, 4, 5, 7], "modul": [3, 4, 9, 44, 199, 205], "lncrna": 3, "rnalysi": [1, 3, 4, 6, 214], "matric": [3, 4, 7, 214], "detail": [1, 3, 214, 215], "enrichmemt": 3, "store": [3, 215], "structur": [3, 102, 165, 215], "offer": [3, 214], "util": [3, 4, 215], "subtyp": [3, 215], "unsort": 3, "howev": [3, 214, 215], "introduc": [4, 215], "qualiti": [4, 215], "life": [4, 214], "graphic": [4, 5, 214], "interfac": [4, 5, 214], "translat": [4, 215], "extend": 4, "translate_gene_id": [4, 8], "filter_by_go_annot": [4, 8], "fastq": [4, 7], "adapt": [4, 7], "cutadapt": [4, 7], "mrna": [4, 214], "quantif": [4, 7, 214], "kallisto": [4, 7], "now": [1, 4, 214, 215], "replicates_group": [4, 214, 215], "refactor": 4, "filter_biotyp": 4, "queue": 4, "computation": 4, "intens": 4, "task": 4, "bug": [4, 5, 7], "disappear": 4, "except": [4, 215], "dure": [4, 214, 215], "caus": [4, 214], "crash": 4, "auxillari": 4, "window": [4, 6, 7, 214, 215], "properli": [4, 214, 215], "restor": 4, "encount": 4, "minor": [1, 4], "renam": [4, 214], "supplement": 4, "correctli": [4, 215], "tutori": [4, 5, 7], "video": 4, "deprec": 4, "longer": 4, "ensur": [4, 214], "among": 4, "unweight": 4, "issu": [1, 4, 45, 102, 165, 214, 215], "recent": 4, "api": [4, 5, 214, 215], "moreov": [4, 214, 215], "slightli": 4, "cach": 4, "runtim": 4, "reflect": [4, 214], "implement": [4, 214, 215], "small": [4, 214], "infer": [4, 214], "priorit": 4, "occur": [4, 215], "befor": [1, 4, 214], "exact": [4, 214, 215], "spuriou": 4, "occurs": 4, "wai": [1, 4, 7, 214], "customiz": 4, "quicker": 4, "conveni": 4, "elabor": [4, 215], "pattern": [4, 214, 215], "perfofm": 4, "eden": [4, 7], "plo": [4, 7, 215], "biol": [4, 7], "2007": [4, 7, 214, 215], "One": [4, 214, 215], "2015": [4, 214], "let": [4, 214], "enrich_randomization_parallel": [4, 215], "parallel_process": 4, "session": [4, 214], "activ": [4, 215], "six": [4, 214, 215], "y_titl": 4, "clearli": 4, "data_scal": 4, "ob": [4, 215], "exp": [4, 215], "respect": [4, 214], "boolean": [4, 215], "_missing_from_biotype_refer": 4, "not_in_biotype_refer": 4, "hint": 4, "empti": [4, 214, 215], "few": [4, 214, 215], "docstr": [1, 4], "printout": 4, "sever": [4, 215], "speed": 4, "board": 4, "feature_str": 4, "abl": [4, 214, 215], "depracationwarn": 4, "linux": 4, "system": [1, 4, 214], "wrong": 4, "utf": 4, "encod": 4, "won": [4, 214, 215], "upsetplot": [4, 7], "divis": 4, "prevent": 4, "previou": [4, 214], "stabl": [4, 5], "releas": [4, 5], "pypi": [1, 4, 6, 7, 215], "upgrad": 4, "report": [4, 5, 7, 214], "write": [4, 7, 214], "been": [4, 214, 215], "deseq_highlight": 4, "load_csv": 4, "clearer": 4, "predict": 4, "comprehens": 4, "filter_by_ref_table_attr": 4, "split_by_ref_table_attr": 4, "norm_reads_with_size_factor": 4, "norm_reads_to_rpm": 4, "made": [4, 214], "hidden": 4, "feature_name_to_wbgen": 4, "beta": 4, "link": [5, 7, 214, 215], "sourc": [5, 7, 214], "depend": [5, 214, 215], "credit": [1, 5], "cite": [5, 215], "contributor": 5, "github": [1, 5, 6], "page": [5, 214], "intro": 5, "word": 5, "glossari": 5, "2022": [5, 7], "11": [5, 7, 214], "07": 5, "04": 5, "02": 5, "2021": 5, "03": 5, "filter_biotype_from_gtf": [0, 8], "go_id": [8, 58, 111, 144, 174], "from_datafram": 8, "translate_to": [8, 99, 133, 163, 196], "translate_from": [8, 99, 133, 163, 196], "remove_unmapped_gen": [8, 99, 133, 163, 196], "filter_types_rev": 8, "readable_nam": 8, "__init__": [10, 24, 45, 102, 136, 165, 198], "downstream": [10, 24, 214], "my_set": [10, 24, 215], "my": [10, 24, 214, 215], "filter_obj": [10, 24], "my_other_set": [10, 24, 215], "valid": [45, 102, 165, 214], "drop": [45, 102, 136, 214], "deseq_pip": [198, 215], "command": [6, 7, 214, 215], "gui": [7, 215], "consol": [7, 215], "run_gui": [7, 215], "click": [214, 215], "overview": [7, 214, 215], "button": [214, 215], "entireti": 215, "desir": [214, 215], "until": 215, "At": [214, 215], "moment": 215, "histori": [1, 214, 215], "redo": [214, 215], "resiz": 215, "workspac": 215, "right": [214, 215], "accident": 215, "worri": 215, "through": [1, 6, 7, 214, 215], "edit": 215, "menu": [214, 215], "soon": 215, "review": 215, "extract": 215, "preview": [214, 215], "pane": 215, "just": [1, 215], "workflow": 215, "faster": 215, "prone": 215, "easier": [1, 214, 215], "understand": 215, "built": 215, "rapid": [214, 215], "section": 215, "principl": [214, 215], "look": [1, 214, 215], "glimps": 215, "line": [7, 214, 215], "access": 215, "our": 215, "directli": [214, 215], "represent": 215, "5954": 215, "remain": [214, 215], "17781": 215, "unaffect": 215, "unchang": 215, "becam": 215, "continu": 215, "suppos": 215, "kept": 215, "want": [1, 214, 215], "throw": [214, 215], "rest": [214, 215], "There": [214, 215], "project": [1, 7, 214, 215], "yet": 215, "sinc": [214, 215], "500": 215, "myfold": 215, "test_deseq_below0": 215, "75basemeangt500": 215, "altern": [7, 215], "alternative_filenam": 215, "later": [214, 215], "Or": [7, 215], "eahc": 215, "return_format": 215, "easili": 215, "here": [1, 214, 215], "18129": 215, "b9": 215, "bioc": 215, "assum": [1, 214, 215], "lfcse": 215, "stat": 215, "044": 215, "329404": 215, "158938": 215, "94783": 215, "96e": 215, "80e": 215, "813": 215, "291484": 215, "93189": 215, "74e": 215, "40e": 215, "567": 215, "190439": 215, "51433": 215, "60e": 215, "34e": 215, "9257": 215, "246313": 215, "49419": 215, "23e": 215, "82e": 215, "186": 215, "129606": 215, "11463": 215, "91e": 215, "46e": 215, "649": 215, "03719": 215, "219781": 215, "3691": 215, "32e": 215, "70e": 215, "1429": 215, "347777": 215, "26471": 215, "58e": 215, "12e": 215, "1632": 215, "217802": 215, "96885": 215, "42e": 215, "similarli": [214, 215], "insignific": 215, "With": 215, "magnitud": [214, 215], "capabl": 215, "softwar": [7, 215], "featurecount": 215, "readthedoc": 215, "io": [1, 215], "master": 215, "html": 215, "unintend": 215, "interact": [214, 215], "sam": 215, "bam": 215, "nativ": 215, "weren": 215, "low": 215, "376": 215, "177": 215, "__no_featur": 215, "__ambigu": 215, "__too_low_aqu": 215, "__not_align": 215, "121": 215, "__alignment_not_uniqu": 215, "deault": 215, "unmap": 215, "uq": 215, "normalize_quantil": 215, "normalize_mrn": 215, "simpli": [214, 215], "sample4": 215, "96": 215, "special": 215, "37": 215, "145": 215, "77": 215, "9468": 215, "11354": 215, "14009": 215, "30287": 215, "108": 215, "290": 215, "557": 215, "893": 215, "109853": 215, "277653": 215, "88653": 215, "96012": 215, "Such": 215, "cell": [214, 215], "__alignment_no_uniqu": 215, "wide": [214, 215], "varieti": 215, "five_clust": 215, "len": 215, "two_clust": 215, "model": [214, 215], "silhouette_clust": 215, "rang": 215, "gap_stat_clust": 215, "evalu": 215, "outcom": 215, "partit": 215, "squar": [7, 215], "eucliean": 215, "therefor": [214, 215], "main": [214, 215], "simplic": 215, "veri": [214, 215], "dissimilar": [214, 215], "eucliidean": 215, "cityblock": 215, "heyer": 215, "kruglyak": 215, "yooseph": 215, "1999": 215, "son": [214, 215], "baek": [214, 215], "hamm": 215, "scikit": [7, 215], "agglom": 215, "aim": 215, "further": [214, 215], "eventu": 215, "connect": 215, "decid": [214, 215], "cut": 215, "height": 215, "specifii": 215, "stand": [214, 215], "densiti": [7, 215], "applic": [214, 215], "springer": 215, "com": [1, 6, 7, 215], "chapter": 215, "1007": 215, "978": 215, "642": 215, "37456": 215, "2_14": 215, "tradit": [214, 215], "hsbscan": [214, 215], "assumpt": [214, 215], "hope": [214, 215], "unlik": [214, 215], "outlier": [214, 215], "guess": [214, 215], "interest": 215, "1016": 215, "j": [7, 215], "eswa": 215, "2011": [7, 214, 215], "08": 215, "059": 215, "potenti": [214, 215], "weak": [214, 215], "account": [214, 215], "robustli": [214, 215], "themselv": [214, 215], "th": [214, 215], "reduc": [214, 215], "increas": [214, 215], "robust": [214, 215], "larg": [214, 215], "quick": [214, 215], "strong": 215, "numerator_read": 215, "denominator_read": 215, "underli": 215, "lack": 215, "famili": 215, "enter": [214, 215], "mean_numerator_read": 215, "mean_denominator_read": 215, "cond3_rep1": 215, "cond3_rep2": 215, "condition1": 215, "condition2": 215, "51828": 215, "36026": 215, "becaus": [214, 215], "itself": 215, "column1": 215, "repr": 215, "alongsid": [214, 215], "output_dict": 215, "biotypes_1": 215, "biotypes_2": 215, "output_dict_inplac": 215, "append": 215, "hyperosmot": 215, "anslys": 215, "my_filter_obj": 215, "my_python_set": 215, "wbgene0245200": 215, "wbgene00402029": 215, "third": 215, "paresd": 215, "path_to_my_fil": 215, "product": 215, "speci": 215, "know": [214, 215], "6239": 215, "mischaracter": 215, "sure": [1, 214, 215], "furthermor": 215, "certain": [214, 215], "deem": 215, "importantli": 215, "usual": [214, 215], "my_background_set": 215, "feature1": 215, "feature2": 215, "feature3": 215, "oppos": 215, "mark": [214, 215], "sucess": 215, "bia": 215, "zero": 215, "topic": 215, "21044043": 215, "discret": 215, "contribut": 215, "locomot": 215, "wnt": 215, "carri": 215, "antioxid": 215, "atp": 215, "chaperon": 215, "locat": [214, 215], "granul": 215, "mitochondrion": 215, "exclus": [214, 215], "associ": [214, 215], "kind": [214, 215], "silico": 215, "statement": 215, "judgement": 215, "homologi": 215, "definit": 215, "iea": 215, "ikr": 215, "arabidopsi": 215, "resourc": 215, "explicit": 215, "demonstr": 215, "facilit": 215, "complex": 215, "organel": 215, "somewhat": 215, "cyclic": 215, "site": 215, "hexos": 215, "biosynthet": 215, "metabol": 215, "sens": 215, "said": 215, "upstream": 215, "unfortun": [214, 215], "neighbor": [214, 215], "discoveri": 215, "rate": 215, "deal": 215, "problem": 215, "de": 215, "compromis": 215, "suggest": [214, 215], "propagation_method": 215, "after": [214, 215], "orient": [214, 215], "custom": [7, 215], "barplot": 215, "0001556": 215, "oocyt": 215, "matur": 215, "1327": 215, "319": 215, "49722119558": 215, "0000999": 215, "0043186": 215, "89": 215, "244": 215, "87": 215, "46013879322": 215, "cel00010": 215, "glycolysi": 215, "gluconeogenesi": 215, "nematod": [214, 215], "cel00030": 215, "pentos": 215, "phosphat": 215, "retreiv": 215, "peform": 215, "neuron": 215, "male": 215, "attirubt": 215, "student": 215, "meet": [1, 215], "wbgene00003002": 215, "wbgene00004201": 215, "wbgene00300139": 215, "union_result": 215, "limit": 215, "tool": [7, 214, 215], "inher": 215, "behav": 215, "journal": [7, 215], "ploscompbiol": 215, "articl": [1, 215], "1371": [7, 215], "pcbi": [7, 215], "0030039": [7, 215], "arxiv": [7, 215], "ab": 215, "1507": [7, 215], "07905": [7, 215], "my_ranked_set": 215, "my_list": 215, "much": [214, 215], "comapr": 215, "ranked_set": 215, "wbgene00000106": 215, "wbgene00000041": 215, "wbgene00000105": 215, "go_en_result": 215, "en_result": 215, "emploi": 215, "sets_to_visu": 215, "gene4": 215, "accur": 215, "proport": [214, 215], "app": 215, "parser": 215, "nearest": [214, 215], "feature_indic": [214, 215], "wbgene0000001": [214, 215], "wbgene0000002": [214, 215], "241": [214, 215], "wbgene0000003": [214, 215], "wbgene0000004": [214, 215], "wbgene0000005": [214, 215], "insensit": 215, "futur": [214, 215], "the_new_attribute_reference_table_path": 215, "the_new_biotype_reference_table_path": 215, "whenev": [214, 215], "read_attr_ref_table_path": 215, "read_biotype_ref_table_path": 215, "attr_table_path": 215, "the_attribute_reference_table_path_that_was_saved_in_the_settings_fil": 215, "biotype_table_path": 215, "the_biotype_reference_table_path_that_was_saved_in_the_settings_fil": 215, "wbgene00023495": 215, "my_str": 215, "wbgene00000002wbgene00000003": 215, "wbgene00000004g": 215, "wbgene000000002": 215, "welcom": 1, "greatli": 1, "appreci": 1, "littl": 1, "bit": [1, 214], "guyteichman": [1, 6, 7], "might": [1, 6, 7, 214], "troubleshoot": 1, "reproduc": [1, 214], "tag": 1, "open": [1, 7, 214], "whoever": 1, "offici": [1, 214], "web": 1, "blog": 1, "send": 1, "propos": 1, "work": [1, 6, 7, 214], "scope": 1, "narrow": 1, "rememb": [1, 214], "volunt": 1, "driven": 1, "readi": 1, "fork": 1, "repo": 1, "clone": [1, 6], "git": [1, 6], "your_name_her": 1, "virtualenv": 1, "virtualenvwrapp": 1, "mkvirtualenv": 1, "py": [1, 6], "branch": 1, "checkout": 1, "bugfix": 1, "re": [1, 214], "flake8": 1, "tox": 1, "pip": [1, 6, 7], "commit": 1, "push": 1, "readm": 1, "rst": 1, "coveral": 1, "test_rnalysi": 1, "remind": 1, "maintain": 1, "Then": [1, 6, 7, 214], "bumpvers": 1, "travi": 1, "citat": 4, "typo": 4, "machin": [6, 7], "graphviz": [6, 7], "microsoft": [6, 7, 214], "download": [6, 214], "repositori": 6, "analyz": [7, 214], "suit": 7, "research": 7, "question": [7, 214], "visualis": 7, "explor": [7, 214], "global": 7, "profil": 7, "dimension": [7, 214], "reduct": [7, 214], "share": [7, 214], "integr": 7, "seq": 7, "bracket": 7, "along": [7, 214], "launch": 7, "numba": 7, "extra": 7, "statsmodel": 7, "joblib": 7, "tqdm": 7, "appdir": 7, "grid_strategi": 7, "pyyaml": 7, "xlmhg": 7, "pairwisedist": 7, "typing_extens": 7, "pyqt5": 7, "qdarkstyl": 7, "teichman": 7, "cohen": 7, "ganon": 7, "o": 7, "dunski": 7, "shani": 7, "gingold": 7, "h": 7, "rechavi": 7, "biorxiv": 7, "517851": 7, "1101": 7, "martin": 7, "high": [7, 214], "throughput": 7, "embnet": 7, "pp": 7, "14806": 7, "ej": 7, "200": [7, 214], "brai": 7, "pimentel": 7, "melst": 7, "Near": 7, "probabilist": 7, "nat": 7, "biotechnol": 7, "34": 7, "527": 7, "2016": 7, "1038": 7, "nbt": 7, "3519": 7, "love": 7, "mi": 7, "w": 7, "2014": [7, 214], "moder": 7, "biologi": 7, "550": 7, "1186": 7, "s13059": 7, "014": 7, "0550": 7, "l": 7, "mcinn": 7, "heali": 7, "astel": 7, "volum": 7, "2017": 7, "lipson": 7, "yogev": 7, "motif": 7, "dna": 7, "e39": 7, "48550": 7, "gmail": 7, "dror": 7, "netta": 7, "shachar": 7, "cookiecutt": 7, "audreyr": 7, "pypackag": 7, "templat": 7, "cover": 214, "focu": 214, "publicli": 214, "literatur": 214, "gave": 214, "readabl": 214, "choos": 214, "u": 214, "dedic": 214, "fragment": 214, "kilobas": 214, "fpkm": 214, "mandatori": 214, "actual": 214, "regard": 214, "rather": 214, "fairli": 214, "gruop": 214, "finish": 214, "tab": 214, "expand": 214, "hover": 214, "cursor": 214, "everyth": 214, "unfilt": 214, "conveniet": 214, "unless": 214, "expelicitli": 214, "undon": 214, "happi": 214, "chose": 214, "scroll": 214, "panel": 214, "undo": 214, "thousand": 214, "still": 214, "difficult": 214, "vari": 214, "remedi": 214, "rearrang": 214, "captur": 214, "sub": 214, "That": 214, "standardaz": 214, "undesir": 214, "skew": 214, "disabl": 214, "neutral": 214, "largest": 214, "amount": 214, "preceed": 214, "perhap": 214, "worth": 214, "ey": 214, "interestingli": 214, "circular": 214, "worm": 214, "hypothesi": 214, "pc1": 214, "arrang": 214, "germlin": 214, "embryo": 214, "mostli": 214, "gonad": 214, "adult": 214, "quantiti": 214, "germ": 214, "l4": 214, "larva": 214, "prolifer": 214, "l3": 214, "pc2": 214, "spot": 214, "trend": 214, "seem": 214, "earlier": 214, "unexpress": 214, "wbgene00003864": 214, "almost": 214, "embryon": 214, "skn": 214, "wbgene00004804": 214, "pop": 214, "possibli": 214, "unlaid": 214, "convei": 214, "had": 214, "subgroup": 214, "cycl": 214, "abund": 214, "illustr": 214, "simplest": 214, "challeng": 214, "aren": 214, "reason": 214, "tempor": 214, "fortun": 214, "good": 214, "known": 214, "especi": 214, "wait": 214, "anslysi": 214, "left": 214, "orang": 214, "On": 214, "peak": 214, "granular": 214, "enough": 214, "regular": 214, "biggest": 214, "character": 214, "quit": 214, "degre": 214, "ok": 214, "cancel": 214, "reveal": 214, "obviou": 214, "again": 214, "move": 214, "emsembl": 214, "concensu": 214, "agre": 214, "half": 214, "mind": 214, "plu": 214, "progress": 214, "commonli": 214, "thw": 214, "enlarg": 214, "back": 214, "unannot": 214, "successfulli": 214, "ancestor": 214, "depth": 214, "geo": 214, "caenorhabidti": 214, "stress": 214, "goal": 214, "answer": 214, "exposur": 214, "expos": 214, "osmot": 214, "gse107704": 214, "unstrand": 214, "srr6348197": 214, "srr6348198": 214, "srr6348199": 214, "srr6348200": 214, "srr6348201": 214, "srr6348202": 214, "starvat": 214, "gse124178": 214, "strand": 214, "srr8359132": 214, "srr8359133": 214, "srr8359142": 214, "srr8359134": 214, "srr8359135": 214, "srr8359136": 214, "heat": 214, "shock": 214, "gse132838": 214, "srr9310678": 214, "srr9310679": 214, "srr9310680": 214, "srr9310681": 214, "srr9310682": 214, "srr9310683": 214, "opportun": 214, "xyz": 214, "detect": 214, "uaualli": 214, "popular": 214, "friendli": 214, "programmat": 214, "portion": 214, "leftov": 214, "happen": 214, "written": 214, "prime": 214, "illumina": 214, "truseq": 214, "agatcggaagagcacacgtctgaactccagtca": 214, "three_prime_adapt": 214, "dialog": 214, "flank": 214, "10bp": 214, "discard_untrimmed_read": 214, "discard": 214, "didn": 214, "awai": 214, "screen": 214, "agatcggaagagcgtcgtgtagggaaagagtg": 214, "reorder": 214, "proce": 214, "pseudoalign": 214, "target": 214, "transcriptom": 214, "physic": 214, "proceed": 214, "fasta": 214, "As": 214, "deviaton": 214, "accordingli": 214, "new_sample_nam": 214, "excel": 214, "scaledtpm": 214, "soneson": 214, "tximport": 214, "un": 214, "forward": 214, "underneath": 214, "subfold": 214, "revers": 214, "languag": 214, "side": 214, "genotyp": 214, "ctrl1": 214, "ctrl": 214, "ctrl2": 214, "ctrl3": 214, "osm1": 214, "osm": 214, "osm2": 214, "osm3": 214, "googl": 214, "sheet": 214, "prepar": 214, "matter": 214, "ran": 214, "straight": 214, "decent": 214, "chanc": 214, "ll": 214, "mistak": 214, "textbox": 214, "notic": 214, "close": 214, "resum": 214, "hard": 214, "big": 214, "seen": 214, "downregl": 214, "simplifi": 214, "primari": 214, "middl": 214, "luckili": 214, "newli": 214, "evolv": 214, "codon": 214, "deviat": 214, "norm": 214, "ye": 214, "convert": 214, "attirbut": 214, "mock": 214, "gut": 214, "houri": 214, "dalzel": 214, "yigit": 214, "2006": 214, "presenc": 214, "inflat": 214, "concern": 214, "123": 214, "18924": 214, "conclud": 214, "encompass": 214, "familiar": 214, "deeper": 214, "dive": 214, "feel": 214, "free": 214, "discuss": 214, "luck": 214, "bioinformat": 214, "endeavor": 214}, "objects": {"rnalysis": [[9, 0, 0, "-", "enrichment"], [44, 0, 0, "-", "filtering"], [205, 0, 0, "-", "general"]], "rnalysis.enrichment": [[10, 1, 1, "", "FeatureSet"], [24, 1, 1, "", "RankedSet"], [41, 3, 1, "", "plot_enrichment_results"], [42, 3, 1, "", "upset_plot"], [43, 3, 1, "", "venn_diagram"]], "rnalysis.enrichment.FeatureSet": [[10, 2, 1, "", "__init__"], [11, 2, 1, "", "biotypes"], [12, 2, 1, "", "change_set_name"], [13, 2, 1, "", "difference"], [14, 2, 1, "", "enrich_hypergeometric"], [15, 2, 1, "", "enrich_randomization"], [16, 2, 1, "", "go_enrichment"], [17, 2, 1, "", "intersection"], [18, 2, 1, "", "kegg_enrichment"], [19, 2, 1, "", "non_categorical_enrichment"], [20, 2, 1, "", "save_txt"], [21, 2, 1, "", "symmetric_difference"], [22, 2, 1, "", "union"], [23, 2, 1, "", "user_defined_enrichment"]], "rnalysis.enrichment.RankedSet": [[24, 2, 1, "", "__init__"], [25, 2, 1, "", "biotypes"], [26, 2, 1, "", "change_set_name"], [27, 2, 1, "", "difference"], [28, 2, 1, "", "enrich_hypergeometric"], [29, 2, 1, "", "enrich_randomization"], [30, 2, 1, "", "go_enrichment"], [31, 2, 1, "", "intersection"], [32, 2, 1, "", "kegg_enrichment"], [33, 2, 1, "", "non_categorical_enrichment"], [34, 2, 1, "", "save_txt"], [35, 2, 1, "", "single_set_enrichment"], [36, 2, 1, "", "single_set_go_enrichment"], [37, 2, 1, "", "single_set_kegg_enrichment"], [38, 2, 1, "", "symmetric_difference"], [39, 2, 1, "", "union"], [40, 2, 1, "", "user_defined_enrichment"]], "rnalysis.filtering": [[45, 1, 1, "", "CountFilter"], [102, 1, 1, "", "DESeqFilter"], [136, 1, 1, "", "Filter"], [165, 1, 1, "", "FoldChangeFilter"], [198, 1, 1, "", "Pipeline"], [204, 3, 1, "", "readable_name"]], "rnalysis.filtering.CountFilter": [[45, 2, 1, "", "__init__"], [46, 2, 1, "", "average_replicate_samples"], [47, 2, 1, "", "biotypes_from_gtf"], [48, 2, 1, "", "biotypes_from_ref_table"], [49, 2, 1, "", "box_plot"], [50, 2, 1, "", "clustergram"], [51, 2, 1, "", "describe"], [52, 2, 1, "", "difference"], [53, 2, 1, "", "differential_expression_deseq2"], [54, 2, 1, "", "enhanced_box_plot"], [55, 2, 1, "", "filter_biotype_from_gtf"], [56, 2, 1, "", "filter_biotype_from_ref_table"], [57, 2, 1, "", "filter_by_attribute"], [58, 2, 1, "", "filter_by_go_annotations"], [59, 2, 1, "", "filter_by_kegg_annotations"], [60, 2, 1, "", "filter_by_row_sum"], [61, 2, 1, "", "filter_low_reads"], [62, 2, 1, "", "filter_missing_values"], [63, 2, 1, "", "filter_percentile"], [64, 2, 1, "", "filter_top_n"], [65, 2, 1, "", "fold_change"], [66, 2, 1, "", "from_dataframe"], [67, 2, 1, "", "from_folder"], [68, 2, 1, "", "head"], [69, 2, 1, "", "intersection"], [70, 2, 1, "", "ma_plot"], [71, 2, 1, "", "majority_vote_intersection"], [72, 2, 1, "", "normalize_median_of_ratios"], [73, 2, 1, "", "normalize_rle"], [74, 2, 1, "", "normalize_tmm"], [75, 2, 1, "", "normalize_to_quantile"], [76, 2, 1, "", "normalize_to_rpm"], [77, 2, 1, "", "normalize_to_rpm_htseqcount"], [78, 2, 1, "", "normalize_with_scaling_factors"], [79, 2, 1, "", "number_filters"], [80, 2, 1, "", "pairplot"], [81, 2, 1, "", "pca"], [82, 2, 1, "", "plot_expression"], [83, 2, 1, "", "print_features"], [84, 2, 1, "", "save_csv"], [85, 2, 1, "", "scatter_sample_vs_sample"], [86, 2, 1, "", "sort"], [87, 2, 1, "", "split_by_attribute"], [88, 2, 1, "", "split_by_percentile"], [89, 2, 1, "", "split_by_reads"], [90, 2, 1, "", "split_clicom"], [91, 2, 1, "", "split_hdbscan"], [92, 2, 1, "", "split_hierarchical"], [93, 2, 1, "", "split_kmeans"], [94, 2, 1, "", "split_kmedoids"], [95, 2, 1, "", "symmetric_difference"], [96, 2, 1, "", "tail"], [97, 2, 1, "", "text_filters"], [98, 2, 1, "", "transform"], [99, 2, 1, "", "translate_gene_ids"], [100, 2, 1, "", "union"], [101, 2, 1, "", "violin_plot"]], "rnalysis.filtering.DESeqFilter": [[102, 2, 1, "", "__init__"], [103, 2, 1, "", "biotypes_from_gtf"], [104, 2, 1, "", "biotypes_from_ref_table"], [105, 2, 1, "", "describe"], [106, 2, 1, "", "difference"], [107, 2, 1, "", "filter_abs_log2_fold_change"], [108, 2, 1, "", "filter_biotype_from_gtf"], [109, 2, 1, "", "filter_biotype_from_ref_table"], [110, 2, 1, "", "filter_by_attribute"], [111, 2, 1, "", "filter_by_go_annotations"], [112, 2, 1, "", "filter_by_kegg_annotations"], [113, 2, 1, "", "filter_fold_change_direction"], [114, 2, 1, "", "filter_missing_values"], [115, 2, 1, "", "filter_percentile"], [116, 2, 1, "", "filter_significant"], [117, 2, 1, "", "filter_top_n"], [118, 2, 1, "", "from_dataframe"], [119, 2, 1, "", "head"], [120, 2, 1, "", "intersection"], [121, 2, 1, "", "majority_vote_intersection"], [122, 2, 1, "", "number_filters"], [123, 2, 1, "", "print_features"], [124, 2, 1, "", "save_csv"], [125, 2, 1, "", "sort"], [126, 2, 1, "", "split_by_attribute"], [127, 2, 1, "", "split_by_percentile"], [128, 2, 1, "", "split_fold_change_direction"], [129, 2, 1, "", "symmetric_difference"], [130, 2, 1, "", "tail"], [131, 2, 1, "", "text_filters"], [132, 2, 1, "", "transform"], [133, 2, 1, "", "translate_gene_ids"], [134, 2, 1, "", "union"], [135, 2, 1, "", "volcano_plot"]], "rnalysis.filtering.Filter": [[136, 2, 1, "", "__init__"], [137, 2, 1, "", "biotypes_from_gtf"], [138, 2, 1, "", "biotypes_from_ref_table"], [139, 2, 1, "", "describe"], [140, 2, 1, "", "difference"], [141, 2, 1, "", "filter_biotype_from_gtf"], [142, 2, 1, "", "filter_biotype_from_ref_table"], [143, 2, 1, "", "filter_by_attribute"], [144, 2, 1, "", "filter_by_go_annotations"], [145, 2, 1, "", "filter_by_kegg_annotations"], [146, 2, 1, "", "filter_missing_values"], [147, 2, 1, "", "filter_percentile"], [148, 2, 1, "", "filter_top_n"], [149, 2, 1, "", "from_dataframe"], [150, 2, 1, "", "head"], [151, 2, 1, "", "intersection"], [152, 2, 1, "", "majority_vote_intersection"], [153, 2, 1, "", "number_filters"], [154, 2, 1, "", "print_features"], [155, 2, 1, "", "save_csv"], [156, 2, 1, "", "sort"], [157, 2, 1, "", "split_by_attribute"], [158, 2, 1, "", "split_by_percentile"], [159, 2, 1, "", "symmetric_difference"], [160, 2, 1, "", "tail"], [161, 2, 1, "", "text_filters"], [162, 2, 1, "", "transform"], [163, 2, 1, "", "translate_gene_ids"], [164, 2, 1, "", "union"]], "rnalysis.filtering.FoldChangeFilter": [[165, 2, 1, "", "__init__"], [166, 2, 1, "", "biotypes_from_gtf"], [167, 2, 1, "", "biotypes_from_ref_table"], [168, 2, 1, "", "describe"], [169, 2, 1, "", "difference"], [170, 2, 1, "", "filter_abs_log2_fold_change"], [171, 2, 1, "", "filter_biotype_from_gtf"], [172, 2, 1, "", "filter_biotype_from_ref_table"], [173, 2, 1, "", "filter_by_attribute"], [174, 2, 1, "", "filter_by_go_annotations"], [175, 2, 1, "", "filter_by_kegg_annotations"], [176, 2, 1, "", "filter_fold_change_direction"], [177, 2, 1, "", "filter_missing_values"], [178, 2, 1, "", "filter_percentile"], [179, 2, 1, "", "filter_top_n"], [180, 2, 1, "", "from_dataframe"], [181, 2, 1, "", "head"], [182, 2, 1, "", "intersection"], [183, 2, 1, "", "majority_vote_intersection"], [184, 2, 1, "", "number_filters"], [185, 2, 1, "", "print_features"], [186, 2, 1, "", "randomization_test"], [187, 2, 1, "", "save_csv"], [188, 2, 1, "", "sort"], [189, 2, 1, "", "split_by_attribute"], [190, 2, 1, "", "split_by_percentile"], [191, 2, 1, "", "split_fold_change_direction"], [192, 2, 1, "", "symmetric_difference"], [193, 2, 1, "", "tail"], [194, 2, 1, "", "text_filters"], [195, 2, 1, "", "transform"], [196, 2, 1, "", "translate_gene_ids"], [197, 2, 1, "", "union"]], "rnalysis.filtering.Pipeline": [[198, 2, 1, "", "__init__"], [199, 2, 1, "", "add_function"], [200, 2, 1, "", "apply_to"], [201, 2, 1, "", "export_pipeline"], [202, 2, 1, "", "import_pipeline"], [203, 2, 1, "", "remove_last_function"]], "rnalysis.general": [[206, 3, 1, "", "parse_gene_name_string"], [207, 3, 1, "", "parse_sequence_name_string"], [208, 3, 1, "", "parse_wbgene_string"], [209, 3, 1, "", "print_settings_file"], [210, 3, 1, "", "reset_settings_file"], [211, 3, 1, "", "save_to_csv"], [212, 3, 1, "", "set_attr_ref_table_path"], [213, 3, 1, "", "set_biotype_ref_table_path"]]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:function"}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "function", "Python function"]}, "titleterms": {"api": 0, "refer": [0, 215], "rnalysi": [0, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 215], "filter": [0, 8, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 214, 215], "modul": [0, 5, 8, 215], "enrich": [0, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 214, 215], "gener": [0, 8, 205, 206, 207, 208, 209, 210, 211, 212, 213, 215], "util": 0, "glossari": 3, "histori": [4, 5], "3": [4, 5], "2": [4, 5, 214], "2022": 4, "11": 4, "23": 4, "ad": 4, "chang": [4, 5, 215], "fix": [1, 4], "1": [4, 5, 214], "0": 4, "10": 4, "16": 4, "12": 4, "07": 4, "05": 4, "04": 4, "02": 4, "2021": 4, "5": 4, "2020": 4, "27": 4, "4": 4, "03": 4, "28": 4, "remov": [4, 214], "2019": 4, "document": [1, 5], "about": 5, "start": [1, 5], "indic": [5, 215], "tabl": [5, 215], "packag": 8, "featureset": [10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 215], "biotyp": [11, 25, 215], "change_set_nam": [12, 26], "differ": [13, 27, 52, 106, 140, 169, 215], "enrich_hypergeometr": [14, 28], "enrich_random": [15, 29], "go_enrich": [16, 30], "intersect": [17, 31, 69, 120, 151, 182, 215], "kegg_enrich": [18, 32], "non_categorical_enrich": [19, 33], "save_txt": [20, 34], "symmetric_differ": [21, 38, 95, 129, 159, 192], "union": [22, 39, 100, 134, 164, 197], "user_defined_enrich": [23, 40], "rankedset": [24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 215], "single_set_enrich": 35, "single_set_go_enrich": 36, "single_set_kegg_enrich": 37, "plot_enrichment_result": 41, "upset_plot": 42, "venn_diagram": 43, "countfilt": [45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 215], "average_replicate_sampl": 46, "biotypes_from_gtf": [47, 103, 137, 166], "biotypes_from_ref_t": [48, 104, 138, 167], "box_plot": 49, "clustergram": 50, "describ": [51, 105, 139, 168], "differential_expression_deseq2": 53, "enhanced_box_plot": 54, "filter_biotype_from_gtf": [55, 108, 141, 171], "filter_biotype_from_ref_t": [56, 109, 142, 172], "filter_by_attribut": [57, 110, 143, 173], "filter_by_go_annot": [58, 111, 144, 174], "filter_by_kegg_annot": [59, 112, 145, 175], "filter_by_row_sum": 60, "filter_low_read": 61, "filter_missing_valu": [62, 114, 146, 177], "filter_percentil": [63, 115, 147, 178], "filter_top_n": [64, 117, 148, 179], "fold_chang": 65, "from_datafram": [66, 118, 149, 180], "from_fold": 67, "head": [68, 119, 150, 181], "ma_plot": 70, "majority_vote_intersect": [71, 121, 152, 183], "normalize_median_of_ratio": 72, "normalize_rl": 73, "normalize_tmm": 74, "normalize_to_quantil": 75, "normalize_to_rpm": 76, "normalize_to_rpm_htseqcount": 77, "normalize_with_scaling_factor": 78, "number_filt": [79, 122, 153, 184], "pairplot": 80, "pca": 81, "plot_express": 82, "print_featur": [83, 123, 154, 185], "save_csv": [84, 124, 155, 187], "scatter_sample_vs_sampl": 85, "sort": [86, 125, 156, 188, 215], "split_by_attribut": [87, 126, 157, 189], "split_by_percentil": [88, 127, 158, 190], "split_by_read": 89, "split_clicom": 90, "split_hdbscan": 91, "split_hierarch": 92, "split_kmean": 93, "split_kmedoid": 94, "tail": [96, 130, 160, 193], "text_filt": [97, 131, 161, 194], "transform": [98, 132, 162, 195], "translate_gene_id": [99, 133, 163, 196], "violin_plot": 101, "deseqfilt": [102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 215], "filter_abs_log2_fold_chang": [107, 170], "filter_fold_change_direct": [113, 176], "filter_signific": 116, "split_fold_change_direct": [128, 191], "volcano_plot": 135, "foldchangefilt": [165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 215], "randomization_test": 186, "pipelin": [198, 199, 200, 201, 202, 203, 214, 215], "add_funct": 199, "apply_to": 200, "export_pipelin": 201, "import_pipelin": 202, "remove_last_funct": 203, "readable_nam": 204, "user": 215, "guid": 215, "graphic": 215, "interfac": 215, "open": 215, "program": 215, "load": 215, "examin": [214, 215], "your": 215, "undo": 215, "oper": 215, "you": 215, "appli": [214, 215], "place": 215, "new": 215, "save": 215, "made": 215, "work": 215, "multipl": 215, "same": 215, "time": [214, 215], "type": [1, 215], "offer": 215, "wai": 215, "analyz": 215, "data": [214, 215], "creat": [214, 215], "graph": 215, "tab": 215, "icon": 215, "restor": 215, "close": 215, "import": 215, "list": 215, "gene": [214, 215], "set": [214, 215], "visual": [214, 215], "between": [214, 215], "perform": 215, "analysi": [214, 215], "streamlin": 215, "one": 215, "more": 215, "export": 215, "share": 215, "make": 215, "reproduc": 215, "object": 215, "initi": 215, "view": 215, "result": 215, "us": [7, 215], "an": 215, "attribut": [214, 215], "deseq2": [214, 215], "output": 215, "file": [214, 215], "from": [6, 215], "csv": 215, "uniqu": 215, "exploratori": [214, 215], "count": 215, "matric": 215, "folder": 215, "htseq": 215, "txt": 215, "pre": 215, "normal": 215, "read": [214, 215], "cluster": [214, 215], "k": [214, 215], "mean": 215, "medoid": [214, 215], "hierarch": 215, "hdbscan": [214, 215], "clicom": [214, 215], "fold": 215, "featur": [1, 215], "exist": 215, "random": 215, "test": 215, "sequenti": 215, "go": 215, "defin": [214, 215], "correct": 215, "organ": 215, "id": 215, "dataset": [214, 215], "background": [214, 215], "choos": 215, "statist": 215, "option": 215, "term": 215, "aspect": 215, "annot": 215, "evid": 215, "code": 215, "databas": 215, "qualifi": 215, "propag": 215, "method": 215, "plot": 215, "paramet": 215, "kegg": 215, "pathwai": 215, "which": 215, "calcul": 215, "non": 215, "categor": 215, "visualis": 215, "singl": 215, "without": 215, "venn": [214, 215], "diagram": [214, 215], "upset": 215, "what": [7, 215], "i": [7, 215], "default": 215, "path": 215, "pars": 215, "c": 215, "elegan": 215, "name": 215, "wbgene": 215, "sequenc": [214, 215], "regular": 215, "express": [214, 215], "contribut": 1, "report": 1, "bug": 1, "implement": 1, "write": 1, "submit": 1, "feedback": 1, "get": 1, "pull": 1, "request": 1, "guidelin": 1, "tip": 1, "deploi": 1, "index": 2, "25": 4, "instal": [6, 7], "stabl": 6, "releas": 6, "sourc": 6, "can": 7, "do": 7, "how": 7, "depend": 7, "credit": 7, "cite": 7, "develop": 7, "lead": 7, "contributor": 7, "parse_gene_name_str": 206, "parse_sequence_name_str": 207, "parse_wbgene_str": 208, "print_settings_fil": 209, "reset_settings_fil": 210, "save_to_csv": 211, "set_attr_ref_table_path": 212, "set_biotype_ref_table_path": 213, "A": 214, "z": 214, "tutori": 214, "exampl": 214, "intro": 214, "recommend": 214, "seri": 214, "rna": 214, "The": 214, "preprocess": 214, "out": 214, "lowli": 214, "varianc": 214, "our": 214, "princip": 214, "compon": 214, "similar": 214, "development": 214, "stage": 214, "compar": 214, "specif": 214, "over": 214, "simpl": 214, "approach": 214, "distanc": 214, "base": 214, "fine": 214, "tune": 214, "densiti": 214, "complex": 214, "ensembl": 214, "run": 214, "differenti": 214, "quantifi": 214, "fastq": 214, "qualiti": 214, "control": 214, "fastqc": 214, "trim": 214, "adapt": 214, "low": 214, "cutadapt": 214, "kallisto": 214, "custom": 214, "extract": 214, "interesct": 214, "subset": 214, "we": 214, "ar": 214, "interest": 214, "final": 214, "word": 214}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx": 57}, "alltitles": {"API Reference": [[0, "api-reference"]], "rnalysis.filtering module": [[0, "rnalysis-filtering-module"], [8, "rnalysis-filtering-module"]], "rnalysis.enrichment module": [[0, "rnalysis-enrichment-module"], [8, "rnalysis-enrichment-module"]], "rnalysis.general module": [[0, "rnalysis-general-module"], [8, "rnalysis-general-module"]], "rnalysis.utils module": [[0, "rnalysis-utils-module"]], "Contributing": [[1, "contributing"]], "Types of Contributions": [[1, "types-of-contributions"]], "Report Bugs": [[1, "report-bugs"]], "Fix Bugs": [[1, "fix-bugs"]], "Implement Features": [[1, "implement-features"]], "Write Documentation": [[1, "write-documentation"]], "Submit Feedback": [[1, "submit-feedback"]], "Get Started!": [[1, "get-started"]], "Pull Request Guidelines": [[1, "pull-request-guidelines"]], "Tips": [[1, "tips"]], "Deploying": [[1, "deploying"]], "Index": [[2, "index"]], "Glossary": [[3, "glossary"]], "History": [[4, "history"]], "3.2.1 (2022-11-25)": [[4, "id1"]], "Changed": [[4, "changed"], [4, "id3"], [4, "id7"], [4, "id12"], [4, "id15"], [4, "id18"], [4, "id22"], [4, "id26"], [4, "id30"], [4, "id33"], [4, "id37"]], "Fixed": [[4, "fixed"], [4, "id4"], [4, "id8"], [4, "id13"], [4, "id19"], [4, "id23"], [4, "id27"], [4, "id31"], [4, "id34"], [4, "id38"]], "3.2.0 (2022-11-23)": [[4, "id2"]], "Added": [[4, "added"], [4, "id6"], [4, "id11"], [4, "id17"], [4, "id21"], [4, "id25"], [4, "id29"], [4, "id36"]], "3.1.0 (2022-10-16)": [[4, "id5"]], "3.0.1 (2022-10-12)": [[4, "id9"]], "3.0.0 (2022-10-10)": [[4, "id10"]], "2.1.1 (2022-07-05)": [[4, "id14"]], "2.1.0 (2022-04-16)": [[4, "id16"]], "2.0.1 (2022-04-02)": [[4, "id20"]], "2.0.0 (2021-12-05)": [[4, "id24"]], "1.3.5 (2020-05-27)": [[4, "id28"]], "1.3.4 (2020-04-07)": [[4, "id32"]], "1.3.3 (2020-03-28)": [[4, "id35"]], "Removed": [[4, "removed"]], "1.3.2 (2019-12-11)": [[4, "id39"]], "RNAlysis 3.2.1 documentation": [[5, "rnalysis-release-documentation"]], "About RNAlysis:": [[5, null]], "Starting with RNAlysis:": [[5, null]], "Change history:": [[5, null]], "Modules:": [[5, "modules"]], "Indices and tables:": [[5, null]], "Installation": [[6, "installation"]], "Stable release": [[6, "stable-release"]], "From sources": [[6, "from-sources"]], "What is RNAlysis?": [[7, "what-is-rnalysis"]], "What can I do with RNAlysis?": [[7, "what-can-i-do-with-rnalysis"]], "How do I install it?": [[7, "how-do-i-install-it"]], "How do I use it?": [[7, "how-do-i-use-it"]], "Dependencies": [[7, "dependencies"]], "Credits": [[7, "credits"]], "How do I cite RNAlysis?": [[7, "how-do-i-cite-rnalysis"]], "Development Lead": [[7, "development-lead"]], "Contributors": [[7, "contributors"]], "rnalysis package": [[8, "rnalysis-package"]], "rnalysis.enrichment": [[9, "rnalysis-enrichment"]], "rnalysis.enrichment.FeatureSet": [[10, "rnalysis-enrichment-featureset"]], "rnalysis.enrichment.FeatureSet.biotypes": [[11, "rnalysis-enrichment-featureset-biotypes"]], "rnalysis.enrichment.FeatureSet.change_set_name": [[12, "rnalysis-enrichment-featureset-change-set-name"]], "rnalysis.enrichment.FeatureSet.difference": [[13, "rnalysis-enrichment-featureset-difference"]], "rnalysis.enrichment.FeatureSet.enrich_hypergeometric": [[14, "rnalysis-enrichment-featureset-enrich-hypergeometric"]], "rnalysis.enrichment.FeatureSet.enrich_randomization": [[15, "rnalysis-enrichment-featureset-enrich-randomization"]], "rnalysis.enrichment.FeatureSet.go_enrichment": [[16, "rnalysis-enrichment-featureset-go-enrichment"]], "rnalysis.enrichment.FeatureSet.intersection": [[17, "rnalysis-enrichment-featureset-intersection"]], "rnalysis.enrichment.FeatureSet.kegg_enrichment": [[18, "rnalysis-enrichment-featureset-kegg-enrichment"]], "rnalysis.enrichment.FeatureSet.non_categorical_enrichment": [[19, "rnalysis-enrichment-featureset-non-categorical-enrichment"]], "rnalysis.enrichment.FeatureSet.save_txt": [[20, "rnalysis-enrichment-featureset-save-txt"]], "rnalysis.enrichment.FeatureSet.symmetric_difference": [[21, "rnalysis-enrichment-featureset-symmetric-difference"]], "rnalysis.enrichment.FeatureSet.union": [[22, "rnalysis-enrichment-featureset-union"]], "rnalysis.enrichment.FeatureSet.user_defined_enrichment": [[23, "rnalysis-enrichment-featureset-user-defined-enrichment"]], "rnalysis.enrichment.RankedSet": [[24, "rnalysis-enrichment-rankedset"]], "rnalysis.enrichment.RankedSet.biotypes": [[25, "rnalysis-enrichment-rankedset-biotypes"]], "rnalysis.enrichment.RankedSet.change_set_name": [[26, "rnalysis-enrichment-rankedset-change-set-name"]], "rnalysis.enrichment.RankedSet.difference": [[27, "rnalysis-enrichment-rankedset-difference"]], "rnalysis.enrichment.RankedSet.enrich_hypergeometric": [[28, "rnalysis-enrichment-rankedset-enrich-hypergeometric"]], "rnalysis.enrichment.RankedSet.enrich_randomization": [[29, "rnalysis-enrichment-rankedset-enrich-randomization"]], "rnalysis.enrichment.RankedSet.go_enrichment": [[30, "rnalysis-enrichment-rankedset-go-enrichment"]], "rnalysis.enrichment.RankedSet.intersection": [[31, "rnalysis-enrichment-rankedset-intersection"]], "rnalysis.enrichment.RankedSet.kegg_enrichment": [[32, "rnalysis-enrichment-rankedset-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.non_categorical_enrichment": [[33, "rnalysis-enrichment-rankedset-non-categorical-enrichment"]], "rnalysis.enrichment.RankedSet.save_txt": [[34, "rnalysis-enrichment-rankedset-save-txt"]], "rnalysis.enrichment.RankedSet.single_set_enrichment": [[35, "rnalysis-enrichment-rankedset-single-set-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_go_enrichment": [[36, "rnalysis-enrichment-rankedset-single-set-go-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment": [[37, "rnalysis-enrichment-rankedset-single-set-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.symmetric_difference": [[38, "rnalysis-enrichment-rankedset-symmetric-difference"]], "rnalysis.enrichment.RankedSet.union": [[39, "rnalysis-enrichment-rankedset-union"]], "rnalysis.enrichment.RankedSet.user_defined_enrichment": [[40, "rnalysis-enrichment-rankedset-user-defined-enrichment"]], "rnalysis.enrichment.plot_enrichment_results": [[41, "rnalysis-enrichment-plot-enrichment-results"]], "rnalysis.enrichment.upset_plot": [[42, "rnalysis-enrichment-upset-plot"]], "rnalysis.enrichment.venn_diagram": [[43, "rnalysis-enrichment-venn-diagram"]], "rnalysis.filtering": [[44, "rnalysis-filtering"]], "rnalysis.filtering.CountFilter": [[45, "rnalysis-filtering-countfilter"]], "rnalysis.filtering.CountFilter.average_replicate_samples": [[46, "rnalysis-filtering-countfilter-average-replicate-samples"]], "rnalysis.filtering.CountFilter.biotypes_from_gtf": [[47, "rnalysis-filtering-countfilter-biotypes-from-gtf"]], "rnalysis.filtering.CountFilter.biotypes_from_ref_table": [[48, "rnalysis-filtering-countfilter-biotypes-from-ref-table"]], "rnalysis.filtering.CountFilter.box_plot": [[49, "rnalysis-filtering-countfilter-box-plot"]], "rnalysis.filtering.CountFilter.clustergram": [[50, "rnalysis-filtering-countfilter-clustergram"]], "rnalysis.filtering.CountFilter.describe": [[51, "rnalysis-filtering-countfilter-describe"]], "rnalysis.filtering.CountFilter.difference": [[52, "rnalysis-filtering-countfilter-difference"]], "rnalysis.filtering.CountFilter.differential_expression_deseq2": [[53, "rnalysis-filtering-countfilter-differential-expression-deseq2"]], "rnalysis.filtering.CountFilter.enhanced_box_plot": [[54, "rnalysis-filtering-countfilter-enhanced-box-plot"]], "rnalysis.filtering.CountFilter.filter_biotype_from_gtf": [[55, "rnalysis-filtering-countfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table": [[56, "rnalysis-filtering-countfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.CountFilter.filter_by_attribute": [[57, "rnalysis-filtering-countfilter-filter-by-attribute"]], "rnalysis.filtering.CountFilter.filter_by_go_annotations": [[58, "rnalysis-filtering-countfilter-filter-by-go-annotations"]], "rnalysis.filtering.CountFilter.filter_by_kegg_annotations": [[59, "rnalysis-filtering-countfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.CountFilter.filter_by_row_sum": [[60, "rnalysis-filtering-countfilter-filter-by-row-sum"]], "rnalysis.filtering.CountFilter.filter_low_reads": [[61, "rnalysis-filtering-countfilter-filter-low-reads"]], "rnalysis.filtering.CountFilter.filter_missing_values": [[62, "rnalysis-filtering-countfilter-filter-missing-values"]], "rnalysis.filtering.CountFilter.filter_percentile": [[63, "rnalysis-filtering-countfilter-filter-percentile"]], "rnalysis.filtering.CountFilter.filter_top_n": [[64, "rnalysis-filtering-countfilter-filter-top-n"]], "rnalysis.filtering.CountFilter.fold_change": [[65, "rnalysis-filtering-countfilter-fold-change"]], "rnalysis.filtering.CountFilter.from_dataframe": [[66, "rnalysis-filtering-countfilter-from-dataframe"]], "rnalysis.filtering.CountFilter.from_folder": [[67, "rnalysis-filtering-countfilter-from-folder"]], "rnalysis.filtering.CountFilter.head": [[68, "rnalysis-filtering-countfilter-head"]], "rnalysis.filtering.CountFilter.intersection": [[69, "rnalysis-filtering-countfilter-intersection"]], "rnalysis.filtering.CountFilter.ma_plot": [[70, "rnalysis-filtering-countfilter-ma-plot"]], "rnalysis.filtering.CountFilter.majority_vote_intersection": [[71, "rnalysis-filtering-countfilter-majority-vote-intersection"]], "rnalysis.filtering.CountFilter.normalize_median_of_ratios": [[72, "rnalysis-filtering-countfilter-normalize-median-of-ratios"]], "rnalysis.filtering.CountFilter.normalize_rle": [[73, "rnalysis-filtering-countfilter-normalize-rle"]], "rnalysis.filtering.CountFilter.normalize_tmm": [[74, "rnalysis-filtering-countfilter-normalize-tmm"]], "rnalysis.filtering.CountFilter.normalize_to_quantile": [[75, "rnalysis-filtering-countfilter-normalize-to-quantile"]], "rnalysis.filtering.CountFilter.normalize_to_rpm": [[76, "rnalysis-filtering-countfilter-normalize-to-rpm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount": [[77, "rnalysis-filtering-countfilter-normalize-to-rpm-htseqcount"]], "rnalysis.filtering.CountFilter.normalize_with_scaling_factors": [[78, "rnalysis-filtering-countfilter-normalize-with-scaling-factors"]], "rnalysis.filtering.CountFilter.number_filters": [[79, "rnalysis-filtering-countfilter-number-filters"]], "rnalysis.filtering.CountFilter.pairplot": [[80, "rnalysis-filtering-countfilter-pairplot"]], "rnalysis.filtering.CountFilter.pca": [[81, "rnalysis-filtering-countfilter-pca"]], "rnalysis.filtering.CountFilter.plot_expression": [[82, "rnalysis-filtering-countfilter-plot-expression"]], "rnalysis.filtering.CountFilter.print_features": [[83, "rnalysis-filtering-countfilter-print-features"]], "rnalysis.filtering.CountFilter.save_csv": [[84, "rnalysis-filtering-countfilter-save-csv"]], "rnalysis.filtering.CountFilter.scatter_sample_vs_sample": [[85, "rnalysis-filtering-countfilter-scatter-sample-vs-sample"]], "rnalysis.filtering.CountFilter.sort": [[86, "rnalysis-filtering-countfilter-sort"]], "rnalysis.filtering.CountFilter.split_by_attribute": [[87, "rnalysis-filtering-countfilter-split-by-attribute"]], "rnalysis.filtering.CountFilter.split_by_percentile": [[88, "rnalysis-filtering-countfilter-split-by-percentile"]], "rnalysis.filtering.CountFilter.split_by_reads": [[89, "rnalysis-filtering-countfilter-split-by-reads"]], "rnalysis.filtering.CountFilter.split_clicom": [[90, "rnalysis-filtering-countfilter-split-clicom"]], "rnalysis.filtering.CountFilter.split_hdbscan": [[91, "rnalysis-filtering-countfilter-split-hdbscan"]], "rnalysis.filtering.CountFilter.split_hierarchical": [[92, "rnalysis-filtering-countfilter-split-hierarchical"]], "rnalysis.filtering.CountFilter.split_kmeans": [[93, "rnalysis-filtering-countfilter-split-kmeans"]], "rnalysis.filtering.CountFilter.split_kmedoids": [[94, "rnalysis-filtering-countfilter-split-kmedoids"]], "rnalysis.filtering.CountFilter.symmetric_difference": [[95, "rnalysis-filtering-countfilter-symmetric-difference"]], "rnalysis.filtering.CountFilter.tail": [[96, "rnalysis-filtering-countfilter-tail"]], "rnalysis.filtering.CountFilter.text_filters": [[97, "rnalysis-filtering-countfilter-text-filters"]], "rnalysis.filtering.CountFilter.transform": [[98, "rnalysis-filtering-countfilter-transform"]], "rnalysis.filtering.CountFilter.translate_gene_ids": [[99, "rnalysis-filtering-countfilter-translate-gene-ids"]], "rnalysis.filtering.CountFilter.union": [[100, "rnalysis-filtering-countfilter-union"]], "rnalysis.filtering.CountFilter.violin_plot": [[101, "rnalysis-filtering-countfilter-violin-plot"]], "rnalysis.filtering.DESeqFilter": [[102, "rnalysis-filtering-deseqfilter"]], "rnalysis.filtering.DESeqFilter.biotypes_from_gtf": [[103, "rnalysis-filtering-deseqfilter-biotypes-from-gtf"]], "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table": [[104, "rnalysis-filtering-deseqfilter-biotypes-from-ref-table"]], "rnalysis.filtering.DESeqFilter.describe": [[105, "rnalysis-filtering-deseqfilter-describe"]], "rnalysis.filtering.DESeqFilter.difference": [[106, "rnalysis-filtering-deseqfilter-difference"]], "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change": [[107, "rnalysis-filtering-deseqfilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf": [[108, "rnalysis-filtering-deseqfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table": [[109, "rnalysis-filtering-deseqfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.DESeqFilter.filter_by_attribute": [[110, "rnalysis-filtering-deseqfilter-filter-by-attribute"]], "rnalysis.filtering.DESeqFilter.filter_by_go_annotations": [[111, "rnalysis-filtering-deseqfilter-filter-by-go-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations": [[112, "rnalysis-filtering-deseqfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.DESeqFilter.filter_fold_change_direction": [[113, "rnalysis-filtering-deseqfilter-filter-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.filter_missing_values": [[114, "rnalysis-filtering-deseqfilter-filter-missing-values"]], "rnalysis.filtering.DESeqFilter.filter_percentile": [[115, "rnalysis-filtering-deseqfilter-filter-percentile"]], "rnalysis.filtering.DESeqFilter.filter_significant": [[116, "rnalysis-filtering-deseqfilter-filter-significant"]], "rnalysis.filtering.DESeqFilter.filter_top_n": [[117, "rnalysis-filtering-deseqfilter-filter-top-n"]], "rnalysis.filtering.DESeqFilter.from_dataframe": [[118, "rnalysis-filtering-deseqfilter-from-dataframe"]], "rnalysis.filtering.DESeqFilter.head": [[119, "rnalysis-filtering-deseqfilter-head"]], "rnalysis.filtering.DESeqFilter.intersection": [[120, "rnalysis-filtering-deseqfilter-intersection"]], "rnalysis.filtering.DESeqFilter.majority_vote_intersection": [[121, "rnalysis-filtering-deseqfilter-majority-vote-intersection"]], "rnalysis.filtering.DESeqFilter.number_filters": [[122, "rnalysis-filtering-deseqfilter-number-filters"]], "rnalysis.filtering.DESeqFilter.print_features": [[123, "rnalysis-filtering-deseqfilter-print-features"]], "rnalysis.filtering.DESeqFilter.save_csv": [[124, "rnalysis-filtering-deseqfilter-save-csv"]], "rnalysis.filtering.DESeqFilter.sort": [[125, "rnalysis-filtering-deseqfilter-sort"]], "rnalysis.filtering.DESeqFilter.split_by_attribute": [[126, "rnalysis-filtering-deseqfilter-split-by-attribute"]], "rnalysis.filtering.DESeqFilter.split_by_percentile": [[127, "rnalysis-filtering-deseqfilter-split-by-percentile"]], "rnalysis.filtering.DESeqFilter.split_fold_change_direction": [[128, "rnalysis-filtering-deseqfilter-split-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.symmetric_difference": [[129, "rnalysis-filtering-deseqfilter-symmetric-difference"]], "rnalysis.filtering.DESeqFilter.tail": [[130, "rnalysis-filtering-deseqfilter-tail"]], "rnalysis.filtering.DESeqFilter.text_filters": [[131, "rnalysis-filtering-deseqfilter-text-filters"]], "rnalysis.filtering.DESeqFilter.transform": [[132, "rnalysis-filtering-deseqfilter-transform"]], "rnalysis.filtering.DESeqFilter.translate_gene_ids": [[133, "rnalysis-filtering-deseqfilter-translate-gene-ids"]], "rnalysis.filtering.DESeqFilter.union": [[134, "rnalysis-filtering-deseqfilter-union"]], "rnalysis.filtering.DESeqFilter.volcano_plot": [[135, "rnalysis-filtering-deseqfilter-volcano-plot"]], "rnalysis.filtering.Filter": [[136, "rnalysis-filtering-filter"]], "rnalysis.filtering.Filter.biotypes_from_gtf": [[137, "rnalysis-filtering-filter-biotypes-from-gtf"]], "rnalysis.filtering.Filter.biotypes_from_ref_table": [[138, "rnalysis-filtering-filter-biotypes-from-ref-table"]], "rnalysis.filtering.Filter.describe": [[139, "rnalysis-filtering-filter-describe"]], "rnalysis.filtering.Filter.difference": [[140, "rnalysis-filtering-filter-difference"]], "rnalysis.filtering.Filter.filter_biotype_from_gtf": [[141, "rnalysis-filtering-filter-filter-biotype-from-gtf"]], "rnalysis.filtering.Filter.filter_biotype_from_ref_table": [[142, "rnalysis-filtering-filter-filter-biotype-from-ref-table"]], "rnalysis.filtering.Filter.filter_by_attribute": [[143, "rnalysis-filtering-filter-filter-by-attribute"]], "rnalysis.filtering.Filter.filter_by_go_annotations": [[144, "rnalysis-filtering-filter-filter-by-go-annotations"]], "rnalysis.filtering.Filter.filter_by_kegg_annotations": [[145, "rnalysis-filtering-filter-filter-by-kegg-annotations"]], "rnalysis.filtering.Filter.filter_missing_values": [[146, "rnalysis-filtering-filter-filter-missing-values"]], "rnalysis.filtering.Filter.filter_percentile": [[147, "rnalysis-filtering-filter-filter-percentile"]], "rnalysis.filtering.Filter.filter_top_n": [[148, "rnalysis-filtering-filter-filter-top-n"]], "rnalysis.filtering.Filter.from_dataframe": [[149, "rnalysis-filtering-filter-from-dataframe"]], "rnalysis.filtering.Filter.head": [[150, "rnalysis-filtering-filter-head"]], "rnalysis.filtering.Filter.intersection": [[151, "rnalysis-filtering-filter-intersection"]], "rnalysis.filtering.Filter.majority_vote_intersection": [[152, "rnalysis-filtering-filter-majority-vote-intersection"]], "rnalysis.filtering.Filter.number_filters": [[153, "rnalysis-filtering-filter-number-filters"]], "rnalysis.filtering.Filter.print_features": [[154, "rnalysis-filtering-filter-print-features"]], "rnalysis.filtering.Filter.save_csv": [[155, "rnalysis-filtering-filter-save-csv"]], "rnalysis.filtering.Filter.sort": [[156, "rnalysis-filtering-filter-sort"]], "rnalysis.filtering.Filter.split_by_attribute": [[157, "rnalysis-filtering-filter-split-by-attribute"]], "rnalysis.filtering.Filter.split_by_percentile": [[158, "rnalysis-filtering-filter-split-by-percentile"]], "rnalysis.filtering.Filter.symmetric_difference": [[159, "rnalysis-filtering-filter-symmetric-difference"]], "rnalysis.filtering.Filter.tail": [[160, "rnalysis-filtering-filter-tail"]], "rnalysis.filtering.Filter.text_filters": [[161, "rnalysis-filtering-filter-text-filters"]], "rnalysis.filtering.Filter.transform": [[162, "rnalysis-filtering-filter-transform"]], "rnalysis.filtering.Filter.translate_gene_ids": [[163, "rnalysis-filtering-filter-translate-gene-ids"]], "rnalysis.filtering.Filter.union": [[164, "rnalysis-filtering-filter-union"]], "rnalysis.filtering.FoldChangeFilter": [[165, "rnalysis-filtering-foldchangefilter"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf": [[166, "rnalysis-filtering-foldchangefilter-biotypes-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table": [[167, "rnalysis-filtering-foldchangefilter-biotypes-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.describe": [[168, "rnalysis-filtering-foldchangefilter-describe"]], "rnalysis.filtering.FoldChangeFilter.difference": [[169, "rnalysis-filtering-foldchangefilter-difference"]], "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change": [[170, "rnalysis-filtering-foldchangefilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf": [[171, "rnalysis-filtering-foldchangefilter-filter-biotype-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table": [[172, "rnalysis-filtering-foldchangefilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.filter_by_attribute": [[173, "rnalysis-filtering-foldchangefilter-filter-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations": [[174, "rnalysis-filtering-foldchangefilter-filter-by-go-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations": [[175, "rnalysis-filtering-foldchangefilter-filter-by-kegg-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction": [[176, "rnalysis-filtering-foldchangefilter-filter-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.filter_missing_values": [[177, "rnalysis-filtering-foldchangefilter-filter-missing-values"]], "rnalysis.filtering.FoldChangeFilter.filter_percentile": [[178, "rnalysis-filtering-foldchangefilter-filter-percentile"]], "rnalysis.filtering.FoldChangeFilter.filter_top_n": [[179, "rnalysis-filtering-foldchangefilter-filter-top-n"]], "rnalysis.filtering.FoldChangeFilter.from_dataframe": [[180, "rnalysis-filtering-foldchangefilter-from-dataframe"]], "rnalysis.filtering.FoldChangeFilter.head": [[181, "rnalysis-filtering-foldchangefilter-head"]], "rnalysis.filtering.FoldChangeFilter.intersection": [[182, "rnalysis-filtering-foldchangefilter-intersection"]], "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection": [[183, "rnalysis-filtering-foldchangefilter-majority-vote-intersection"]], "rnalysis.filtering.FoldChangeFilter.number_filters": [[184, "rnalysis-filtering-foldchangefilter-number-filters"]], "rnalysis.filtering.FoldChangeFilter.print_features": [[185, "rnalysis-filtering-foldchangefilter-print-features"]], "rnalysis.filtering.FoldChangeFilter.randomization_test": [[186, "rnalysis-filtering-foldchangefilter-randomization-test"]], "rnalysis.filtering.FoldChangeFilter.save_csv": [[187, "rnalysis-filtering-foldchangefilter-save-csv"]], "rnalysis.filtering.FoldChangeFilter.sort": [[188, "rnalysis-filtering-foldchangefilter-sort"]], "rnalysis.filtering.FoldChangeFilter.split_by_attribute": [[189, "rnalysis-filtering-foldchangefilter-split-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.split_by_percentile": [[190, "rnalysis-filtering-foldchangefilter-split-by-percentile"]], "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction": [[191, "rnalysis-filtering-foldchangefilter-split-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.symmetric_difference": [[192, "rnalysis-filtering-foldchangefilter-symmetric-difference"]], "rnalysis.filtering.FoldChangeFilter.tail": [[193, "rnalysis-filtering-foldchangefilter-tail"]], "rnalysis.filtering.FoldChangeFilter.text_filters": [[194, "rnalysis-filtering-foldchangefilter-text-filters"]], "rnalysis.filtering.FoldChangeFilter.transform": [[195, "rnalysis-filtering-foldchangefilter-transform"]], "rnalysis.filtering.FoldChangeFilter.translate_gene_ids": [[196, "rnalysis-filtering-foldchangefilter-translate-gene-ids"]], "rnalysis.filtering.FoldChangeFilter.union": [[197, "rnalysis-filtering-foldchangefilter-union"]], "rnalysis.filtering.Pipeline": [[198, "rnalysis-filtering-pipeline"]], "rnalysis.filtering.Pipeline.add_function": [[199, "rnalysis-filtering-pipeline-add-function"]], "rnalysis.filtering.Pipeline.apply_to": [[200, "rnalysis-filtering-pipeline-apply-to"]], "rnalysis.filtering.Pipeline.export_pipeline": [[201, "rnalysis-filtering-pipeline-export-pipeline"]], "rnalysis.filtering.Pipeline.import_pipeline": [[202, "rnalysis-filtering-pipeline-import-pipeline"]], "rnalysis.filtering.Pipeline.remove_last_function": [[203, "rnalysis-filtering-pipeline-remove-last-function"]], "rnalysis.filtering.readable_name": [[204, "rnalysis-filtering-readable-name"]], "rnalysis.general": [[205, "rnalysis-general"]], "rnalysis.general.parse_gene_name_string": [[206, "rnalysis-general-parse-gene-name-string"]], "rnalysis.general.parse_sequence_name_string": [[207, "rnalysis-general-parse-sequence-name-string"]], "rnalysis.general.parse_wbgene_string": [[208, "rnalysis-general-parse-wbgene-string"]], "rnalysis.general.print_settings_file": [[209, "rnalysis-general-print-settings-file"]], "rnalysis.general.reset_settings_file": [[210, "rnalysis-general-reset-settings-file"]], "rnalysis.general.save_to_csv": [[211, "rnalysis-general-save-to-csv"]], "rnalysis.general.set_attr_ref_table_path": [[212, "rnalysis-general-set-attr-ref-table-path"]], "rnalysis.general.set_biotype_ref_table_path": [[213, "rnalysis-general-set-biotype-ref-table-path"]], "A-to-Z tutorial - example analysis": [[214, "a-to-z-tutorial-example-analysis"]], "Intro and recommendations": [[214, "intro-and-recommendations"]], "Analysis #1 - time series RNA sequencing": [[214, "analysis-1-time-series-rna-sequencing"]], "The dataset": [[214, "the-dataset"], [214, "id5"]], "Data preprocessing and exploratory data analysis": [[214, "data-preprocessing-and-exploratory-data-analysis"]], "Filter out lowly-expressed genes": [[214, "filter-out-lowly-expressed-genes"]], "Examine variance in our data with Principal Component Analysis": [[214, "examine-variance-in-our-data-with-principal-component-analysis"]], "Examine similarity between developmental stages": [[214, "examine-similarity-between-developmental-stages"]], "Compare the expression of specific genes over the developmental stages": [[214, "compare-the-expression-of-specific-genes-over-the-developmental-stages"]], "Clustering analysis": [[214, "clustering-analysis"]], "The simple approach - distance-based clustering with K-Medoids": [[214, "the-simple-approach-distance-based-clustering-with-k-medoids"]], "Fine-tuning our approach - density-based clustering with HDBSCAN": [[214, "fine-tuning-our-approach-density-based-clustering-with-hdbscan"]], "The complex approach - ensemble-based clustering with CLICOM": [[214, "the-complex-approach-ensemble-based-clustering-with-clicom"]], "Enrichment analysis": [[214, "enrichment-analysis"], [214, "id8"]], "Running enrichment analysis": [[214, "running-enrichment-analysis"], [214, "id10"]], "Analysis #2 - differential expression data": [[214, "analysis-2-differential-expression-data"]], "Quantify FASTQ files and Differential Expression Analysis": [[214, "quantify-fastq-files-and-differential-expression-analysis"]], "Quality control with FastQC": [[214, "quality-control-with-fastqc"]], "Trim adapters and remove low-quality reads with CutAdapt": [[214, "trim-adapters-and-remove-low-quality-reads-with-cutadapt"]], "Quantify gene expression with kallisto": [[214, "quantify-gene-expression-with-kallisto"]], "Run differential expression analysis with DESeq2": [[214, "run-differential-expression-analysis-with-deseq2"]], "Data filtering and visualization with customized Pipelines": [[214, "data-filtering-and-visualization-with-customized-pipelines"]], "Create a customized Pipeline": [[214, "create-a-customized-pipeline"]], "Apply the Pipeline to our datasets": [[214, "apply-the-pipeline-to-our-datasets"]], "Visualizing and extracting gene set interesctions": [[214, "visualizing-and-extracting-gene-set-interesctions"]], "Create a Venn diagram": [[214, "create-a-venn-diagram"]], "Extract the gene subsets we are interested in": [[214, "extract-the-gene-subsets-we-are-interested-in"]], "Define a background set": [[214, "define-a-background-set"]], "Define our custom enrichment attributes": [[214, "define-our-custom-enrichment-attributes"]], "Final words": [[214, "final-words"]], "User guide": [[215, "user-guide"]], "RNAlysis graphical user interface": [[215, "rnalysis-graphical-user-interface"]], "Open the program": [[215, "open-the-program"]], "Load a table": [[215, "load-a-table"]], "Examine your table": [[215, "examine-your-table"]], "Filter your table": [[215, "filter-your-table"]], "Undo the operations you applied to your table": [[215, "undo-the-operations-you-applied-to-your-table"]], "Apply your operations \u2018in-place\u2019 or apply on a new table": [[215, "apply-your-operations-in-place-or-apply-on-a-new-table"]], "Save the changes you made to your table": [[215, "save-the-changes-you-made-to-your-table"]], "Work on multiple tables at the same time": [[215, "work-on-multiple-tables-at-the-same-time"]], "Different types of tables offer different ways to filter and analyze your data": [[215, "different-types-of-tables-offer-different-ways-to-filter-and-analyze-your-data"]], "Create and save graphs": [[215, "create-and-save-graphs"]], "Sort your tabs and change their icons": [[215, "sort-your-tabs-and-change-their-icons"]], "Restore tabs you closed": [[215, "restore-tabs-you-closed"]], "Import lists of genes as Gene Sets": [[215, "import-lists-of-genes-as-gene-sets"]], "Visualize the intersections between your tables and gene sets": [[215, "visualize-the-intersections-between-your-tables-and-gene-sets"]], "Apply set operations to your tables and gene sets": [[215, "apply-set-operations-to-your-tables-and-gene-sets"]], "Perform enrichment analysis on your tables and gene sets": [[215, "perform-enrichment-analysis-on-your-tables-and-gene-sets"]], "Create Pipelines to streamline your data analysis": [[215, "create-pipelines-to-streamline-your-data-analysis"]], "Apply Pipelines to one or more of your tables": [[215, "apply-pipelines-to-one-or-more-of-your-tables"]], "Export and share Pipelines to make your analysis more reproducible": [[215, "export-and-share-pipelines-to-make-your-analysis-more-reproducible"]], "RNAlysis filtering module": [[215, "rnalysis-filtering-module"]], "Working with Filter objects": [[215, "working-with-filter-objects"]], "Initialize a Filter object": [[215, "initialize-a-filter-object"]], "View a Filter object": [[215, "view-a-filter-object"]], "Filtering operations": [[215, "filtering-operations"]], "Performing set operations on multiple Filter objects": [[215, "performing-set-operations-on-multiple-filter-objects"]], "Saving Filter results": [[215, "saving-filter-results"]], "Using an Attribute Reference Table for filter operations": [[215, "using-an-attribute-reference-table-for-filter-operations"]], "Using a Biotype Reference Table for filter operations": [[215, "using-a-biotype-reference-table-for-filter-operations"]], "Filtering DESeq2 output files with filtering.DESeqFilter": [[215, "filtering-deseq2-output-files-with-filtering-deseqfilter"]], "Loading from a csv file": [[215, "loading-from-a-csv-file"]], "Filtering operations unique to DESeqFilter": [[215, "filtering-operations-unique-to-deseqfilter"]], "Data visualization and exploratory data analysis with DESeqFilter": [[215, "data-visualization-and-exploratory-data-analysis-with-deseqfilter"]], "Filtering count matrices with filtering.CountFilter": [[215, "filtering-count-matrices-with-filtering-countfilter"]], "Generating an CountFilter object from a folder of HTSeq-count output .txt files": [[215, "generating-an-countfilter-object-from-a-folder-of-htseq-count-output-txt-files"]], "Loading from a pre-made csv file": [[215, "loading-from-a-pre-made-csv-file"]], "Filtering operations unique to CountFilter": [[215, "filtering-operations-unique-to-countfilter"]], "Normalizing reads with CountFilter": [[215, "normalizing-reads-with-countfilter"]], "Data clustering with CountFilter": [[215, "data-clustering-with-countfilter"]], "K-Means clustering": [[215, "k-means-clustering"]], "K-Medoids clustering": [[215, "k-medoids-clustering"]], "Hierarchical clustering": [[215, "hierarchical-clustering"]], "HDBSCAN clustering": [[215, "hdbscan-clustering"]], "CLICOM clustering": [[215, "clicom-clustering"]], "Data visualization and exploratory data analysis with CountFilter": [[215, "data-visualization-and-exploratory-data-analysis-with-countfilter"]], "Filtering fold-change data of features using filtering.FoldChangeFilter": [[215, "filtering-fold-change-data-of-features-using-filtering-foldchangefilter"]], "Loading fold change data from a csv file": [[215, "loading-fold-change-data-from-a-csv-file"]], "Generating fold change data from an existing CountFilter object": [[215, "generating-fold-change-data-from-an-existing-countfilter-object"]], "Performing randomization tests on a FoldChangeFilter object": [[215, "performing-randomization-tests-on-a-foldchangefilter-object"]], "Sequentially applying filtering operations using Pipelines": [[215, "sequentially-applying-filtering-operations-using-pipelines"]], "RNAlysis enrichment module": [[215, "rnalysis-enrichment-module"]], "Working with FeatureSet objects": [[215, "working-with-featureset-objects"]], "Initialize an FeatureSet object": [[215, "initialize-an-featureset-object"]], "GO Enrichment": [[215, "go-enrichment"]], "Define the correct organism and gene ID type for your dataset": [[215, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [215, "id15"]], "Define the background set": [[215, "define-the-background-set"], [215, "id16"], [215, "id24"], [215, "id32"]], "Choose the statistical test (optional)": [[215, "choose-the-statistical-test-optional"], [215, "id17"], [215, "id25"], [215, "id33"]], "Filter GO Terms by GO aspects (optional)": [[215, "filter-go-terms-by-go-aspects-optional"]], "Filter GO Annotations by Evidence Codes (optional)": [[215, "filter-go-annotations-by-evidence-codes-optional"]], "Filter GO Annotations by database (optional)": [[215, "filter-go-annotations-by-database-optional"]], "Filter GO Annotations by Qualifiers (optional)": [[215, "filter-go-annotations-by-qualifiers-optional"]], "Choose annotation propagation method (optional)": [[215, "choose-annotation-propagation-method-optional"]], "Choose plotting parameters (optional)": [[215, "choose-plotting-parameters-optional"], [215, "id18"], [215, "id26"], [215, "id34"]], "Enrichment analysis output": [[215, "enrichment-analysis-output"], [215, "id23"], [215, "id31"]], "KEGG Pathways enrichment": [[215, "kegg-pathways-enrichment"]], "Enrichment analysis for user-defined attributes": [[215, "enrichment-analysis-for-user-defined-attributes"]], "Choose which user-defined attributes to calculate enrichment for": [[215, "choose-which-user-defined-attributes-to-calculate-enrichment-for"]], "Performing enrichment analysis for non-categorical user-defined attributes": [[215, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"]], "Choose which user-defined non-categorical attributes to calculate enrichment for": [[215, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"]], "Non-Categorical Enrichment analysis output": [[215, "non-categorical-enrichment-analysis-output"]], "Performing set operations and visualisation on multiple FeatureSet objects": [[215, "performing-set-operations-and-visualisation-on-multiple-featureset-objects"]], "Saving indices from FeatureSet to a .txt file": [[215, "saving-indices-from-featureset-to-a-txt-file"]], "Working with RankedSet objects": [[215, "working-with-rankedset-objects"]], "Initialize an RankedSet object": [[215, "initialize-an-rankedset-object"]], "Performing single-set GO Enrichment analysis without a background set": [[215, "performing-single-set-go-enrichment-analysis-without-a-background-set"]], "Performing single-set KEGG Enrichment analysis without a background set": [[215, "performing-single-set-kegg-enrichment-analysis-without-a-background-set"]], "Performing single-set enrichment analysis for user-defined attributes without a background set": [[215, "performing-single-set-enrichment-analysis-for-user-defined-attributes-without-a-background-set"]], "Visualizing sets, intersections, and enrichment": [[215, "visualizing-sets-intersections-and-enrichment"]], "Plotting results of enrichment analysis": [[215, "plotting-results-of-enrichment-analysis"]], "Plotting Venn Diagrams and UpSet Plots": [[215, "plotting-venn-diagrams-and-upset-plots"]], "RNAlysis general module": [[215, "rnalysis-general-module"]], "Set and load a Reference Table": [[215, "set-and-load-a-reference-table"]], "What is an Attribute Reference Table?": [[215, "what-is-an-attribute-reference-table"]], "What is a Biotype Reference Table?": [[215, "what-is-a-biotype-reference-table"]], "Set a Reference Table as default": [[215, "set-a-reference-table-as-default"]], "Load the default Attribute Reference Table path": [[215, "load-the-default-attribute-reference-table-path"]], "Parse C. elegans gene names, WBGene indices and sequence names using regular expressions": [[215, "parse-c-elegans-gene-names-wbgene-indices-and-sequence-names-using-regular-expressions"]]}, "indexentries": {"attribute reference table": [[3, "term-Attribute-Reference-Table"]], "biotype reference table": [[3, "term-Biotype-Reference-Table"]], "countfilter": [[3, "term-CountFilter"]], "deseqfilter": [[3, "term-DESeqFilter"]], "featureset": [[3, "term-FeatureSet"]], "filter": [[3, "term-Filter"]], "filter object": [[3, "term-Filter-object"]], "filter objects": [[3, "term-Filter-objects"]], "foldchangefilter": [[3, "term-FoldChangeFilter"]], "pipeline": [[3, "term-Pipeline"]], "rankedset": [[3, "term-RankedSet"]], "module": [[9, "module-rnalysis.enrichment"], [44, "module-rnalysis.filtering"], [205, "module-rnalysis.general"]], "rnalysis.enrichment": [[9, "module-rnalysis.enrichment"]], "featureset (class in rnalysis.enrichment)": [[10, "rnalysis.enrichment.FeatureSet"]], "__init__() (rnalysis.enrichment.featureset method)": [[10, "rnalysis.enrichment.FeatureSet.__init__"]], "biotypes() (rnalysis.enrichment.featureset method)": [[11, "rnalysis.enrichment.FeatureSet.biotypes"]], "change_set_name() (rnalysis.enrichment.featureset method)": [[12, "rnalysis.enrichment.FeatureSet.change_set_name"]], "difference() (rnalysis.enrichment.featureset method)": [[13, "rnalysis.enrichment.FeatureSet.difference"]], "enrich_hypergeometric() (rnalysis.enrichment.featureset method)": [[14, "rnalysis.enrichment.FeatureSet.enrich_hypergeometric"]], "enrich_randomization() (rnalysis.enrichment.featureset method)": [[15, "rnalysis.enrichment.FeatureSet.enrich_randomization"]], "go_enrichment() (rnalysis.enrichment.featureset method)": [[16, "rnalysis.enrichment.FeatureSet.go_enrichment"]], "intersection() (rnalysis.enrichment.featureset method)": [[17, "rnalysis.enrichment.FeatureSet.intersection"]], "kegg_enrichment() (rnalysis.enrichment.featureset method)": [[18, "rnalysis.enrichment.FeatureSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.featureset method)": [[19, "rnalysis.enrichment.FeatureSet.non_categorical_enrichment"]], "save_txt() (rnalysis.enrichment.featureset method)": [[20, "rnalysis.enrichment.FeatureSet.save_txt"]], "symmetric_difference() (rnalysis.enrichment.featureset method)": [[21, "rnalysis.enrichment.FeatureSet.symmetric_difference"]], "union() (rnalysis.enrichment.featureset method)": [[22, "rnalysis.enrichment.FeatureSet.union"]], "user_defined_enrichment() (rnalysis.enrichment.featureset method)": [[23, "rnalysis.enrichment.FeatureSet.user_defined_enrichment"]], "rankedset (class in rnalysis.enrichment)": [[24, "rnalysis.enrichment.RankedSet"]], "__init__() (rnalysis.enrichment.rankedset method)": [[24, "rnalysis.enrichment.RankedSet.__init__"]], "biotypes() (rnalysis.enrichment.rankedset method)": [[25, "rnalysis.enrichment.RankedSet.biotypes"]], "change_set_name() (rnalysis.enrichment.rankedset method)": [[26, "rnalysis.enrichment.RankedSet.change_set_name"]], "difference() (rnalysis.enrichment.rankedset method)": [[27, "rnalysis.enrichment.RankedSet.difference"]], "enrich_hypergeometric() (rnalysis.enrichment.rankedset method)": [[28, "rnalysis.enrichment.RankedSet.enrich_hypergeometric"]], "enrich_randomization() (rnalysis.enrichment.rankedset method)": [[29, "rnalysis.enrichment.RankedSet.enrich_randomization"]], "go_enrichment() (rnalysis.enrichment.rankedset method)": [[30, "rnalysis.enrichment.RankedSet.go_enrichment"]], "intersection() (rnalysis.enrichment.rankedset method)": [[31, "rnalysis.enrichment.RankedSet.intersection"]], "kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[32, "rnalysis.enrichment.RankedSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.rankedset method)": [[33, "rnalysis.enrichment.RankedSet.non_categorical_enrichment"]], "save_txt() (rnalysis.enrichment.rankedset method)": [[34, "rnalysis.enrichment.RankedSet.save_txt"]], "single_set_enrichment() (rnalysis.enrichment.rankedset method)": [[35, "rnalysis.enrichment.RankedSet.single_set_enrichment"]], "single_set_go_enrichment() (rnalysis.enrichment.rankedset method)": [[36, "rnalysis.enrichment.RankedSet.single_set_go_enrichment"]], "single_set_kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[37, "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment"]], "symmetric_difference() (rnalysis.enrichment.rankedset method)": [[38, "rnalysis.enrichment.RankedSet.symmetric_difference"]], "union() (rnalysis.enrichment.rankedset method)": [[39, "rnalysis.enrichment.RankedSet.union"]], "user_defined_enrichment() (rnalysis.enrichment.rankedset method)": [[40, "rnalysis.enrichment.RankedSet.user_defined_enrichment"]], "plot_enrichment_results() (in module rnalysis.enrichment)": [[41, "rnalysis.enrichment.plot_enrichment_results"]], "upset_plot() (in module rnalysis.enrichment)": [[42, "rnalysis.enrichment.upset_plot"]], "venn_diagram() (in module rnalysis.enrichment)": [[43, "rnalysis.enrichment.venn_diagram"]], "rnalysis.filtering": [[44, "module-rnalysis.filtering"]], "countfilter (class in rnalysis.filtering)": [[45, "rnalysis.filtering.CountFilter"]], "__init__() (rnalysis.filtering.countfilter method)": [[45, "rnalysis.filtering.CountFilter.__init__"]], "average_replicate_samples() (rnalysis.filtering.countfilter method)": [[46, "rnalysis.filtering.CountFilter.average_replicate_samples"]], "biotypes_from_gtf() (rnalysis.filtering.countfilter method)": [[47, "rnalysis.filtering.CountFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.countfilter method)": [[48, "rnalysis.filtering.CountFilter.biotypes_from_ref_table"]], "box_plot() (rnalysis.filtering.countfilter method)": [[49, "rnalysis.filtering.CountFilter.box_plot"]], "clustergram() (rnalysis.filtering.countfilter method)": [[50, "rnalysis.filtering.CountFilter.clustergram"]], "describe() (rnalysis.filtering.countfilter method)": [[51, "rnalysis.filtering.CountFilter.describe"]], "difference() (rnalysis.filtering.countfilter method)": [[52, "rnalysis.filtering.CountFilter.difference"]], "differential_expression_deseq2() (rnalysis.filtering.countfilter method)": [[53, "rnalysis.filtering.CountFilter.differential_expression_deseq2"]], "enhanced_box_plot() (rnalysis.filtering.countfilter method)": [[54, "rnalysis.filtering.CountFilter.enhanced_box_plot"]], "filter_biotype_from_gtf() (rnalysis.filtering.countfilter method)": [[55, "rnalysis.filtering.CountFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.countfilter method)": [[56, "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.countfilter method)": [[57, "rnalysis.filtering.CountFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.countfilter method)": [[58, "rnalysis.filtering.CountFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.countfilter method)": [[59, "rnalysis.filtering.CountFilter.filter_by_kegg_annotations"]], "filter_by_row_sum() (rnalysis.filtering.countfilter method)": [[60, "rnalysis.filtering.CountFilter.filter_by_row_sum"]], "filter_low_reads() (rnalysis.filtering.countfilter method)": [[61, "rnalysis.filtering.CountFilter.filter_low_reads"]], "filter_missing_values() (rnalysis.filtering.countfilter method)": [[62, "rnalysis.filtering.CountFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.countfilter method)": [[63, "rnalysis.filtering.CountFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.countfilter method)": [[64, "rnalysis.filtering.CountFilter.filter_top_n"]], "fold_change() (rnalysis.filtering.countfilter method)": [[65, "rnalysis.filtering.CountFilter.fold_change"]], "from_dataframe() (rnalysis.filtering.countfilter class method)": [[66, "rnalysis.filtering.CountFilter.from_dataframe"]], "from_folder() (rnalysis.filtering.countfilter class method)": [[67, "rnalysis.filtering.CountFilter.from_folder"]], "head() (rnalysis.filtering.countfilter method)": [[68, "rnalysis.filtering.CountFilter.head"]], "intersection() (rnalysis.filtering.countfilter method)": [[69, "rnalysis.filtering.CountFilter.intersection"]], "ma_plot() (rnalysis.filtering.countfilter method)": [[70, "rnalysis.filtering.CountFilter.ma_plot"]], "majority_vote_intersection() (rnalysis.filtering.countfilter method)": [[71, "rnalysis.filtering.CountFilter.majority_vote_intersection"]], "normalize_median_of_ratios() (rnalysis.filtering.countfilter method)": [[72, "rnalysis.filtering.CountFilter.normalize_median_of_ratios"]], "normalize_rle() (rnalysis.filtering.countfilter method)": [[73, "rnalysis.filtering.CountFilter.normalize_rle"]], "normalize_tmm() (rnalysis.filtering.countfilter method)": [[74, "rnalysis.filtering.CountFilter.normalize_tmm"]], "normalize_to_quantile() (rnalysis.filtering.countfilter method)": [[75, "rnalysis.filtering.CountFilter.normalize_to_quantile"]], "normalize_to_rpm() (rnalysis.filtering.countfilter method)": [[76, "rnalysis.filtering.CountFilter.normalize_to_rpm"]], "normalize_to_rpm_htseqcount() (rnalysis.filtering.countfilter method)": [[77, "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount"]], "normalize_with_scaling_factors() (rnalysis.filtering.countfilter method)": [[78, "rnalysis.filtering.CountFilter.normalize_with_scaling_factors"]], "number_filters() (rnalysis.filtering.countfilter method)": [[79, "rnalysis.filtering.CountFilter.number_filters"]], "pairplot() (rnalysis.filtering.countfilter method)": [[80, "rnalysis.filtering.CountFilter.pairplot"]], "pca() (rnalysis.filtering.countfilter method)": [[81, "rnalysis.filtering.CountFilter.pca"]], "plot_expression() (rnalysis.filtering.countfilter method)": [[82, "rnalysis.filtering.CountFilter.plot_expression"]], "print_features() (rnalysis.filtering.countfilter method)": [[83, "rnalysis.filtering.CountFilter.print_features"]], "save_csv() (rnalysis.filtering.countfilter method)": [[84, "rnalysis.filtering.CountFilter.save_csv"]], "scatter_sample_vs_sample() (rnalysis.filtering.countfilter method)": [[85, "rnalysis.filtering.CountFilter.scatter_sample_vs_sample"]], "sort() (rnalysis.filtering.countfilter method)": [[86, "rnalysis.filtering.CountFilter.sort"]], "split_by_attribute() (rnalysis.filtering.countfilter method)": [[87, "rnalysis.filtering.CountFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.countfilter method)": [[88, "rnalysis.filtering.CountFilter.split_by_percentile"]], "split_by_reads() (rnalysis.filtering.countfilter method)": [[89, "rnalysis.filtering.CountFilter.split_by_reads"]], "split_clicom() (rnalysis.filtering.countfilter method)": [[90, "rnalysis.filtering.CountFilter.split_clicom"]], "split_hdbscan() (rnalysis.filtering.countfilter method)": [[91, "rnalysis.filtering.CountFilter.split_hdbscan"]], "split_hierarchical() (rnalysis.filtering.countfilter method)": [[92, "rnalysis.filtering.CountFilter.split_hierarchical"]], "split_kmeans() (rnalysis.filtering.countfilter method)": [[93, "rnalysis.filtering.CountFilter.split_kmeans"]], "split_kmedoids() (rnalysis.filtering.countfilter method)": [[94, "rnalysis.filtering.CountFilter.split_kmedoids"]], "symmetric_difference() (rnalysis.filtering.countfilter method)": [[95, "rnalysis.filtering.CountFilter.symmetric_difference"]], "tail() (rnalysis.filtering.countfilter method)": [[96, "rnalysis.filtering.CountFilter.tail"]], "text_filters() (rnalysis.filtering.countfilter method)": [[97, "rnalysis.filtering.CountFilter.text_filters"]], "transform() (rnalysis.filtering.countfilter method)": [[98, "rnalysis.filtering.CountFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.countfilter method)": [[99, "rnalysis.filtering.CountFilter.translate_gene_ids"]], "union() (rnalysis.filtering.countfilter method)": [[100, "rnalysis.filtering.CountFilter.union"]], "violin_plot() (rnalysis.filtering.countfilter method)": [[101, "rnalysis.filtering.CountFilter.violin_plot"]], "deseqfilter (class in rnalysis.filtering)": [[102, "rnalysis.filtering.DESeqFilter"]], "__init__() (rnalysis.filtering.deseqfilter method)": [[102, "rnalysis.filtering.DESeqFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.deseqfilter method)": [[103, "rnalysis.filtering.DESeqFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[104, "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.deseqfilter method)": [[105, "rnalysis.filtering.DESeqFilter.describe"]], "difference() (rnalysis.filtering.deseqfilter method)": [[106, "rnalysis.filtering.DESeqFilter.difference"]], "filter_abs_log2_fold_change() (rnalysis.filtering.deseqfilter method)": [[107, "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.deseqfilter method)": [[108, "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[109, "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.deseqfilter method)": [[110, "rnalysis.filtering.DESeqFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.deseqfilter method)": [[111, "rnalysis.filtering.DESeqFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.deseqfilter method)": [[112, "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations"]], "filter_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[113, "rnalysis.filtering.DESeqFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.deseqfilter method)": [[114, "rnalysis.filtering.DESeqFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.deseqfilter method)": [[115, "rnalysis.filtering.DESeqFilter.filter_percentile"]], "filter_significant() (rnalysis.filtering.deseqfilter method)": [[116, "rnalysis.filtering.DESeqFilter.filter_significant"]], "filter_top_n() (rnalysis.filtering.deseqfilter method)": [[117, "rnalysis.filtering.DESeqFilter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.deseqfilter class method)": [[118, "rnalysis.filtering.DESeqFilter.from_dataframe"]], "head() (rnalysis.filtering.deseqfilter method)": [[119, "rnalysis.filtering.DESeqFilter.head"]], "intersection() (rnalysis.filtering.deseqfilter method)": [[120, "rnalysis.filtering.DESeqFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.deseqfilter method)": [[121, "rnalysis.filtering.DESeqFilter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.deseqfilter method)": [[122, "rnalysis.filtering.DESeqFilter.number_filters"]], "print_features() (rnalysis.filtering.deseqfilter method)": [[123, "rnalysis.filtering.DESeqFilter.print_features"]], "save_csv() (rnalysis.filtering.deseqfilter method)": [[124, "rnalysis.filtering.DESeqFilter.save_csv"]], "sort() (rnalysis.filtering.deseqfilter method)": [[125, "rnalysis.filtering.DESeqFilter.sort"]], "split_by_attribute() (rnalysis.filtering.deseqfilter method)": [[126, "rnalysis.filtering.DESeqFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.deseqfilter method)": [[127, "rnalysis.filtering.DESeqFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[128, "rnalysis.filtering.DESeqFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.deseqfilter method)": [[129, "rnalysis.filtering.DESeqFilter.symmetric_difference"]], "tail() (rnalysis.filtering.deseqfilter method)": [[130, "rnalysis.filtering.DESeqFilter.tail"]], "text_filters() (rnalysis.filtering.deseqfilter method)": [[131, "rnalysis.filtering.DESeqFilter.text_filters"]], "transform() (rnalysis.filtering.deseqfilter method)": [[132, "rnalysis.filtering.DESeqFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.deseqfilter method)": [[133, "rnalysis.filtering.DESeqFilter.translate_gene_ids"]], "union() (rnalysis.filtering.deseqfilter method)": [[134, "rnalysis.filtering.DESeqFilter.union"]], "volcano_plot() (rnalysis.filtering.deseqfilter method)": [[135, "rnalysis.filtering.DESeqFilter.volcano_plot"]], "filter (class in rnalysis.filtering)": [[136, "rnalysis.filtering.Filter"]], "__init__() (rnalysis.filtering.filter method)": [[136, "rnalysis.filtering.Filter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.filter method)": [[137, "rnalysis.filtering.Filter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.filter method)": [[138, "rnalysis.filtering.Filter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.filter method)": [[139, "rnalysis.filtering.Filter.describe"]], "difference() (rnalysis.filtering.filter method)": [[140, "rnalysis.filtering.Filter.difference"]], "filter_biotype_from_gtf() (rnalysis.filtering.filter method)": [[141, "rnalysis.filtering.Filter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.filter method)": [[142, "rnalysis.filtering.Filter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.filter method)": [[143, "rnalysis.filtering.Filter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.filter method)": [[144, "rnalysis.filtering.Filter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.filter method)": [[145, "rnalysis.filtering.Filter.filter_by_kegg_annotations"]], "filter_missing_values() (rnalysis.filtering.filter method)": [[146, "rnalysis.filtering.Filter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.filter method)": [[147, "rnalysis.filtering.Filter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.filter method)": [[148, "rnalysis.filtering.Filter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.filter class method)": [[149, "rnalysis.filtering.Filter.from_dataframe"]], "head() (rnalysis.filtering.filter method)": [[150, "rnalysis.filtering.Filter.head"]], "intersection() (rnalysis.filtering.filter method)": [[151, "rnalysis.filtering.Filter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.filter method)": [[152, "rnalysis.filtering.Filter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.filter method)": [[153, "rnalysis.filtering.Filter.number_filters"]], "print_features() (rnalysis.filtering.filter method)": [[154, "rnalysis.filtering.Filter.print_features"]], "save_csv() (rnalysis.filtering.filter method)": [[155, "rnalysis.filtering.Filter.save_csv"]], "sort() (rnalysis.filtering.filter method)": [[156, "rnalysis.filtering.Filter.sort"]], "split_by_attribute() (rnalysis.filtering.filter method)": [[157, "rnalysis.filtering.Filter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.filter method)": [[158, "rnalysis.filtering.Filter.split_by_percentile"]], "symmetric_difference() (rnalysis.filtering.filter method)": [[159, "rnalysis.filtering.Filter.symmetric_difference"]], "tail() (rnalysis.filtering.filter method)": [[160, "rnalysis.filtering.Filter.tail"]], "text_filters() (rnalysis.filtering.filter method)": [[161, "rnalysis.filtering.Filter.text_filters"]], "transform() (rnalysis.filtering.filter method)": [[162, "rnalysis.filtering.Filter.transform"]], "translate_gene_ids() (rnalysis.filtering.filter method)": [[163, "rnalysis.filtering.Filter.translate_gene_ids"]], "union() (rnalysis.filtering.filter method)": [[164, "rnalysis.filtering.Filter.union"]], "foldchangefilter (class in rnalysis.filtering)": [[165, "rnalysis.filtering.FoldChangeFilter"]], "__init__() (rnalysis.filtering.foldchangefilter method)": [[165, "rnalysis.filtering.FoldChangeFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[166, "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[167, "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.foldchangefilter method)": [[168, "rnalysis.filtering.FoldChangeFilter.describe"]], "difference() (rnalysis.filtering.foldchangefilter method)": [[169, "rnalysis.filtering.FoldChangeFilter.difference"]], "filter_abs_log2_fold_change() (rnalysis.filtering.foldchangefilter method)": [[170, "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[171, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[172, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[173, "rnalysis.filtering.FoldChangeFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.foldchangefilter method)": [[174, "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.foldchangefilter method)": [[175, "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations"]], "filter_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[176, "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.foldchangefilter method)": [[177, "rnalysis.filtering.FoldChangeFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.foldchangefilter method)": [[178, "rnalysis.filtering.FoldChangeFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.foldchangefilter method)": [[179, "rnalysis.filtering.FoldChangeFilter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.foldchangefilter class method)": [[180, "rnalysis.filtering.FoldChangeFilter.from_dataframe"]], "head() (rnalysis.filtering.foldchangefilter method)": [[181, "rnalysis.filtering.FoldChangeFilter.head"]], "intersection() (rnalysis.filtering.foldchangefilter method)": [[182, "rnalysis.filtering.FoldChangeFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.foldchangefilter method)": [[183, "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.foldchangefilter method)": [[184, "rnalysis.filtering.FoldChangeFilter.number_filters"]], "print_features() (rnalysis.filtering.foldchangefilter method)": [[185, "rnalysis.filtering.FoldChangeFilter.print_features"]], "randomization_test() (rnalysis.filtering.foldchangefilter method)": [[186, "rnalysis.filtering.FoldChangeFilter.randomization_test"]], "save_csv() (rnalysis.filtering.foldchangefilter method)": [[187, "rnalysis.filtering.FoldChangeFilter.save_csv"]], "sort() (rnalysis.filtering.foldchangefilter method)": [[188, "rnalysis.filtering.FoldChangeFilter.sort"]], "split_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[189, "rnalysis.filtering.FoldChangeFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.foldchangefilter method)": [[190, "rnalysis.filtering.FoldChangeFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[191, "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.foldchangefilter method)": [[192, "rnalysis.filtering.FoldChangeFilter.symmetric_difference"]], "tail() (rnalysis.filtering.foldchangefilter method)": [[193, "rnalysis.filtering.FoldChangeFilter.tail"]], "text_filters() (rnalysis.filtering.foldchangefilter method)": [[194, "rnalysis.filtering.FoldChangeFilter.text_filters"]], "transform() (rnalysis.filtering.foldchangefilter method)": [[195, "rnalysis.filtering.FoldChangeFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.foldchangefilter method)": [[196, "rnalysis.filtering.FoldChangeFilter.translate_gene_ids"]], "union() (rnalysis.filtering.foldchangefilter method)": [[197, "rnalysis.filtering.FoldChangeFilter.union"]], "pipeline (class in rnalysis.filtering)": [[198, "rnalysis.filtering.Pipeline"]], "__init__() (rnalysis.filtering.pipeline method)": [[198, "rnalysis.filtering.Pipeline.__init__"]], "add_function() (rnalysis.filtering.pipeline method)": [[199, "rnalysis.filtering.Pipeline.add_function"]], "apply_to() (rnalysis.filtering.pipeline method)": [[200, "rnalysis.filtering.Pipeline.apply_to"]], "export_pipeline() (rnalysis.filtering.pipeline method)": [[201, "rnalysis.filtering.Pipeline.export_pipeline"]], "import_pipeline() (rnalysis.filtering.pipeline class method)": [[202, "rnalysis.filtering.Pipeline.import_pipeline"]], "remove_last_function() (rnalysis.filtering.pipeline method)": [[203, "rnalysis.filtering.Pipeline.remove_last_function"]], "readable_name() (in module rnalysis.filtering)": [[204, "rnalysis.filtering.readable_name"]], "rnalysis.general": [[205, "module-rnalysis.general"]], "parse_gene_name_string() (in module rnalysis.general)": [[206, "rnalysis.general.parse_gene_name_string"]], "parse_sequence_name_string() (in module rnalysis.general)": [[207, "rnalysis.general.parse_sequence_name_string"]], "parse_wbgene_string() (in module rnalysis.general)": [[208, "rnalysis.general.parse_wbgene_string"]], "print_settings_file() (in module rnalysis.general)": [[209, "rnalysis.general.print_settings_file"]], "reset_settings_file() (in module rnalysis.general)": [[210, "rnalysis.general.reset_settings_file"]], "save_to_csv() (in module rnalysis.general)": [[211, "rnalysis.general.save_to_csv"]], "set_attr_ref_table_path() (in module rnalysis.general)": [[212, "rnalysis.general.set_attr_ref_table_path"]], "set_biotype_ref_table_path() (in module rnalysis.general)": [[213, "rnalysis.general.set_biotype_ref_table_path"]]}})
\ No newline at end of file
+Search.setIndex({"docnames": ["api_reference", "contributing", "genindex", "glossary", "history", "index", "installation", "readme", "rnalysis", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.biotypes", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric", "rnalysis.enrichment.FeatureSet.enrich_randomization", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.biotypes", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.enrich_hypergeometric", "rnalysis.enrichment.RankedSet.enrich_randomization", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.plot_enrichment_results", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.filtering.readable_name", "rnalysis.general", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "tutorial", "user_guide"], "filenames": ["api_reference.rst", "contributing.rst", "genindex.rst", "glossary.rst", "history.rst", "index.rst", "installation.rst", "readme.rst", "rnalysis.rst", "rnalysis.enrichment.rst", "rnalysis.enrichment.FeatureSet.rst", "rnalysis.enrichment.FeatureSet.biotypes.rst", "rnalysis.enrichment.FeatureSet.change_set_name.rst", "rnalysis.enrichment.FeatureSet.difference.rst", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric.rst", "rnalysis.enrichment.FeatureSet.enrich_randomization.rst", "rnalysis.enrichment.FeatureSet.go_enrichment.rst", "rnalysis.enrichment.FeatureSet.intersection.rst", "rnalysis.enrichment.FeatureSet.kegg_enrichment.rst", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment.rst", "rnalysis.enrichment.FeatureSet.save_txt.rst", "rnalysis.enrichment.FeatureSet.symmetric_difference.rst", "rnalysis.enrichment.FeatureSet.union.rst", "rnalysis.enrichment.FeatureSet.user_defined_enrichment.rst", "rnalysis.enrichment.RankedSet.rst", "rnalysis.enrichment.RankedSet.biotypes.rst", "rnalysis.enrichment.RankedSet.change_set_name.rst", "rnalysis.enrichment.RankedSet.difference.rst", "rnalysis.enrichment.RankedSet.enrich_hypergeometric.rst", "rnalysis.enrichment.RankedSet.enrich_randomization.rst", "rnalysis.enrichment.RankedSet.go_enrichment.rst", "rnalysis.enrichment.RankedSet.intersection.rst", "rnalysis.enrichment.RankedSet.kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.non_categorical_enrichment.rst", "rnalysis.enrichment.RankedSet.save_txt.rst", "rnalysis.enrichment.RankedSet.single_set_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_go_enrichment.rst", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment.rst", "rnalysis.enrichment.RankedSet.symmetric_difference.rst", "rnalysis.enrichment.RankedSet.union.rst", "rnalysis.enrichment.RankedSet.user_defined_enrichment.rst", "rnalysis.enrichment.plot_enrichment_results.rst", "rnalysis.enrichment.upset_plot.rst", "rnalysis.enrichment.venn_diagram.rst", "rnalysis.filtering.rst", "rnalysis.filtering.CountFilter.rst", "rnalysis.filtering.CountFilter.average_replicate_samples.rst", "rnalysis.filtering.CountFilter.biotypes_from_gtf.rst", "rnalysis.filtering.CountFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.CountFilter.box_plot.rst", "rnalysis.filtering.CountFilter.clustergram.rst", "rnalysis.filtering.CountFilter.describe.rst", "rnalysis.filtering.CountFilter.difference.rst", "rnalysis.filtering.CountFilter.differential_expression_deseq2.rst", "rnalysis.filtering.CountFilter.enhanced_box_plot.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.CountFilter.filter_by_attribute.rst", "rnalysis.filtering.CountFilter.filter_by_go_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.CountFilter.filter_by_row_sum.rst", "rnalysis.filtering.CountFilter.filter_low_reads.rst", "rnalysis.filtering.CountFilter.filter_missing_values.rst", "rnalysis.filtering.CountFilter.filter_percentile.rst", "rnalysis.filtering.CountFilter.filter_top_n.rst", "rnalysis.filtering.CountFilter.fold_change.rst", "rnalysis.filtering.CountFilter.from_dataframe.rst", "rnalysis.filtering.CountFilter.from_folder.rst", "rnalysis.filtering.CountFilter.head.rst", "rnalysis.filtering.CountFilter.intersection.rst", "rnalysis.filtering.CountFilter.ma_plot.rst", "rnalysis.filtering.CountFilter.majority_vote_intersection.rst", "rnalysis.filtering.CountFilter.normalize_median_of_ratios.rst", "rnalysis.filtering.CountFilter.normalize_rle.rst", "rnalysis.filtering.CountFilter.normalize_tmm.rst", "rnalysis.filtering.CountFilter.normalize_to_quantile.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm.rst", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount.rst", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors.rst", "rnalysis.filtering.CountFilter.number_filters.rst", "rnalysis.filtering.CountFilter.pairplot.rst", "rnalysis.filtering.CountFilter.pca.rst", "rnalysis.filtering.CountFilter.plot_expression.rst", "rnalysis.filtering.CountFilter.print_features.rst", "rnalysis.filtering.CountFilter.save_csv.rst", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample.rst", "rnalysis.filtering.CountFilter.sort.rst", "rnalysis.filtering.CountFilter.split_by_attribute.rst", "rnalysis.filtering.CountFilter.split_by_percentile.rst", "rnalysis.filtering.CountFilter.split_by_reads.rst", "rnalysis.filtering.CountFilter.split_clicom.rst", "rnalysis.filtering.CountFilter.split_hdbscan.rst", "rnalysis.filtering.CountFilter.split_hierarchical.rst", "rnalysis.filtering.CountFilter.split_kmeans.rst", "rnalysis.filtering.CountFilter.split_kmedoids.rst", "rnalysis.filtering.CountFilter.symmetric_difference.rst", "rnalysis.filtering.CountFilter.tail.rst", "rnalysis.filtering.CountFilter.text_filters.rst", "rnalysis.filtering.CountFilter.transform.rst", "rnalysis.filtering.CountFilter.translate_gene_ids.rst", "rnalysis.filtering.CountFilter.union.rst", "rnalysis.filtering.CountFilter.violin_plot.rst", "rnalysis.filtering.DESeqFilter.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf.rst", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.describe.rst", "rnalysis.filtering.DESeqFilter.difference.rst", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.DESeqFilter.filter_by_attribute.rst", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.filter_missing_values.rst", "rnalysis.filtering.DESeqFilter.filter_percentile.rst", "rnalysis.filtering.DESeqFilter.filter_significant.rst", "rnalysis.filtering.DESeqFilter.filter_top_n.rst", "rnalysis.filtering.DESeqFilter.from_dataframe.rst", "rnalysis.filtering.DESeqFilter.head.rst", "rnalysis.filtering.DESeqFilter.intersection.rst", "rnalysis.filtering.DESeqFilter.majority_vote_intersection.rst", "rnalysis.filtering.DESeqFilter.number_filters.rst", "rnalysis.filtering.DESeqFilter.print_features.rst", "rnalysis.filtering.DESeqFilter.save_csv.rst", "rnalysis.filtering.DESeqFilter.sort.rst", "rnalysis.filtering.DESeqFilter.split_by_attribute.rst", "rnalysis.filtering.DESeqFilter.split_by_percentile.rst", "rnalysis.filtering.DESeqFilter.split_fold_change_direction.rst", "rnalysis.filtering.DESeqFilter.symmetric_difference.rst", "rnalysis.filtering.DESeqFilter.tail.rst", "rnalysis.filtering.DESeqFilter.text_filters.rst", "rnalysis.filtering.DESeqFilter.transform.rst", "rnalysis.filtering.DESeqFilter.translate_gene_ids.rst", "rnalysis.filtering.DESeqFilter.union.rst", "rnalysis.filtering.DESeqFilter.volcano_plot.rst", "rnalysis.filtering.Filter.rst", "rnalysis.filtering.Filter.biotypes_from_gtf.rst", "rnalysis.filtering.Filter.biotypes_from_ref_table.rst", "rnalysis.filtering.Filter.describe.rst", "rnalysis.filtering.Filter.difference.rst", "rnalysis.filtering.Filter.filter_biotype_from_gtf.rst", "rnalysis.filtering.Filter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.Filter.filter_by_attribute.rst", "rnalysis.filtering.Filter.filter_by_go_annotations.rst", "rnalysis.filtering.Filter.filter_by_kegg_annotations.rst", "rnalysis.filtering.Filter.filter_missing_values.rst", "rnalysis.filtering.Filter.filter_percentile.rst", "rnalysis.filtering.Filter.filter_top_n.rst", "rnalysis.filtering.Filter.from_dataframe.rst", "rnalysis.filtering.Filter.head.rst", "rnalysis.filtering.Filter.intersection.rst", "rnalysis.filtering.Filter.majority_vote_intersection.rst", "rnalysis.filtering.Filter.number_filters.rst", "rnalysis.filtering.Filter.print_features.rst", "rnalysis.filtering.Filter.save_csv.rst", "rnalysis.filtering.Filter.sort.rst", "rnalysis.filtering.Filter.split_by_attribute.rst", "rnalysis.filtering.Filter.split_by_percentile.rst", "rnalysis.filtering.Filter.symmetric_difference.rst", "rnalysis.filtering.Filter.tail.rst", "rnalysis.filtering.Filter.text_filters.rst", "rnalysis.filtering.Filter.transform.rst", "rnalysis.filtering.Filter.translate_gene_ids.rst", "rnalysis.filtering.Filter.union.rst", "rnalysis.filtering.FoldChangeFilter.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.describe.rst", "rnalysis.filtering.FoldChangeFilter.difference.rst", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf.rst", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations.rst", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.filter_missing_values.rst", "rnalysis.filtering.FoldChangeFilter.filter_percentile.rst", "rnalysis.filtering.FoldChangeFilter.filter_top_n.rst", "rnalysis.filtering.FoldChangeFilter.from_dataframe.rst", "rnalysis.filtering.FoldChangeFilter.head.rst", "rnalysis.filtering.FoldChangeFilter.intersection.rst", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection.rst", "rnalysis.filtering.FoldChangeFilter.number_filters.rst", "rnalysis.filtering.FoldChangeFilter.print_features.rst", "rnalysis.filtering.FoldChangeFilter.randomization_test.rst", "rnalysis.filtering.FoldChangeFilter.save_csv.rst", "rnalysis.filtering.FoldChangeFilter.sort.rst", "rnalysis.filtering.FoldChangeFilter.split_by_attribute.rst", "rnalysis.filtering.FoldChangeFilter.split_by_percentile.rst", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction.rst", "rnalysis.filtering.FoldChangeFilter.symmetric_difference.rst", "rnalysis.filtering.FoldChangeFilter.tail.rst", "rnalysis.filtering.FoldChangeFilter.text_filters.rst", "rnalysis.filtering.FoldChangeFilter.transform.rst", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids.rst", "rnalysis.filtering.FoldChangeFilter.union.rst", "rnalysis.filtering.Pipeline.rst", "rnalysis.filtering.Pipeline.add_function.rst", "rnalysis.filtering.Pipeline.apply_to.rst", "rnalysis.filtering.Pipeline.export_pipeline.rst", "rnalysis.filtering.Pipeline.import_pipeline.rst", "rnalysis.filtering.Pipeline.remove_last_function.rst", "rnalysis.filtering.readable_name.rst", "rnalysis.general.rst", "rnalysis.general.parse_gene_name_string.rst", "rnalysis.general.parse_sequence_name_string.rst", "rnalysis.general.parse_wbgene_string.rst", "rnalysis.general.print_settings_file.rst", "rnalysis.general.reset_settings_file.rst", "rnalysis.general.save_to_csv.rst", "rnalysis.general.set_attr_ref_table_path.rst", "rnalysis.general.set_biotype_ref_table_path.rst", "tutorial.rst", "user_guide.rst"], "titles": ["API Reference", "Contributing", "Index", "Glossary", "History", "RNAlysis 3.2.2 documentation", "Installation", "What is <em>RNAlysis?</em>", "rnalysis package", "rnalysis.enrichment", "rnalysis.enrichment.FeatureSet", "rnalysis.enrichment.FeatureSet.biotypes", "rnalysis.enrichment.FeatureSet.change_set_name", "rnalysis.enrichment.FeatureSet.difference", "rnalysis.enrichment.FeatureSet.enrich_hypergeometric", "rnalysis.enrichment.FeatureSet.enrich_randomization", "rnalysis.enrichment.FeatureSet.go_enrichment", "rnalysis.enrichment.FeatureSet.intersection", "rnalysis.enrichment.FeatureSet.kegg_enrichment", "rnalysis.enrichment.FeatureSet.non_categorical_enrichment", "rnalysis.enrichment.FeatureSet.save_txt", "rnalysis.enrichment.FeatureSet.symmetric_difference", "rnalysis.enrichment.FeatureSet.union", "rnalysis.enrichment.FeatureSet.user_defined_enrichment", "rnalysis.enrichment.RankedSet", "rnalysis.enrichment.RankedSet.biotypes", "rnalysis.enrichment.RankedSet.change_set_name", "rnalysis.enrichment.RankedSet.difference", "rnalysis.enrichment.RankedSet.enrich_hypergeometric", "rnalysis.enrichment.RankedSet.enrich_randomization", "rnalysis.enrichment.RankedSet.go_enrichment", "rnalysis.enrichment.RankedSet.intersection", "rnalysis.enrichment.RankedSet.kegg_enrichment", "rnalysis.enrichment.RankedSet.non_categorical_enrichment", "rnalysis.enrichment.RankedSet.save_txt", "rnalysis.enrichment.RankedSet.single_set_enrichment", "rnalysis.enrichment.RankedSet.single_set_go_enrichment", "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment", "rnalysis.enrichment.RankedSet.symmetric_difference", "rnalysis.enrichment.RankedSet.union", "rnalysis.enrichment.RankedSet.user_defined_enrichment", "rnalysis.enrichment.plot_enrichment_results", "rnalysis.enrichment.upset_plot", "rnalysis.enrichment.venn_diagram", "rnalysis.filtering", "rnalysis.filtering.CountFilter", "rnalysis.filtering.CountFilter.average_replicate_samples", "rnalysis.filtering.CountFilter.biotypes_from_gtf", "rnalysis.filtering.CountFilter.biotypes_from_ref_table", "rnalysis.filtering.CountFilter.box_plot", "rnalysis.filtering.CountFilter.clustergram", "rnalysis.filtering.CountFilter.describe", "rnalysis.filtering.CountFilter.difference", "rnalysis.filtering.CountFilter.differential_expression_deseq2", "rnalysis.filtering.CountFilter.enhanced_box_plot", "rnalysis.filtering.CountFilter.filter_biotype_from_gtf", "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table", "rnalysis.filtering.CountFilter.filter_by_attribute", "rnalysis.filtering.CountFilter.filter_by_go_annotations", "rnalysis.filtering.CountFilter.filter_by_kegg_annotations", "rnalysis.filtering.CountFilter.filter_by_row_sum", "rnalysis.filtering.CountFilter.filter_low_reads", "rnalysis.filtering.CountFilter.filter_missing_values", "rnalysis.filtering.CountFilter.filter_percentile", "rnalysis.filtering.CountFilter.filter_top_n", "rnalysis.filtering.CountFilter.fold_change", "rnalysis.filtering.CountFilter.from_dataframe", "rnalysis.filtering.CountFilter.from_folder", "rnalysis.filtering.CountFilter.head", "rnalysis.filtering.CountFilter.intersection", "rnalysis.filtering.CountFilter.ma_plot", "rnalysis.filtering.CountFilter.majority_vote_intersection", "rnalysis.filtering.CountFilter.normalize_median_of_ratios", "rnalysis.filtering.CountFilter.normalize_rle", "rnalysis.filtering.CountFilter.normalize_tmm", "rnalysis.filtering.CountFilter.normalize_to_quantile", "rnalysis.filtering.CountFilter.normalize_to_rpm", "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount", "rnalysis.filtering.CountFilter.normalize_with_scaling_factors", "rnalysis.filtering.CountFilter.number_filters", "rnalysis.filtering.CountFilter.pairplot", "rnalysis.filtering.CountFilter.pca", "rnalysis.filtering.CountFilter.plot_expression", "rnalysis.filtering.CountFilter.print_features", "rnalysis.filtering.CountFilter.save_csv", "rnalysis.filtering.CountFilter.scatter_sample_vs_sample", "rnalysis.filtering.CountFilter.sort", "rnalysis.filtering.CountFilter.split_by_attribute", "rnalysis.filtering.CountFilter.split_by_percentile", "rnalysis.filtering.CountFilter.split_by_reads", "rnalysis.filtering.CountFilter.split_clicom", "rnalysis.filtering.CountFilter.split_hdbscan", "rnalysis.filtering.CountFilter.split_hierarchical", "rnalysis.filtering.CountFilter.split_kmeans", "rnalysis.filtering.CountFilter.split_kmedoids", "rnalysis.filtering.CountFilter.symmetric_difference", "rnalysis.filtering.CountFilter.tail", "rnalysis.filtering.CountFilter.text_filters", "rnalysis.filtering.CountFilter.transform", "rnalysis.filtering.CountFilter.translate_gene_ids", "rnalysis.filtering.CountFilter.union", "rnalysis.filtering.CountFilter.violin_plot", "rnalysis.filtering.DESeqFilter", "rnalysis.filtering.DESeqFilter.biotypes_from_gtf", "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table", "rnalysis.filtering.DESeqFilter.describe", "rnalysis.filtering.DESeqFilter.difference", "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change", "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf", "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table", "rnalysis.filtering.DESeqFilter.filter_by_attribute", "rnalysis.filtering.DESeqFilter.filter_by_go_annotations", "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations", "rnalysis.filtering.DESeqFilter.filter_fold_change_direction", "rnalysis.filtering.DESeqFilter.filter_missing_values", "rnalysis.filtering.DESeqFilter.filter_percentile", "rnalysis.filtering.DESeqFilter.filter_significant", "rnalysis.filtering.DESeqFilter.filter_top_n", "rnalysis.filtering.DESeqFilter.from_dataframe", "rnalysis.filtering.DESeqFilter.head", "rnalysis.filtering.DESeqFilter.intersection", "rnalysis.filtering.DESeqFilter.majority_vote_intersection", "rnalysis.filtering.DESeqFilter.number_filters", "rnalysis.filtering.DESeqFilter.print_features", "rnalysis.filtering.DESeqFilter.save_csv", "rnalysis.filtering.DESeqFilter.sort", "rnalysis.filtering.DESeqFilter.split_by_attribute", "rnalysis.filtering.DESeqFilter.split_by_percentile", "rnalysis.filtering.DESeqFilter.split_fold_change_direction", "rnalysis.filtering.DESeqFilter.symmetric_difference", "rnalysis.filtering.DESeqFilter.tail", "rnalysis.filtering.DESeqFilter.text_filters", "rnalysis.filtering.DESeqFilter.transform", "rnalysis.filtering.DESeqFilter.translate_gene_ids", "rnalysis.filtering.DESeqFilter.union", "rnalysis.filtering.DESeqFilter.volcano_plot", "rnalysis.filtering.Filter", "rnalysis.filtering.Filter.biotypes_from_gtf", "rnalysis.filtering.Filter.biotypes_from_ref_table", "rnalysis.filtering.Filter.describe", "rnalysis.filtering.Filter.difference", "rnalysis.filtering.Filter.filter_biotype_from_gtf", "rnalysis.filtering.Filter.filter_biotype_from_ref_table", "rnalysis.filtering.Filter.filter_by_attribute", "rnalysis.filtering.Filter.filter_by_go_annotations", "rnalysis.filtering.Filter.filter_by_kegg_annotations", "rnalysis.filtering.Filter.filter_missing_values", "rnalysis.filtering.Filter.filter_percentile", "rnalysis.filtering.Filter.filter_top_n", "rnalysis.filtering.Filter.from_dataframe", "rnalysis.filtering.Filter.head", "rnalysis.filtering.Filter.intersection", "rnalysis.filtering.Filter.majority_vote_intersection", "rnalysis.filtering.Filter.number_filters", "rnalysis.filtering.Filter.print_features", "rnalysis.filtering.Filter.save_csv", "rnalysis.filtering.Filter.sort", "rnalysis.filtering.Filter.split_by_attribute", "rnalysis.filtering.Filter.split_by_percentile", "rnalysis.filtering.Filter.symmetric_difference", "rnalysis.filtering.Filter.tail", "rnalysis.filtering.Filter.text_filters", "rnalysis.filtering.Filter.transform", "rnalysis.filtering.Filter.translate_gene_ids", "rnalysis.filtering.Filter.union", "rnalysis.filtering.FoldChangeFilter", "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf", "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table", "rnalysis.filtering.FoldChangeFilter.describe", "rnalysis.filtering.FoldChangeFilter.difference", "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf", "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table", "rnalysis.filtering.FoldChangeFilter.filter_by_attribute", "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations", "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations", "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.filter_missing_values", "rnalysis.filtering.FoldChangeFilter.filter_percentile", "rnalysis.filtering.FoldChangeFilter.filter_top_n", "rnalysis.filtering.FoldChangeFilter.from_dataframe", "rnalysis.filtering.FoldChangeFilter.head", "rnalysis.filtering.FoldChangeFilter.intersection", "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection", "rnalysis.filtering.FoldChangeFilter.number_filters", "rnalysis.filtering.FoldChangeFilter.print_features", "rnalysis.filtering.FoldChangeFilter.randomization_test", "rnalysis.filtering.FoldChangeFilter.save_csv", "rnalysis.filtering.FoldChangeFilter.sort", "rnalysis.filtering.FoldChangeFilter.split_by_attribute", "rnalysis.filtering.FoldChangeFilter.split_by_percentile", "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction", "rnalysis.filtering.FoldChangeFilter.symmetric_difference", "rnalysis.filtering.FoldChangeFilter.tail", "rnalysis.filtering.FoldChangeFilter.text_filters", "rnalysis.filtering.FoldChangeFilter.transform", "rnalysis.filtering.FoldChangeFilter.translate_gene_ids", "rnalysis.filtering.FoldChangeFilter.union", "rnalysis.filtering.Pipeline", "rnalysis.filtering.Pipeline.add_function", "rnalysis.filtering.Pipeline.apply_to", "rnalysis.filtering.Pipeline.export_pipeline", "rnalysis.filtering.Pipeline.import_pipeline", "rnalysis.filtering.Pipeline.remove_last_function", "rnalysis.filtering.readable_name", "rnalysis.general", "rnalysis.general.parse_gene_name_string", "rnalysis.general.parse_sequence_name_string", "rnalysis.general.parse_wbgene_string", "rnalysis.general.print_settings_file", "rnalysis.general.reset_settings_file", "rnalysis.general.save_to_csv", "rnalysis.general.set_attr_ref_table_path", "rnalysis.general.set_biotype_ref_table_path", "A-to-Z tutorial - example analysis", "User guide"], "terms": {"privat": 0, "function": [0, 1, 3, 4, 7, 8, 9, 14, 15, 16, 18, 24, 28, 29, 30, 32, 36, 37, 41, 44, 45, 46, 49, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 81, 97, 98, 101, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 131, 132, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 161, 162, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 194, 195, 198, 199, 200, 203, 205, 214, 215], "ar": [0, 1, 4, 8, 13, 14, 15, 16, 18, 19, 23, 27, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 45, 57, 59, 61, 62, 65, 72, 74, 87, 90, 91, 102, 110, 112, 114, 126, 135, 136, 143, 145, 146, 157, 165, 173, 175, 177, 189, 215], "meant": [0, 45], "us": [0, 1, 3, 4, 5, 6, 8, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 44, 45, 46, 47, 48, 49, 50, 53, 54, 55, 56, 57, 65, 70, 72, 73, 74, 75, 77, 78, 84, 85, 87, 90, 91, 92, 93, 94, 101, 102, 103, 104, 108, 109, 110, 124, 126, 135, 136, 137, 138, 141, 142, 143, 155, 157, 165, 166, 167, 171, 172, 173, 186, 187, 189, 199, 209, 214], "out": [0, 4, 6, 7, 8, 42, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 74, 79, 88, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 127, 131, 141, 142, 143, 145, 146, 147, 148, 153, 158, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 190, 194, 215], "context": 0, "do": [0, 4, 5, 8, 16, 18, 30, 32, 36, 37, 55, 56, 59, 108, 109, 112, 141, 142, 145, 171, 172, 175, 199, 214, 215], "so": [0, 8, 72, 74, 214, 215], "mai": [0, 8, 43, 214, 215], "lead": [0, 4, 5, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 90, 91, 165, 214, 215], "unexpect": 0, "result": [0, 4, 8, 9, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 53, 62, 87, 88, 89, 90, 91, 92, 93, 94, 98, 114, 126, 127, 128, 132, 146, 157, 158, 162, 177, 186, 189, 190, 191, 195, 200, 205, 214], "thi": [0, 1, 3, 4, 6, 7, 8, 9, 13, 14, 15, 16, 17, 18, 21, 22, 23, 27, 28, 29, 30, 31, 32, 38, 39, 40, 42, 44, 45, 49, 53, 54, 64, 67, 72, 73, 74, 75, 86, 90, 92, 101, 117, 125, 148, 156, 165, 179, 188, 205, 210, 214, 215], "can": [0, 1, 3, 4, 5, 6, 8, 9, 15, 16, 20, 24, 29, 30, 34, 44, 45, 49, 52, 54, 57, 59, 67, 69, 80, 81, 82, 90, 101, 102, 106, 110, 112, 120, 140, 143, 145, 151, 169, 173, 175, 182, 198, 199, 206, 207, 208, 214, 215], "normal": [0, 3, 4, 7, 8, 44, 45, 49, 54, 67, 72, 73, 74, 75, 76, 77, 78, 90, 101, 199, 214], "intersect": [0, 4, 8, 9, 42, 44, 52, 57, 58, 59, 71, 106, 110, 111, 112, 121, 140, 143, 144, 145, 152, 169, 173, 174, 175, 183, 214], "visual": [0, 3, 4, 6, 7, 8, 9, 44, 81, 90, 91, 92, 93, 94], "tabular": [0, 3, 7, 8, 44, 214, 215], "data": [0, 3, 4, 5, 7, 8, 44, 47, 48, 55, 56, 67, 80, 82, 84, 90, 91, 92, 93, 94, 98, 103, 104, 108, 109, 124, 132, 135, 137, 138, 141, 142, 155, 162, 166, 167, 171, 172, 187, 195], "read": [0, 4, 7, 8, 16, 30, 36, 44, 49, 54, 57, 61, 67, 72, 74, 75, 76, 77, 78, 82, 85, 89, 90, 101, 110, 143, 173, 205], "count": [0, 3, 4, 7, 8, 10, 11, 24, 25, 44, 45, 46, 47, 48, 51, 52, 53, 56, 57, 60, 61, 64, 67, 71, 72, 73, 74, 75, 76, 77, 78, 82, 83, 85, 86, 87, 89, 95, 98, 100, 103, 104, 105, 106, 109, 110, 117, 121, 123, 125, 126, 129, 132, 134, 136, 137, 138, 139, 140, 142, 143, 148, 152, 154, 156, 157, 159, 162, 164, 166, 167, 168, 169, 172, 173, 179, 183, 185, 188, 189, 192, 195, 197, 214], "differenti": [0, 3, 4, 5, 7, 8, 44, 53, 74, 102, 215], "express": [0, 3, 4, 5, 7, 8, 24, 44, 46, 53, 61, 72, 73, 74, 75, 82, 89, 90, 91, 92, 93, 94, 102, 206, 207], "ani": [0, 1, 3, 4, 8, 16, 24, 30, 36, 44, 50, 58, 90, 98, 111, 132, 144, 162, 174, 195, 200, 206, 207, 208, 214, 215], "save": [0, 4, 8, 9, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 44, 45, 62, 67, 84, 87, 88, 89, 90, 91, 92, 93, 94, 98, 102, 114, 124, 126, 127, 128, 132, 136, 146, 155, 157, 158, 162, 165, 177, 186, 187, 189, 190, 191, 195, 200, 201, 205, 211, 214], "csv": [0, 3, 4, 8, 9, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 44, 45, 48, 51, 52, 53, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 84, 86, 87, 88, 89, 95, 96, 97, 98, 100, 102, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 164, 165, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 211, 214], "format": [0, 3, 4, 8, 16, 30, 36, 43, 44, 47, 48, 55, 67, 103, 104, 108, 137, 138, 141, 166, 167, 171, 206, 207, 208, 214, 215], "import": [0, 4, 7, 8, 10, 11, 13, 17, 21, 22, 24, 25, 27, 31, 38, 39, 44, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 165, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 202, 203, 206, 207, 208, 209, 212, 213], "perform": [0, 3, 4, 7, 8, 9, 16, 19, 30, 33, 36, 44, 50, 63, 81, 86, 88, 115, 125, 127, 147, 156, 158, 178, 186, 188, 190, 214], "variou": [0, 3, 4, 8, 10, 24, 44, 45, 102, 214, 215], "oper": [0, 1, 4, 8, 44, 45, 79, 86, 97, 102, 122, 125, 131, 136, 153, 156, 161, 165, 184, 188, 194, 200, 214], "your": [0, 1, 3, 4, 6, 7, 8, 16, 18, 30, 32, 36, 37, 42, 43, 44, 47, 55, 59, 90, 103, 108, 112, 137, 141, 145, 166, 171, 175, 214], "set": [0, 1, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 50, 52, 56, 69, 71, 74, 92, 95, 100, 102, 106, 109, 120, 121, 129, 134, 136, 140, 142, 151, 152, 159, 164, 165, 169, 172, 182, 183, 186, 192, 197, 205, 206, 207, 208, 209, 210, 212, 213], "union": [0, 4, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 62, 64, 65, 66, 69, 70, 71, 74, 77, 78, 80, 81, 82, 84, 85, 86, 87, 90, 91, 92, 93, 94, 95, 98, 99, 101, 102, 103, 104, 105, 106, 108, 109, 110, 111, 112, 114, 117, 118, 120, 121, 124, 125, 126, 129, 132, 133, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 148, 149, 151, 152, 155, 156, 157, 159, 162, 163, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 177, 179, 180, 182, 183, 187, 188, 189, 192, 195, 196, 198, 199, 200, 201, 202, 211, 214, 215], "etc": [0, 3, 4, 8, 9, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 40, 44, 53, 55, 56, 61, 67, 77, 85, 89, 108, 109, 141, 142, 171, 172, 205, 214, 215], "run": [0, 1, 3, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 44, 53, 90, 93, 94, 186, 215], "basic": [0, 3, 4, 6, 7, 8, 44, 214, 215], "exploratori": [0, 7, 8, 44], "analys": [0, 3, 7, 8, 9, 10, 24, 44, 165, 214, 215], "plot": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 44, 49, 50, 54, 70, 80, 81, 82, 85, 90, 91, 92, 93, 94, 101, 135, 199, 214], "pca": [0, 4, 8, 44, 214, 215], "clustergram": [0, 4, 8, 44, 215], "violin": [0, 8, 44, 101], "scatter": [0, 8, 44, 49, 54, 85, 214], "comput": [0, 4, 6, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 44, 58, 111, 144, 174, 214, 215], "more": [0, 1, 3, 4, 7, 8, 14, 16, 28, 30, 36, 42, 44, 51, 57, 59, 80, 90, 91, 105, 110, 112, 139, 143, 145, 168, 173, 175, 214], "when": [0, 1, 4, 8, 15, 29, 44, 45, 57, 59, 102, 110, 112, 136, 143, 145, 165, 173, 175, 199, 214, 215], "you": [0, 1, 3, 4, 6, 7, 8, 15, 16, 29, 30, 44, 47, 55, 72, 73, 74, 75, 90, 103, 108, 137, 141, 166, 171, 212, 213, 214], "modifi": [0, 4, 8, 44, 45, 86, 90, 102, 125, 136, 156, 165, 188, 214, 215], "its": [0, 3, 8, 44, 70, 82, 87, 90, 91, 92, 93, 94, 126, 157, 189, 214, 215], "new": [0, 1, 4, 8, 12, 13, 17, 21, 22, 26, 27, 31, 38, 39, 44, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 72, 73, 74, 75, 76, 77, 78, 79, 87, 88, 89, 90, 91, 92, 93, 94, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 126, 127, 128, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 157, 158, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 189, 190, 191, 194, 195, 200, 214], "file": [0, 1, 3, 4, 7, 8, 9, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 44, 45, 47, 53, 55, 56, 67, 77, 78, 84, 102, 103, 108, 109, 124, 136, 137, 141, 142, 155, 165, 166, 171, 172, 186, 187, 201, 202, 205, 209, 210, 211, 212, 213], "name": [0, 1, 3, 4, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 53, 54, 55, 56, 58, 59, 62, 63, 64, 65, 66, 67, 70, 72, 74, 78, 79, 80, 81, 82, 84, 85, 86, 87, 88, 97, 98, 99, 101, 102, 103, 104, 108, 109, 111, 112, 114, 115, 117, 118, 122, 124, 125, 126, 127, 131, 132, 133, 136, 137, 138, 141, 142, 144, 145, 146, 147, 148, 149, 153, 155, 156, 157, 158, 161, 162, 163, 165, 166, 167, 170, 171, 172, 174, 175, 176, 177, 178, 179, 180, 184, 186, 187, 188, 189, 190, 191, 194, 195, 196, 199, 202, 204, 206, 207, 211, 214], "includ": [0, 1, 4, 6, 7, 8, 9, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 40, 42, 43, 44, 48, 51, 67, 74, 80, 89, 104, 105, 138, 139, 167, 168, 199, 205, 214, 215], "default": [0, 3, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 124, 125, 129, 130, 131, 132, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 155, 156, 159, 160, 161, 162, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 186, 187, 188, 192, 193, 194, 195, 197, 198, 200, 214], "all": [0, 1, 4, 6, 7, 8, 14, 15, 16, 17, 18, 19, 22, 23, 24, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 42, 44, 45, 46, 49, 50, 51, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 67, 69, 70, 72, 74, 75, 80, 81, 82, 88, 89, 90, 91, 92, 93, 94, 98, 101, 102, 105, 107, 108, 109, 110, 112, 114, 115, 116, 120, 127, 132, 136, 139, 141, 142, 143, 145, 146, 147, 151, 158, 162, 165, 168, 170, 171, 172, 173, 175, 177, 178, 182, 190, 195, 199, 200, 214, 215], "order": [0, 3, 4, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 44, 45, 60, 61, 64, 83, 86, 87, 89, 117, 123, 125, 126, 148, 154, 156, 157, 179, 185, 188, 189, 199, 214, 215], "thei": [0, 1, 8, 44, 49, 54, 65, 71, 72, 74, 80, 81, 82, 85, 90, 101, 113, 121, 152, 176, 183, 200, 214, 215], "were": [0, 4, 8, 14, 28, 44, 45, 63, 87, 90, 91, 102, 115, 126, 136, 147, 157, 165, 178, 189, 214, 215], "allow": [0, 7, 8, 44, 90, 214, 215], "easi": [0, 8, 44, 214, 215], "traceback": [0, 8, 44], "class": [0, 4, 8, 9, 10, 24, 44, 45, 102, 136, 165, 198, 215], "countfilt": [0, 3, 4, 8, 10, 24, 106, 129, 140, 159, 169, 192, 198, 200], "fname": [0, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 102, 136, 165, 186, 215], "str": [0, 4, 8, 10, 11, 12, 14, 15, 16, 18, 19, 20, 23, 24, 25, 26, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 69, 70, 71, 72, 74, 77, 78, 79, 80, 81, 82, 84, 85, 86, 87, 88, 90, 91, 94, 95, 97, 98, 99, 100, 101, 102, 103, 104, 106, 108, 109, 110, 111, 112, 114, 115, 117, 118, 120, 121, 122, 124, 125, 126, 127, 129, 131, 132, 133, 134, 135, 136, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 151, 152, 153, 155, 156, 157, 158, 159, 161, 162, 163, 164, 165, 166, 167, 169, 171, 172, 173, 174, 175, 177, 178, 179, 180, 182, 183, 184, 186, 187, 188, 189, 190, 192, 194, 195, 196, 197, 198, 199, 201, 202, 204, 206, 207, 208, 211, 212, 213], "path": [0, 8, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 42, 43, 45, 47, 48, 53, 55, 56, 57, 59, 66, 67, 77, 78, 84, 87, 102, 103, 104, 108, 109, 110, 112, 118, 124, 126, 136, 137, 138, 141, 142, 143, 145, 149, 155, 157, 165, 166, 167, 171, 172, 173, 175, 180, 186, 187, 189, 201, 202, 211, 212, 213, 214], "tupl": [0, 8, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 45, 53, 81, 87, 88, 89, 90, 91, 92, 93, 94, 102, 126, 127, 128, 136, 157, 158, 165, 189, 190, 191, 200, 215], "drop_column": [0, 8, 45, 102, 136], "option": [0, 3, 4, 8, 10, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 41, 42, 43, 45, 57, 67, 74, 85, 91, 92, 93, 94, 102, 110, 135, 136, 143, 173, 186, 200, 201, 212, 213, 214], "list": [0, 1, 3, 4, 7, 8, 10, 14, 15, 16, 18, 19, 20, 23, 24, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 43, 45, 46, 49, 50, 51, 54, 55, 56, 57, 58, 59, 62, 64, 65, 70, 72, 80, 81, 82, 85, 86, 87, 90, 91, 92, 93, 94, 98, 101, 102, 105, 108, 109, 110, 111, 112, 114, 117, 125, 126, 132, 136, 139, 141, 142, 143, 144, 145, 146, 148, 156, 157, 162, 165, 168, 171, 172, 173, 174, 175, 177, 179, 188, 189, 195, 198, 214], "none": [0, 8, 10, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 57, 67, 74, 84, 85, 86, 91, 92, 93, 94, 102, 110, 124, 125, 135, 136, 143, 155, 156, 173, 186, 187, 188, 200, 201, 212, 213, 214], "is_norm": [0, 8, 45, 66], "bool": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 66, 67, 69, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 86, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120, 122, 125, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 153, 156, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 184, 186, 188, 194, 195, 196, 200], "fals": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 45, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 66, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 83, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120, 121, 122, 123, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 152, 153, 154, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 194, 195, 196, 199, 200, 214, 215], "base": [0, 3, 4, 7, 8, 16, 18, 30, 32, 36, 37, 50, 53, 58, 59, 89, 90, 91, 92, 93, 94, 98, 99, 111, 112, 128, 132, 133, 144, 145, 162, 163, 174, 175, 191, 195, 196, 215], "A": [0, 1, 3, 5, 8, 21, 38, 45, 49, 50, 54, 65, 70, 74, 80, 81, 82, 87, 89, 101, 102, 126, 136, 157, 165, 186, 189, 198, 206, 207, 215], "receiv": [0, 8, 10, 24, 41, 45, 78, 102, 206, 207, 208, 215], "matrix": [0, 4, 8, 42, 45, 46, 53, 72, 73, 74, 75, 76, 77, 90, 214], "accord": [0, 4, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 45, 57, 59, 63, 67, 84, 88, 102, 110, 112, 113, 115, 116, 124, 127, 143, 145, 147, 155, 158, 173, 175, 176, 178, 187, 190, 215], "characterist": [0, 8, 45, 102, 214], "attribut": [0, 3, 4, 7, 8, 9, 14, 15, 19, 23, 28, 29, 33, 35, 36, 40, 41, 42, 43, 45, 47, 55, 57, 59, 87, 102, 103, 108, 110, 112, 126, 136, 137, 141, 143, 145, 157, 165, 166, 171, 173, 175, 189, 198, 209, 212], "df": [0, 8, 45, 66, 102, 118, 136, 149, 165, 180, 211], "panda": [0, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41, 45, 47, 48, 51, 68, 96, 102, 103, 104, 105, 119, 130, 136, 137, 138, 139, 150, 160, 165, 166, 167, 168, 181, 186, 193, 211, 215], "datafram": [0, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 45, 47, 48, 51, 63, 66, 67, 68, 80, 88, 96, 102, 103, 104, 105, 115, 118, 119, 127, 130, 136, 137, 138, 139, 147, 149, 150, 158, 160, 165, 166, 167, 168, 178, 180, 181, 186, 190, 193, 211, 215], "contain": [0, 3, 4, 8, 41, 45, 47, 52, 53, 55, 67, 69, 77, 78, 87, 88, 89, 90, 91, 97, 102, 103, 106, 108, 120, 126, 127, 128, 131, 136, 137, 140, 141, 151, 157, 158, 161, 165, 166, 169, 171, 182, 186, 189, 190, 191, 194, 202, 205, 206, 207, 208, 214, 215], "content": [0, 8, 45, 102, 136, 165, 214, 215], "The": [0, 1, 3, 4, 6, 7, 8, 13, 14, 15, 16, 17, 18, 19, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 39, 40, 45, 47, 48, 49, 50, 51, 53, 54, 55, 56, 60, 61, 63, 67, 70, 71, 80, 81, 82, 88, 89, 90, 91, 92, 93, 94, 98, 101, 102, 103, 104, 105, 107, 108, 109, 115, 121, 127, 128, 132, 135, 136, 137, 138, 139, 141, 142, 147, 152, 158, 162, 165, 166, 167, 168, 170, 171, 172, 178, 183, 186, 190, 191, 195, 198, 206, 207, 208, 215], "i": [0, 1, 3, 4, 5, 8, 11, 14, 15, 16, 18, 19, 21, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 38, 40, 41, 42, 43, 45, 47, 48, 49, 51, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 81, 85, 86, 90, 91, 92, 93, 94, 97, 98, 101, 102, 103, 104, 105, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 121, 122, 125, 131, 132, 135, 136, 137, 138, 139, 141, 142, 143, 145, 146, 147, 148, 152, 153, 156, 161, 162, 165, 166, 167, 168, 170, 171, 172, 173, 175, 176, 177, 178, 179, 183, 184, 186, 188, 194, 195, 201, 203, 206, 207, 208, 210, 214], "upon": [0, 8, 45, 102, 136, 165], "usag": [0, 4, 8, 45, 102, 136, 165, 214, 215], "shape": [0, 8, 45, 51, 102, 105, 136, 139, 165, 168, 215], "row": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 45, 47, 48, 55, 56, 57, 60, 61, 62, 63, 64, 68, 79, 86, 96, 97, 102, 103, 104, 107, 108, 109, 110, 113, 114, 115, 116, 117, 119, 122, 125, 130, 131, 136, 137, 138, 141, 142, 143, 146, 147, 148, 150, 153, 156, 160, 161, 165, 166, 167, 170, 171, 172, 173, 176, 177, 178, 179, 181, 184, 186, 188, 193, 194, 214, 215], "column": [0, 3, 4, 8, 41, 42, 43, 45, 46, 47, 48, 51, 53, 57, 61, 62, 63, 64, 65, 68, 70, 72, 74, 76, 77, 78, 79, 86, 88, 96, 97, 98, 102, 103, 104, 105, 110, 114, 115, 117, 119, 122, 125, 127, 130, 131, 132, 136, 137, 138, 139, 143, 146, 147, 148, 150, 153, 156, 158, 160, 161, 162, 165, 166, 167, 168, 173, 177, 178, 179, 181, 184, 186, 188, 190, 193, 194, 195, 214, 215], "dimens": [0, 8, 45, 102, 136, 165, 214, 215], "pathlib": [0, 8, 11, 14, 15, 16, 18, 19, 20, 23, 25, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 42, 43, 45, 57, 67, 78, 84, 102, 110, 124, 136, 143, 155, 165, 173, 186, 187, 201, 202], "filenam": [0, 3, 4, 8, 20, 34, 45, 57, 87, 102, 110, 126, 136, 143, 157, 165, 173, 189, 201, 202, 211, 215], "purpos": [0, 8, 45, 102, 136, 165, 205, 214], "updat": [0, 1, 4, 8, 45, 102, 136, 165, 205, 212, 213, 214], "automat": [0, 4, 7, 8, 45, 46, 49, 50, 54, 65, 67, 70, 74, 80, 81, 84, 85, 90, 91, 92, 93, 94, 101, 102, 124, 135, 136, 155, 165, 187, 214, 215], "appli": [0, 3, 4, 8, 24, 45, 46, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 90, 91, 92, 93, 94, 97, 98, 102, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 131, 132, 136, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 161, 162, 165, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 194, 195, 198, 199, 200], "index_set": [0, 8, 45, 102, 136, 165, 215], "indic": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 49, 52, 54, 55, 56, 57, 59, 69, 71, 74, 83, 95, 100, 101, 102, 106, 107, 108, 109, 110, 112, 120, 121, 123, 129, 134, 136, 140, 141, 142, 143, 145, 151, 152, 154, 159, 164, 165, 169, 170, 171, 172, 173, 175, 182, 183, 185, 186, 192, 197, 205, 206, 207, 208, 214], "current": [0, 4, 6, 8, 13, 17, 21, 22, 27, 31, 38, 39, 45, 46, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 69, 72, 73, 74, 75, 76, 77, 78, 79, 83, 84, 97, 98, 102, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 122, 123, 124, 131, 132, 136, 140, 141, 142, 143, 145, 146, 147, 148, 151, 153, 154, 155, 161, 162, 165, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 184, 185, 187, 194, 195, 209, 215], "which": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 46, 47, 48, 51, 55, 56, 57, 59, 61, 63, 64, 67, 74, 75, 77, 78, 88, 89, 90, 91, 92, 98, 102, 103, 104, 105, 108, 109, 110, 112, 113, 115, 116, 117, 127, 132, 136, 137, 138, 139, 141, 142, 143, 145, 147, 148, 158, 162, 165, 166, 167, 168, 171, 172, 173, 175, 176, 178, 179, 186, 190, 195, 198, 214], "remov": [0, 7, 8, 45, 60, 61, 62, 63, 102, 114, 115, 116, 136, 146, 147, 165, 177, 178, 203, 215], "previous": [0, 8, 45, 102, 136, 165, 214, 215], "method": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 45, 50, 72, 73, 74, 75, 84, 90, 91, 92, 93, 94, 102, 124, 136, 155, 165, 187, 214], "index_str": [0, 4, 8, 45, 102, 136, 165, 215], "string": [0, 4, 8, 10, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 40, 45, 52, 55, 56, 57, 64, 69, 71, 82, 84, 85, 87, 90, 95, 100, 102, 106, 108, 109, 110, 117, 120, 121, 124, 126, 129, 134, 136, 140, 141, 142, 143, 148, 151, 152, 155, 157, 159, 164, 165, 169, 171, 172, 173, 179, 182, 183, 187, 189, 192, 197, 201, 202, 206, 207, 208, 215], "featur": [0, 3, 4, 6, 7, 8, 9, 10, 14, 15, 16, 18, 19, 20, 23, 24, 28, 29, 30, 32, 33, 34, 36, 37, 40, 42, 43, 45, 47, 48, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 82, 83, 85, 87, 88, 89, 90, 91, 92, 93, 94, 95, 97, 98, 100, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 121, 122, 123, 126, 127, 128, 129, 131, 132, 134, 135, 136, 137, 138, 140, 141, 142, 143, 145, 146, 147, 148, 151, 152, 153, 154, 157, 158, 159, 161, 162, 164, 165, 166, 167, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 183, 184, 185, 186, 189, 190, 191, 192, 194, 195, 197, 200, 205, 214], "separ": [0, 4, 7, 8, 45, 46, 67, 83, 90, 102, 123, 136, 154, 165, 185, 214, 215], "newlin": [0, 8, 45, 83, 102, 123, 136, 154, 165, 185, 215], "triplic": [0, 8, 45], "return": [0, 4, 8, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 125, 126, 127, 128, 129, 130, 131, 132, 134, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 156, 157, 158, 159, 160, 161, 162, 164, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 201, 202, 206, 207, 208, 214, 215], "nest": [0, 8, 45, 46, 72, 80, 90], "group": [0, 4, 8, 45, 46, 49, 54, 72, 80, 81, 82, 90, 101, 186, 214, 215], "alphabet": [0, 4, 8, 45], "For": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 45, 50, 51, 53, 59, 63, 80, 90, 91, 92, 94, 105, 107, 112, 115, 139, 145, 147, 168, 170, 175, 178, 186, 199, 214, 215], "exampl": [0, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 203, 206, 207, 208, 209, 212, 213, 215], "a_rep1": [0, 8, 45], "a_rep2": [0, 8, 45], "a_rep3": [0, 8, 45], "b_rep1": [0, 8, 45], "b_rep2": [0, 8, 45], "_b_rep3": [0, 8, 45], "_avg_subsampl": 0, "sample_group": [0, 8, 46, 72], "liter": [0, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 62, 69, 70, 71, 74, 79, 80, 81, 82, 85, 87, 90, 91, 92, 93, 94, 95, 97, 98, 99, 100, 101, 103, 104, 106, 108, 109, 110, 111, 112, 113, 114, 120, 121, 122, 126, 129, 131, 132, 133, 134, 135, 137, 138, 140, 141, 142, 143, 144, 145, 146, 151, 152, 153, 157, 159, 161, 162, 163, 164, 166, 167, 169, 171, 172, 173, 174, 175, 176, 177, 182, 183, 184, 189, 192, 194, 195, 196, 197], "mean": [0, 4, 8, 46, 48, 50, 51, 65, 70, 72, 73, 74, 90, 93, 104, 105, 138, 139, 167, 168, 214], "median": [0, 4, 8, 46, 49, 50, 54, 63, 72, 73, 101, 115, 147, 178, 214, 215], "geometric_mean": [0, 8, 46], "new_column_nam": [0, 8, 46], "auto": [0, 8, 16, 18, 30, 32, 36, 37, 46, 49, 50, 53, 54, 58, 59, 70, 74, 80, 81, 85, 92, 93, 94, 99, 101, 111, 112, 133, 135, 144, 145, 163, 174, 175, 196, 214], "avarag": 0, "subsampl": 0, "replic": [0, 3, 4, 8, 46, 49, 53, 54, 72, 80, 81, 82, 85, 90, 101, 214, 215], "specifi": [0, 4, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 49, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 74, 79, 80, 81, 82, 85, 86, 87, 88, 89, 90, 92, 97, 98, 101, 102, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 125, 126, 127, 131, 132, 136, 141, 142, 143, 145, 146, 147, 148, 153, 156, 157, 158, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 188, 189, 190, 194, 195, 211, 214, 215], "sampl": [0, 7, 8, 19, 33, 46, 49, 50, 53, 54, 61, 72, 73, 74, 75, 78, 80, 81, 82, 85, 89, 91, 101, 214, 215], "everi": [0, 1, 3, 4, 8, 57, 59, 81, 85, 90, 110, 112, 143, 145, 173, 175, 186, 214, 215], "member": [0, 8, 91], "should": [0, 1, 4, 6, 7, 8, 45, 46, 47, 51, 53, 55, 60, 61, 72, 74, 90, 98, 102, 103, 105, 108, 132, 137, 139, 141, 162, 165, 166, 168, 171, 195, 214, 215], "either": [0, 4, 8, 14, 15, 16, 18, 19, 21, 23, 28, 29, 30, 32, 33, 38, 40, 42, 43, 57, 69, 95, 110, 120, 129, 143, 151, 159, 173, 182, 192, 214, 215], "singl": [0, 3, 4, 7, 8, 49, 50, 54, 67, 80, 92, 93, 94, 101, 165, 214], "multipl": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 39, 40, 42, 49, 54, 57, 59, 64, 65, 80, 81, 82, 86, 87, 90, 91, 92, 93, 94, 100, 101, 110, 112, 117, 125, 126, 134, 143, 145, 148, 156, 157, 164, 173, 175, 179, 188, 189, 197, 214], "averag": [0, 8, 46, 49, 50, 54, 65, 80, 82, 85, 90, 91, 92, 101, 214, 215], "paramet": [0, 4, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 38, 39, 40, 41, 42, 43, 45, 46, 47, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 82, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 105, 106, 107, 108, 109, 110, 112, 113, 115, 116, 117, 119, 120, 121, 122, 124, 125, 126, 127, 129, 130, 131, 132, 134, 135, 136, 137, 139, 140, 141, 142, 143, 145, 147, 148, 150, 151, 152, 153, 155, 156, 157, 158, 159, 160, 161, 162, 164, 165, 166, 168, 169, 170, 171, 172, 173, 175, 176, 178, 179, 181, 182, 183, 184, 186, 187, 188, 189, 190, 192, 193, 194, 195, 197, 198, 200, 201, 202, 203, 214], "pass": [0, 1, 215], "user": [0, 3, 4, 5, 7, 8, 9, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 47, 48, 53, 55, 56, 57, 91, 92, 94, 103, 104, 108, 109, 110, 137, 138, 141, 142, 143, 166, 167, 171, 172, 173, 214], "must": [0, 8, 49, 53, 54, 64, 72, 80, 81, 82, 86, 90, 92, 101, 117, 125, 148, 156, 179, 188, 200, 215], "present": [0, 8, 49, 54, 80, 81, 82, 101, 214], "object": [0, 3, 4, 8, 10, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 135, 136, 137, 138, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 165, 166, 167, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 205, 211], "To": [0, 1, 6, 7, 8, 16, 30, 36, 49, 53, 54, 57, 72, 73, 74, 75, 80, 81, 82, 90, 101, 110, 143, 173, 214, 215], "same": [0, 3, 8, 43, 45, 46, 49, 54, 64, 70, 72, 80, 81, 82, 86, 87, 90, 91, 92, 93, 94, 101, 102, 117, 125, 126, 136, 148, 156, 157, 179, 188, 189, 214], "condit": [0, 3, 8, 45, 46, 49, 53, 54, 65, 72, 80, 81, 82, 101, 113, 165, 176, 214, 215], "an": [0, 1, 3, 4, 7, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 41, 42, 43, 47, 49, 53, 54, 55, 57, 59, 67, 70, 72, 74, 80, 81, 82, 91, 92, 93, 94, 101, 103, 108, 110, 112, 136, 137, 141, 143, 145, 166, 171, 173, 175, 214], "inner": [0, 8, 49, 54, 80, 81, 82, 101], "input": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 40, 49, 50, 54, 67, 80, 81, 82, 84, 101, 124, 155, 187, 214, 215], "sample1a": [0, 8, 49, 54, 80, 81, 82, 101], "sample1b": [0, 8, 49, 54, 80, 81, 82, 101], "sample1c": [0, 8, 49, 54, 80, 81, 82, 101], "sample2a": [0, 8, 49, 54, 80, 81, 82, 101], "sample2b": [0, 8, 49, 54, 80, 81, 82, 101], "sample2c": [0, 8, 49, 54, 80, 81, 82, 101], "sample3": [0, 8, 49, 54, 80, 81, 82, 101, 215], "sample6": [0, 8, 49, 54, 80, 81, 82, 101], "output": [0, 3, 8, 20, 34, 41, 51, 55, 56, 57, 59, 60, 61, 62, 63, 64, 77, 79, 93, 94, 97, 102, 105, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 136, 139, 141, 142, 143, 145, 146, 147, 148, 153, 161, 168, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 200, 214], "follow": [0, 6, 7, 8, 53, 90, 214, 215], "sample1": [0, 8, 85, 215], "sample2": [0, 8, 85, 215], "sample_list": 0, "static": 0, "_from_str": 0, "msg": 0, "delimit": [0, 4, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197], "n": [0, 4, 7, 8, 14, 28, 64, 68, 96, 117, 119, 130, 148, 150, 160, 179, 181, 193, 200, 214, 215], "take": [0, 8, 42, 90, 214, 215], "manual": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 215], "from": [0, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 47, 48, 51, 52, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 102, 103, 104, 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 137, 138, 139, 140, 141, 142, 143, 145, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 166, 167, 168, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 198, 199, 200, 202, 203, 206, 207, 208, 209, 212, 213, 214], "split": [0, 3, 4, 8, 87, 88, 89, 90, 91, 92, 93, 94, 126, 127, 128, 157, 158, 189, 190, 191, 199, 214, 215], "valu": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 46, 47, 48, 49, 51, 54, 61, 62, 63, 64, 67, 72, 73, 74, 75, 76, 77, 78, 79, 85, 86, 90, 91, 92, 93, 94, 97, 98, 101, 102, 103, 104, 105, 113, 114, 115, 116, 117, 122, 125, 131, 132, 135, 137, 138, 139, 146, 147, 148, 153, 156, 161, 162, 165, 166, 167, 168, 176, 177, 178, 179, 184, 186, 188, 194, 195, 199, 214, 215], "param": [0, 8, 15, 16, 29, 30, 36, 37, 47, 48, 49, 59, 62, 70, 80, 81, 101, 103, 104, 112, 114, 135, 137, 138, 145, 146, 166, 167, 175, 177, 198, 199, 206, 207, 208, 211, 212, 213], "promprt": 0, "print": [0, 4, 8, 13, 17, 21, 22, 27, 31, 38, 39, 83, 123, 154, 185, 206, 207, 208, 209, 214, 215], "comma": [0, 7, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197, 214], "seper": [0, 215], "insert": 0, "_inplac": 0, "new_df": 0, "opposit": [0, 8, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 144, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 184, 194, 199, 214, 215], "inplac": [0, 4, 8, 46, 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 67, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 86, 90, 91, 92, 93, 94, 97, 98, 99, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 120, 121, 122, 125, 131, 132, 133, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 152, 153, 156, 161, 162, 163, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 182, 183, 184, 186, 188, 194, 195, 196, 199, 200, 214, 215], "suffix": [0, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 67, 186], "printout_oper": 0, "filter_update_kwarg": 0, "execut": [0, 215], "": [0, 1, 4, 7, 8, 10, 13, 16, 17, 22, 27, 30, 31, 36, 39, 42, 43, 45, 51, 53, 72, 73, 74, 75, 77, 84, 90, 102, 105, 124, 136, 139, 155, 165, 168, 187, 214, 215], "choic": [0, 4, 214, 215], "whether": [0, 1, 8, 45, 47, 55, 90, 103, 108, 137, 141, 166, 171, 186, 200, 214, 215], "place": [0, 4, 8, 52, 69, 86, 106, 120, 125, 140, 151, 156, 169, 182, 188, 200, 203], "creat": [0, 1, 4, 7, 8, 41, 90, 200], "instanc": [0, 8, 41, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 72, 73, 74, 75, 76, 77, 78, 79, 80, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 195], "pd": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41], "post": [0, 1], "determin": [0, 4, 7, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 36, 40, 41, 42, 43, 47, 48, 49, 50, 54, 55, 56, 70, 71, 80, 81, 85, 90, 91, 92, 93, 94, 101, 103, 104, 108, 109, 116, 121, 135, 137, 138, 141, 142, 152, 166, 167, 171, 172, 183, 200, 214, 215], "filtrat": 0, "ad": [0, 8, 74, 80, 199, 200, 203, 214, 215], "If": [0, 1, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 46, 49, 50, 52, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 84, 85, 86, 90, 91, 92, 93, 94, 95, 97, 98, 100, 101, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 120, 121, 122, 124, 125, 129, 131, 132, 134, 135, 140, 141, 142, 143, 145, 146, 147, 148, 151, 152, 153, 155, 156, 159, 161, 162, 164, 169, 170, 171, 172, 173, 175, 176, 177, 178, 179, 182, 183, 184, 186, 187, 188, 192, 194, 195, 197, 200, 214, 215], "_is_norm": 0, "properti": [0, 8], "_numeric_column": 0, "numer": [0, 4, 8, 53, 65, 165, 170, 176, 180, 186, 191, 214, 215], "int": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 58, 59, 64, 68, 70, 72, 81, 90, 91, 92, 93, 94, 96, 97, 107, 111, 112, 117, 119, 130, 131, 144, 145, 148, 150, 160, 161, 170, 174, 175, 179, 181, 186, 193, 194], "float": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 49, 50, 51, 54, 60, 61, 63, 70, 71, 74, 75, 79, 80, 81, 85, 88, 89, 90, 91, 92, 97, 101, 105, 107, 115, 116, 121, 122, 127, 131, 135, 139, 147, 152, 153, 158, 161, 168, 170, 178, 183, 184, 186, 190, 194], "_plot_pca": 0, "final_df": 0, "pc1_var": 0, "pc2_var": 0, "label": [0, 4, 8, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "titl": [0, 4, 8, 41, 42, 43, 49, 50, 54, 57, 70, 80, 81, 85, 101, 110, 135, 143, 173, 214, 215], "title_fonts": [0, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "label_fonts": [0, 8, 49, 54, 70, 80, 81, 85, 101, 135], "tick_fonts": [0, 8, 49, 50, 54, 70, 80, 81, 85, 101, 135], "intern": [0, 214], "varianc": [0, 8, 74, 81], "explain": [0, 1, 8, 81, 214, 215], "first": [0, 4, 6, 7, 8, 13, 27, 42, 43, 52, 53, 64, 68, 69, 72, 73, 74, 75, 81, 85, 86, 88, 89, 95, 106, 117, 119, 120, 125, 127, 128, 129, 140, 148, 150, 151, 156, 158, 159, 165, 169, 179, 181, 182, 188, 190, 191, 192, 199, 214, 215], "pc": [0, 214], "second": [0, 8, 21, 38, 42, 43, 81, 85, 88, 89, 95, 127, 128, 129, 158, 159, 165, 190, 191, 192, 214, 215], "draw": [0, 8, 14, 28, 41, 81, 214, 215], "color": [0, 8, 42, 43, 81, 135, 214, 215], "axi": [0, 8, 19, 33, 49, 54, 70, 80, 81, 82, 85, 101, 135, 215], "_set_op": 0, "other": [0, 1, 3, 8, 10, 13, 17, 21, 22, 24, 27, 31, 38, 39, 50, 52, 69, 71, 81, 88, 90, 95, 100, 106, 120, 121, 127, 128, 129, 134, 140, 151, 152, 158, 159, 164, 169, 182, 183, 190, 191, 192, 197, 214, 215], "return_typ": [0, 8, 52, 69, 71, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 169, 182, 183, 192, 197], "op": 0, "kwarg": [0, 8, 199], "suppli": [0, 4, 8, 42, 43, 47, 48, 53, 55, 56, 90, 98, 103, 104, 108, 109, 132, 137, 138, 141, 142, 162, 166, 167, 171, 172, 195, 214, 215], "differ": [0, 3, 4, 8, 21, 38, 78, 81, 90, 93, 94, 95, 129, 159, 186, 192, 214], "symmetr": [0, 4, 8, 21, 38, 95, 129, 159, 192, 215], "type": [0, 3, 4, 7, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 43, 47, 49, 50, 51, 52, 54, 55, 59, 62, 65, 69, 70, 71, 81, 87, 88, 89, 95, 96, 100, 101, 103, 105, 106, 108, 112, 114, 120, 121, 126, 127, 128, 129, 130, 134, 137, 139, 140, 141, 145, 146, 151, 152, 157, 158, 159, 160, 164, 166, 168, 169, 171, 175, 177, 182, 183, 186, 189, 190, 191, 192, 193, 197, 198, 199, 200, 202, 205, 206, 207, 208, 211, 212, 213, 214], "symmetric_differ": [0, 8], "addit": [0, 4, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 47, 48, 91, 98, 103, 104, 132, 137, 138, 162, 166, 167, 195, 200, 214, 215], "keyword": [0, 8, 98, 132, 162, 195, 199, 215], "argument": [0, 3, 4, 8, 65, 98, 132, 162, 195, 199, 215], "_sort": 0, "ascend": [0, 8, 64, 83, 86, 117, 123, 125, 148, 154, 156, 179, 185, 188, 199], "true": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 46, 47, 48, 49, 52, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 67, 69, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 86, 90, 91, 92, 93, 94, 97, 98, 99, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 120, 122, 125, 131, 132, 133, 137, 138, 140, 141, 142, 143, 144, 145, 146, 147, 148, 151, 153, 156, 161, 162, 163, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 182, 184, 186, 188, 194, 195, 196, 199, 200, 214, 215], "na_posit": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 199], "last": [0, 8, 64, 86, 96, 117, 125, 130, 148, 156, 160, 179, 188, 193, 203, 214, 215], "sort": [0, 4, 8, 24, 35, 36, 37, 64, 83, 117, 123, 148, 154, 179, 185, 199, 200, 214], "v": [0, 8, 64, 86, 117, 125, 135, 148, 156, 179, 188, 214], "descend": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188], "have": [0, 1, 3, 4, 6, 8, 20, 34, 45, 60, 61, 64, 75, 79, 86, 89, 91, 97, 102, 113, 117, 122, 125, 131, 148, 153, 156, 161, 176, 179, 184, 188, 194, 214, 215], "length": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 214, 215], "put": [0, 1, 8, 64, 86, 117, 125, 148, 156, 179, 188], "nan": [0, 4, 8, 51, 62, 64, 86, 105, 114, 117, 125, 139, 146, 148, 156, 168, 177, 179, 188, 214, 215], "begin": [0, 8, 64, 86, 117, 125, 148, 156, 179, 188, 214], "end": [0, 4, 8, 64, 86, 97, 117, 125, 131, 148, 156, 161, 179, 188, 194, 214, 215], "otherwis": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 47, 48, 70, 82, 86, 90, 91, 92, 93, 94, 103, 104, 125, 137, 138, 156, 166, 167, 188, 200, 214, 215], "copi": [0, 1, 6, 8, 86, 125, 156, 188, 214, 215], "without": [0, 3, 4, 7, 8, 14, 28, 35, 36, 37, 86, 90, 125, 156, 188, 199, 214], "origin": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 52, 56, 57, 60, 61, 62, 63, 64, 67, 69, 79, 86, 87, 88, 89, 90, 91, 92, 93, 94, 97, 106, 107, 109, 110, 113, 114, 115, 116, 117, 120, 122, 125, 126, 127, 128, 131, 140, 142, 143, 146, 147, 148, 151, 153, 156, 157, 158, 161, 169, 170, 172, 173, 176, 177, 178, 179, 182, 184, 186, 188, 189, 190, 191, 194, 200, 214, 215], "average_replicate_sampl": [0, 4, 8], "gene": [0, 3, 4, 7, 8, 9, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 36, 37, 40, 45, 46, 47, 48, 55, 58, 59, 72, 73, 74, 75, 82, 90, 91, 99, 102, 103, 104, 108, 111, 112, 116, 133, 137, 138, 141, 144, 145, 163, 165, 166, 167, 171, 174, 175, 186, 196, 206], "each": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 42, 46, 47, 48, 53, 70, 72, 73, 74, 75, 76, 77, 78, 80, 82, 87, 90, 91, 92, 93, 94, 102, 103, 104, 126, 137, 138, 157, 166, 167, 189, 214, 215], "e": [0, 4, 7, 8, 46, 53, 214, 215], "g": [0, 4, 7, 8, 43, 46, 53, 214, 215], "biolog": [0, 8, 24, 46, 214, 215], "technic": [0, 8, 46, 214, 215], "conta": [0, 8, 46, 72], "given": [0, 1, 4, 8, 9, 14, 28, 46, 50, 57, 59, 65, 67, 69, 71, 75, 87, 110, 112, 120, 121, 126, 143, 145, 151, 152, 157, 173, 175, 182, 183, 186, 189, 200, 206, 207, 208, 215], "match": [0, 4, 8, 16, 18, 30, 32, 36, 37, 46, 47, 55, 56, 59, 87, 103, 108, 109, 112, 126, 137, 141, 142, 145, 157, 166, 171, 172, 175, 189, 214, 215], "within": [0, 8, 46, 72, 73, 75, 214, 215], "affect": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 46, 55, 56, 57, 59, 60, 61, 62, 63, 64, 72, 73, 74, 75, 76, 77, 78, 79, 97, 98, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 132, 141, 142, 143, 145, 146, 147, 148, 153, 161, 162, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 195, 214, 215], "biotypes_from_gtf": [0, 8], "gtf_path": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "attribute_nam": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "biotyp": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 47, 48, 55, 56, 103, 104, 108, 109, 137, 138, 141, 142, 166, 167, 171, 172, 209, 213], "gene_biotyp": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript_biotyp": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "gene_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "feature_typ": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "transcript": [0, 7, 8, 16, 18, 30, 32, 36, 37, 47, 55, 58, 59, 99, 103, 108, 111, 112, 133, 137, 141, 144, 145, 163, 166, 171, 174, 175, 196, 214], "long_format": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167], "describ": [0, 7, 8, 47, 48, 55, 103, 104, 108, 137, 138, 141, 166, 167, 171, 214, 215], "tabl": [0, 3, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 40, 42, 43, 45, 47, 48, 53, 55, 56, 57, 59, 67, 77, 78, 87, 102, 103, 104, 108, 109, 110, 112, 126, 136, 137, 138, 141, 142, 143, 145, 157, 165, 166, 167, 171, 172, 173, 175, 189, 205, 209, 212, 213, 214], "about": [0, 1, 3, 4, 8, 16, 30, 36, 47, 48, 55, 56, 57, 72, 77, 88, 90, 102, 103, 104, 108, 109, 110, 127, 137, 138, 141, 142, 143, 158, 165, 166, 167, 171, 172, 173, 190, 214, 215], "drawn": [0, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 47, 48, 55, 56, 103, 104, 108, 109, 137, 138, 141, 142, 166, 167, 171, 172, 214], "gtf": [0, 4, 8, 47, 55, 103, 108, 137, 141, 166, 171, 214], "transfer": [0, 8, 47, 55, 103, 108, 137, 141, 166, 171], "id": [0, 3, 4, 8, 16, 18, 30, 32, 36, 37, 47, 55, 58, 59, 99, 103, 108, 111, 112, 133, 137, 141, 144, 145, 163, 166, 171, 174, 175, 196, 214], "individu": [0, 8, 47, 53, 55, 67, 70, 103, 108, 137, 141, 166, 171, 214, 215], "short": [0, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214], "long": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214, 215], "form": [0, 3, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 215], "state": [0, 8, 47, 48, 103, 104, 137, 138, 166, 167, 199], "also": [0, 3, 4, 7, 8, 24, 47, 48, 67, 90, 103, 104, 137, 138, 166, 167, 200, 214, 215], "provid": [0, 8, 47, 48, 91, 103, 104, 116, 137, 138, 166, 167, 214], "descript": [0, 1, 4, 8, 9, 44, 47, 48, 51, 103, 104, 105, 137, 138, 139, 166, 167, 168, 205, 214, 215], "statist": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 41, 47, 48, 51, 92, 93, 94, 103, 104, 105, 137, 138, 139, 165, 166, 167, 168, 214], "per": [0, 4, 8, 45, 47, 48, 67, 72, 76, 77, 82, 92, 93, 94, 103, 104, 137, 138, 166, 167, 214, 215], "rtype": [0, 8, 15, 16, 29, 30, 36, 47, 48, 103, 104, 137, 138, 166, 167], "show": [0, 8, 16, 30, 36, 42, 47, 48, 51, 68, 80, 96, 103, 104, 105, 119, 130, 137, 138, 139, 150, 160, 166, 167, 168, 181, 193, 214, 215], "number": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 47, 48, 58, 59, 61, 68, 72, 75, 79, 89, 90, 91, 92, 93, 94, 96, 97, 99, 103, 104, 111, 112, 119, 122, 130, 131, 133, 137, 138, 144, 145, 150, 153, 160, 161, 163, 166, 167, 174, 175, 181, 184, 186, 193, 194, 196, 214, 215], "belong": [0, 8, 14, 28, 47, 48, 57, 59, 87, 90, 103, 104, 110, 112, 126, 137, 138, 143, 145, 157, 166, 167, 173, 175, 189, 214, 215], "well": [0, 4, 8, 47, 48, 103, 104, 137, 138, 166, 167, 214, 215], "biotypes_from_ref_t": [0, 3, 4, 8, 215], "ref": [0, 8, 11, 25, 48, 56, 57, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 186, 189, 215], "predefin": [0, 4, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 40, 42, 43, 48, 56, 57, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 189, 215], "ce11": [0, 8, 48, 104, 138, 167], "packag": [0, 4, 7, 48, 104, 138, 167, 214, 215], "d": [0, 7, 8, 11, 25, 48, 52, 63, 68, 69, 71, 88, 95, 96, 100, 104, 106, 107, 113, 115, 116, 119, 120, 121, 127, 128, 129, 130, 134, 136, 138, 140, 147, 150, 151, 152, 158, 159, 160, 164, 167, 169, 178, 181, 182, 183, 190, 192, 193, 197, 200, 215], "test": [0, 1, 4, 7, 8, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 214], "test_fil": [0, 8, 10, 11, 24, 25, 48, 51, 52, 56, 57, 60, 61, 62, 63, 64, 65, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 78, 79, 83, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 100, 104, 105, 106, 107, 109, 110, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 125, 126, 127, 128, 129, 130, 131, 132, 134, 136, 138, 139, 140, 142, 143, 146, 147, 148, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 164, 167, 168, 169, 170, 172, 173, 176, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 189, 190, 191, 192, 193, 194, 195, 197, 200, 215], "test_deseq": [0, 8, 11, 25, 48, 52, 63, 68, 69, 71, 79, 88, 95, 96, 100, 104, 106, 115, 119, 120, 121, 122, 127, 128, 129, 130, 134, 138, 140, 147, 150, 151, 152, 153, 158, 159, 160, 164, 167, 169, 178, 181, 182, 183, 184, 190, 192, 193, 197, 215], "view": [0, 8, 48, 104, 138, 167, 214], "biotype_ref_table_for_test": [0, 8, 11, 25, 48, 56, 104, 109, 138, 142, 167, 172, 186, 215], "protein_cod": [0, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 40, 48, 55, 56, 104, 108, 109, 138, 141, 142, 167, 171, 172, 186, 215], "26": [0, 8, 11, 25, 48, 51, 52, 62, 69, 79, 104, 105, 106, 113, 114, 120, 122, 128, 138, 139, 140, 146, 151, 153, 167, 168, 169, 177, 182, 184, 215], "pseudogen": [0, 3, 8, 11, 25, 48, 55, 56, 104, 108, 109, 138, 141, 142, 167, 171, 172, 215], "1": [0, 5, 7, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 48, 49, 51, 53, 54, 62, 63, 68, 71, 72, 74, 75, 80, 81, 86, 88, 90, 91, 96, 98, 101, 104, 105, 107, 114, 115, 116, 119, 121, 125, 127, 130, 132, 135, 138, 139, 146, 147, 150, 152, 156, 158, 160, 162, 167, 168, 170, 177, 178, 181, 183, 186, 188, 190, 193, 195, 199, 206, 215], "unknown": [0, 8, 11, 25, 48, 104, 138, 167, 215], "basemean": [0, 8, 48, 62, 68, 79, 96, 104, 114, 119, 122, 130, 138, 146, 150, 153, 160, 167, 177, 181, 184, 193, 200, 215], "padj": [0, 8, 48, 68, 96, 102, 104, 118, 119, 130, 138, 150, 160, 167, 181, 193, 200, 215], "75": [0, 8, 48, 49, 51, 54, 63, 75, 88, 90, 91, 96, 101, 104, 105, 115, 127, 130, 138, 139, 147, 158, 160, 167, 168, 178, 190, 193, 214, 215], "max": [0, 8, 41, 48, 51, 104, 105, 138, 139, 167, 168, 215], "0": [0, 5, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 43, 48, 51, 56, 63, 68, 71, 72, 74, 75, 86, 88, 90, 91, 104, 105, 107, 109, 115, 116, 119, 121, 125, 127, 135, 138, 139, 142, 147, 150, 152, 156, 158, 165, 167, 168, 170, 172, 178, 181, 183, 186, 188, 190, 191, 199, 206, 207, 214, 215], "1823": [0, 8, 48, 104, 138, 167, 215], "089609": [0, 8, 48, 104, 138, 167, 215], "005060e": [0, 8, 48, 104, 138, 167, 215], "90": [0, 8, 48, 51, 96, 104, 105, 130, 138, 139, 160, 167, 168, 193, 215], "9": [0, 4, 8, 48, 51, 56, 68, 96, 104, 105, 109, 119, 130, 138, 139, 142, 150, 160, 167, 168, 172, 181, 186, 193, 206, 207, 214, 215], "290000e": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "68": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "2688": [0, 8, 48, 104, 138, 167, 215], "043701": [0, 8, 48, 104, 138, 167, 215], "800000e": [0, 8, 48, 68, 104, 119, 138, 150, 167, 181, 215], "94": [0, 8, 48, 96, 104, 130, 138, 160, 167, 193, 215], "2085": [0, 8, 48, 104, 138, 167, 215], "995094": [0, 8, 48, 104, 138, 167, 215], "3": [0, 1, 7, 8, 43, 48, 51, 57, 62, 68, 71, 74, 81, 90, 93, 94, 96, 104, 105, 110, 113, 114, 119, 121, 130, 138, 139, 143, 146, 150, 152, 160, 167, 168, 173, 177, 181, 183, 193, 200, 206, 214, 215], "070000e": [0, 8, 48, 68, 104, 119, 138, 150, 167, 181, 215], "152": [0, 8, 48, 104, 138, 167, 215], "x": [0, 8, 14, 28, 48, 49, 50, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 68, 70, 74, 79, 80, 81, 85, 96, 97, 98, 101, 104, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 122, 130, 131, 132, 135, 138, 141, 142, 143, 145, 146, 147, 148, 150, 153, 160, 161, 162, 167, 170, 171, 172, 173, 175, 176, 177, 178, 179, 181, 184, 186, 193, 194, 195, 214, 215], "48": [0, 8, 48, 104, 138, 167, 215], "box_plot": [0, 4, 8], "notch": [0, 8, 49], "ylabel": [0, 8, 41, 49, 54, 85, 101], "log10": [0, 8, 49, 54, 85, 98, 101, 132, 135, 162, 195], "20": [0, 8, 42, 49, 50, 51, 54, 70, 81, 85, 86, 87, 101, 105, 125, 126, 135, 139, 156, 157, 168, 188, 189, 214, 215], "16": [0, 5, 8, 49, 54, 61, 80, 81, 85, 89, 90, 101, 135, 207, 215], "12": [0, 5, 7, 8, 43, 49, 50, 54, 64, 70, 80, 81, 85, 90, 101, 117, 135, 148, 176, 179, 191, 215], "ax": [0, 8, 42, 43, 49, 54, 70, 101, 214], "box": [0, 6, 7, 8, 49, 54, 90, 91, 92, 93, 94, 98, 101, 132, 162, 195, 214], "scale": [0, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 49, 54, 72, 73, 74, 75, 78, 101, 214, 215], "both": [0, 3, 8, 14, 15, 16, 18, 21, 23, 28, 29, 30, 32, 35, 36, 38, 40, 49, 54, 57, 80, 90, 95, 101, 110, 129, 143, 159, 173, 192, 214, 215], "It": [0, 4, 8, 49, 54, 101, 214, 215], "recommend": [0, 5, 8, 15, 29, 49, 54, 101, 186, 215], "absolut": [0, 8, 49, 54, 67, 101, 107, 135, 170, 214, 215], "25": [0, 5, 7, 8, 49, 51, 54, 62, 63, 101, 105, 114, 115, 116, 139, 146, 147, 168, 177, 178, 200, 215], "percentil": [0, 4, 8, 49, 51, 54, 63, 88, 101, 105, 115, 127, 139, 147, 158, 168, 178, 190, 215], "white": [0, 8, 49, 54, 101], "dot": [0, 8, 49, 54, 85, 101], "add": [0, 1, 8, 43, 49, 54, 199, 214, 215], "confid": [0, 8, 49], "interv": [0, 8, 49], "top": [0, 8, 49, 54, 64, 74, 117, 148, 179, 214, 215], "y": [0, 8, 19, 33, 41, 49, 50, 54, 70, 74, 80, 81, 82, 85, 101, 135, 215], "30": [0, 8, 49, 50, 51, 54, 70, 80, 81, 85, 101, 105, 135, 139, 168], "font": [0, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 101, 135], "size": [0, 4, 8, 42, 43, 49, 50, 54, 70, 80, 81, 85, 90, 91, 101, 135, 186, 214, 215], "graph": [0, 4, 8, 16, 30, 36, 41, 49, 50, 54, 70, 80, 81, 85, 101, 135, 214], "15": [0, 7, 8, 49, 51, 54, 57, 70, 80, 81, 85, 86, 87, 90, 101, 105, 110, 125, 126, 135, 139, 143, 156, 157, 168, 173, 188, 189, 215], "tick": [0, 8, 49, 50, 54, 70, 80, 81, 85, 101, 135], "matplotlib": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 49, 54, 70, 81, 85, 101, 215], "add_scatt": [0, 8, 49, 54], "sample_nam": [0, 8, 50], "metric": [0, 8, 50, 90, 91, 92, 94, 214, 215], "euclidean": [0, 8, 50, 90, 91, 92, 94, 214, 215], "linkag": [0, 8, 50, 90, 92, 214, 215], "complet": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 43, 50, 53, 92, 214], "ward": [0, 8, 50, 90, 92, 214], "weight": [0, 8, 16, 30, 36, 43, 50, 72, 74, 215], "centroid": [0, 8, 50, 93, 94], "hierarch": [0, 4, 7, 8, 50, 90, 92, 214], "cluster": [0, 4, 7, 8, 50, 90, 91, 92, 93, 94], "2": [0, 7, 8, 42, 43, 50, 51, 52, 53, 62, 68, 69, 71, 79, 86, 87, 90, 96, 105, 106, 107, 113, 114, 119, 120, 121, 122, 125, 126, 128, 130, 139, 140, 146, 150, 151, 152, 153, 156, 157, 160, 168, 169, 170, 177, 181, 182, 183, 184, 186, 188, 189, 193, 206, 215], "log": [0, 4, 8, 50, 73, 98, 132, 162, 195, 214, 215], "relev": [0, 4, 8, 50, 214, 215], "condition1_rep1": [0, 8, 50], "condition1_rep2": [0, 8, 50], "condition1_rep3": [0, 8, 50], "condition2_rep1": [0, 8, 50], "condition3_rep1": [0, 8, 50], "condition3_rep2": [0, 8, 50], "ham": [0, 8, 50, 91, 94], "correl": [0, 8, 50, 80, 214, 215], "distanc": [0, 8, 50, 91, 92, 94, 215], "avail": [0, 8, 16, 18, 23, 30, 32, 40, 50, 90, 214], "scipi": [0, 7, 8, 50], "spatial": [0, 8, 50, 214, 215], "pdist": [0, 8, 50], "possibl": [0, 1, 8, 50, 215], "see": [0, 3, 4, 8, 16, 18, 30, 32, 36, 37, 50, 51, 53, 59, 68, 80, 90, 91, 92, 94, 96, 105, 112, 119, 130, 139, 145, 150, 160, 168, 175, 181, 193, 214, 215], "document": [0, 4, 7, 8, 50, 51, 68, 80, 96, 105, 119, 130, 139, 150, 160, 168, 181, 193, 214, 215], "onlin": [0, 8, 50, 215], "hierarchi": [0, 8, 50, 214, 215], "10": [0, 5, 7, 8, 15, 29, 43, 50, 51, 54, 64, 67, 76, 77, 81, 85, 90, 105, 117, 139, 148, 168, 176, 179, 186, 191, 214, 215], "seaborn": [0, 7, 8, 50, 80], "clustermap": [0, 8, 50], "01": [0, 8, 51, 105, 139, 168], "5": [0, 5, 8, 51, 60, 61, 63, 68, 71, 74, 89, 90, 96, 97, 105, 115, 119, 121, 130, 131, 139, 147, 150, 152, 160, 161, 168, 178, 181, 183, 186, 193, 194, 199, 207, 208, 214, 215], "99": [0, 8, 51, 105, 139, 168], "summar": [0, 8, 51, 105, 139, 168, 214], "central": [0, 8, 51, 105, 139, 168], "tendenc": [0, 8, 51, 105, 139, 168], "dispers": [0, 7, 8, 51, 105, 139, 168, 214], "dataset": [0, 8, 42, 51, 80, 105, 139, 168], "distribut": [0, 8, 51, 105, 139, 168, 214, 215], "exclud": [0, 8, 16, 30, 36, 51, 75, 105, 139, 168, 214, 215], "inform": [0, 3, 4, 8, 51, 72, 77, 80, 105, 139, 168, 214, 215], "like": [0, 3, 8, 51, 74, 105, 139, 168, 201, 202, 206, 214, 215], "fall": [0, 8, 51, 105, 139, 168], "between": [0, 3, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 43, 51, 63, 65, 69, 71, 72, 73, 74, 75, 80, 81, 88, 90, 91, 92, 94, 100, 105, 107, 113, 115, 116, 120, 121, 127, 134, 135, 139, 147, 151, 152, 158, 164, 165, 168, 170, 176, 178, 182, 183, 186, 190, 197], "25th": [0, 8, 51, 63, 105, 115, 139, 147, 168, 178], "50th": [0, 8, 51, 105, 139, 168], "75th": [0, 8, 51, 63, 105, 115, 139, 147, 168, 178], "summari": [0, 4, 8, 51, 105, 139, 168, 214, 215], "seri": [0, 3, 4, 5, 8, 51, 105, 139, 165, 168, 215], "numpi": [0, 7, 8, 51, 91, 105, 139, 168, 215], "np": [0, 8, 51, 105, 139, 168], "cond1": [0, 8, 51, 64, 72, 83, 86, 98, 105, 117, 123, 125, 132, 139, 148, 154, 156, 162, 168, 179, 185, 188, 195, 215], "cond2": [0, 8, 51, 64, 72, 86, 105, 117, 125, 139, 148, 156, 168, 179, 188, 215], "cond3": [0, 8, 51, 72, 86, 105, 125, 139, 156, 168, 188, 215], "cond4": [0, 8, 51, 72, 86, 98, 105, 125, 132, 139, 156, 162, 168, 188, 195, 215], "22": [0, 8, 51, 56, 57, 60, 61, 64, 72, 73, 74, 75, 76, 77, 78, 87, 89, 90, 97, 98, 105, 109, 110, 117, 126, 131, 132, 139, 142, 143, 148, 157, 161, 162, 168, 170, 172, 173, 176, 179, 186, 189, 191, 194, 195, 200, 215], "000000": [0, 8, 51, 105, 139, 168], "2515": [0, 8, 51, 105, 139, 168], "590909": [0, 8, 51, 105, 139, 168], "2209": [0, 8, 51, 105, 139, 168], "227273": [0, 8, 51, 105, 139, 168], "4230": [0, 8, 51, 105, 139, 168], "3099": [0, 8, 51, 105, 139, 168], "818182": [0, 8, 51, 105, 139, 168], "std": [0, 8, 51, 105, 139, 168], "4820": [0, 8, 51, 105, 139, 168], "512674": [0, 8, 51, 105, 139, 168], "4134": [0, 8, 51, 105, 139, 168], "948493": [0, 8, 51, 105, 139, 168], "7635": [0, 8, 51, 105, 139, 168], "832664": [0, 8, 51, 105, 139, 168], "5520": [0, 8, 51, 105, 139, 168], "394522": [0, 8, 51, 105, 139, 168], "min": [0, 8, 41, 51, 105, 139, 168], "6": [0, 8, 51, 61, 68, 76, 77, 89, 96, 105, 119, 130, 139, 150, 160, 168, 181, 186, 193, 207, 214, 215], "250000": [0, 8, 51, 105, 139, 168], "50": [0, 8, 19, 33, 51, 90, 93, 105, 139, 168, 214], "57": [0, 8, 51, 86, 91, 105, 125, 139, 156, 168, 188, 215], "500000": [0, 8, 51, 105, 139, 168], "52": [0, 8, 51, 105, 139, 168, 215], "23": [0, 5, 8, 51, 86, 105, 125, 139, 156, 168, 188, 215], "21": [0, 8, 51, 63, 88, 105, 115, 127, 139, 147, 158, 168, 178, 190, 214, 215], "2637": [0, 8, 51, 105, 139, 168], "2479": [0, 8, 51, 105, 139, 168], "6030": [0, 8, 51, 105, 139, 168], "4669": [0, 8, 51, 105, 139, 168], "750000": [0, 8, 51, 105, 139, 168], "15054": [0, 8, 51, 105, 139, 168], "950000": [0, 8, 51, 105, 139, 168], "12714": [0, 8, 51, 105, 139, 168], "290000": [0, 8, 51, 105, 139, 168], "21955": [0, 8, 51, 105, 139, 168], "390000": [0, 8, 51, 105, 139, 168], "15603": [0, 8, 51, 105, 139, 168], "510000": [0, 8, 51, 105, 139, 168], "15056": [0, 8, 51, 105, 139, 168], "12746": [0, 8, 51, 105, 139, 168], "22027": [0, 8, 51, 105, 139, 168], "15639": [0, 8, 51, 105, 139, 168], "decil": [0, 8, 51, 105, 139, 168], "arang": [0, 8, 51, 105, 139, 168], "200000": [0, 8, 51, 105, 139, 168], "400000": [0, 8, 51, 105, 139, 168], "700000": [0, 8, 51, 105, 139, 168], "600000": [0, 8, 51, 105, 139, 168], "40": [0, 8, 51, 90, 92, 105, 139, 168], "28": [0, 5, 8, 51, 52, 62, 63, 69, 79, 88, 105, 106, 107, 114, 115, 120, 122, 127, 128, 139, 140, 146, 147, 151, 153, 158, 168, 169, 177, 178, 182, 184, 190, 200, 215], "800000": [0, 8, 51, 105, 139, 168], "14": [0, 6, 7, 8, 43, 51, 57, 91, 93, 94, 105, 110, 139, 143, 168, 173, 176, 191], "60": [0, 8, 51, 86, 90, 105, 125, 139, 156, 168, 188, 215], "82": [0, 8, 51, 91, 96, 105, 130, 139, 160, 168, 193, 215], "106": [0, 8, 51, 105, 139, 168], "44": [0, 8, 51, 105, 139, 168], "33": [0, 8, 51, 105, 139, 168], "70": [0, 8, 51, 96, 105, 130, 139, 160, 168, 193, 215], "484": [0, 8, 51, 105, 139, 168], "395": [0, 8, 51, 105, 139, 168], "305": [0, 8, 51, 105, 139, 168], "302": [0, 8, 51, 68, 105, 119, 139, 150, 168, 181, 215], "80": [0, 8, 51, 91, 92, 105, 139, 168], "3398": [0, 8, 51, 105, 139, 168], "3172": [0, 8, 51, 105, 139, 168], "7981": [0, 8, 51, 105, 139, 168], "6213": [0, 8, 51, 105, 139, 168], "8722": [0, 8, 51, 105, 139, 168], "100000": [0, 8, 51, 105, 139, 168], "7941": [0, 8, 51, 105, 139, 168], "16449": [0, 8, 51, 105, 139, 168], "12129": [0, 8, 51, 105, 139, 168], "900000": [0, 8, 51, 105, 139, 168], "keep": [0, 1, 8, 52, 56, 57, 59, 61, 63, 64, 69, 79, 97, 106, 107, 109, 110, 112, 113, 115, 116, 117, 120, 122, 131, 140, 142, 143, 145, 147, 148, 151, 153, 161, 169, 170, 172, 173, 175, 176, 178, 179, 182, 184, 186, 194, 214, 215], "onli": [0, 3, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 52, 56, 57, 59, 61, 63, 64, 68, 69, 71, 79, 87, 89, 92, 97, 106, 107, 109, 110, 112, 113, 115, 116, 117, 119, 120, 121, 122, 126, 128, 131, 140, 142, 143, 145, 147, 148, 150, 151, 152, 153, 157, 161, 169, 170, 172, 173, 175, 176, 178, 179, 181, 182, 183, 184, 186, 189, 191, 194, 214, 215], "exist": [0, 8, 17, 22, 31, 39, 52, 69, 95, 100, 106, 120, 129, 134, 140, 151, 159, 164, 169, 182, 192, 197, 214], "NOT": [0, 8, 13, 27, 52, 67, 95, 106, 129, 140, 159, 169, 192, 215], "done": [0, 1, 4, 8, 52, 57, 59, 69, 90, 106, 110, 112, 120, 140, 143, 145, 151, 169, 173, 175, 182, 214, 215], "calcul": [0, 4, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 52, 65, 69, 71, 72, 73, 74, 75, 78, 80, 81, 95, 100, 106, 120, 121, 129, 134, 140, 151, 152, 159, 164, 165, 169, 182, 183, 186, 192, 197, 214], "wbgene": [0, 4, 8, 52, 71, 95, 100, 106, 121, 129, 134, 140, 152, 159, 164, 169, 183, 192, 197, 206, 207, 208], "deseqfilt": [0, 3, 8, 52, 53, 95, 140, 159, 169, 192, 198, 200], "a_set": [0, 8, 52, 69, 71, 106, 120, 121, 140, 151, 152, 169, 182, 183, 215], "wbgene00000001": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 52, 69, 71, 106, 120, 121, 140, 151, 152, 169, 182, 183, 215], "wbgene00000002": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 52, 68, 69, 71, 95, 100, 106, 119, 120, 121, 129, 134, 140, 150, 151, 152, 159, 164, 169, 181, 182, 183, 192, 197, 215], "wbgene00000003": [0, 8, 13, 17, 22, 27, 31, 39, 52, 68, 69, 71, 95, 100, 106, 119, 120, 121, 129, 134, 140, 150, 151, 152, 159, 164, 169, 181, 182, 183, 192, 197, 215], "wbgene00007063": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007064": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007066": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007067": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007069": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00007071": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007074": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007075": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007076": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007077": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007078": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00007079": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00014997": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043987": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043988": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043989": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00043990": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00044022": [0, 8, 52, 83, 95, 100, 106, 123, 129, 134, 140, 154, 159, 164, 169, 185, 192, 197, 215], "wbgene00044951": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077502": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077503": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "wbgene00077504": [0, 8, 52, 83, 86, 95, 100, 106, 123, 125, 129, 134, 140, 154, 156, 159, 164, 169, 185, 188, 192, 197, 215], "leav": [0, 8, 52, 56, 57, 60, 61, 62, 63, 64, 69, 79, 87, 88, 89, 90, 91, 92, 93, 94, 97, 106, 107, 109, 110, 113, 114, 115, 116, 117, 120, 122, 126, 127, 128, 131, 140, 142, 143, 146, 147, 148, 151, 153, 157, 158, 161, 169, 170, 172, 173, 176, 177, 178, 179, 182, 184, 186, 189, 190, 191, 194, 200, 214, 215], "differential_expression_deseq2": [0, 4, 8], "design_matrix": [0, 8, 53], "comparison": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 53, 186, 214, 215], "iter": [0, 8, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 53, 58, 67, 85, 93, 94, 111, 144, 174], "r_installation_fold": [0, 8, 53], "analysi": [0, 3, 4, 5, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 53, 81], "deseq2": [0, 3, 4, 7, 8, 53, 73], "algorithm": [0, 8, 53, 90, 91, 92, 93, 94, 214, 215], "design": [0, 8, 53, 214], "least": [0, 4, 8, 22, 39, 53, 57, 59, 61, 71, 89, 90, 100, 110, 112, 121, 134, 143, 145, 152, 164, 173, 175, 183, 197, 214, 215], "two": [0, 3, 8, 21, 38, 53, 67, 71, 88, 89, 107, 113, 121, 127, 128, 152, 158, 165, 170, 176, 183, 190, 191, 214, 215], "experiment": [0, 8, 16, 30, 36, 53, 58, 72, 111, 144, 174, 214, 215], "factor": [0, 4, 8, 53, 72, 73, 74, 75, 78, 215], "guid": [0, 3, 4, 5, 6, 7, 8, 16, 30, 36, 53, 57, 91, 92, 94, 110, 143, 173, 214], "formula": [0, 8, 15, 29, 53, 214, 215], "version": [0, 1, 4, 6, 7, 8, 53, 90, 214, 215], "r": [0, 7, 8, 41, 43, 53, 73, 74, 75, 80, 214, 215], "instal": [0, 1, 4, 5, 8, 53, 214, 215], "experi": [0, 8, 53, 214, 215], "numerator_valu": [0, 8, 53], "denominator_valu": [0, 8, 53], "what": [0, 5, 8, 14, 28, 53, 71, 121, 152, 183, 214], "build": [0, 7, 8, 53, 215], "exactli": [0, 8, 21, 38, 53, 95, 129, 159, 165, 192, 208, 214, 215], "three": [0, 8, 53, 214, 215], "element": [0, 4, 8, 13, 17, 21, 22, 27, 31, 38, 39, 53, 81], "level": [0, 8, 24, 53, 89, 214, 215], "fold": [0, 3, 4, 7, 8, 24, 41, 53, 65, 102, 107, 113, 128, 135, 165, 170, 176, 186, 191, 214], "chang": [0, 1, 3, 7, 8, 12, 24, 26, 53, 65, 102, 107, 113, 116, 128, 135, 165, 170, 176, 186, 191, 214], "denomin": [0, 8, 53, 65, 165, 170, 176, 180, 186, 191, 214, 215], "folder": [0, 8, 53, 67, 214], "c": [0, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 53, 59, 60, 61, 65, 67, 72, 73, 74, 75, 76, 77, 78, 89, 112, 145, 175, 186, 214], "program": [0, 8, 53, 214], "4": [0, 5, 8, 43, 53, 60, 68, 86, 96, 116, 119, 125, 130, 150, 156, 160, 170, 181, 188, 193, 206, 207, 215], "one": [0, 4, 7, 8, 19, 22, 33, 39, 42, 45, 53, 57, 59, 61, 87, 88, 89, 92, 93, 94, 95, 100, 110, 112, 126, 127, 129, 134, 143, 145, 157, 158, 159, 164, 173, 175, 189, 190, 192, 197, 214], "enhanced_box_plot": [0, 4, 8], "enhanc": [0, 1, 8, 54], "rpm": [0, 8, 54, 61, 67, 76, 77, 85, 89, 215], "filter_biotype_from_ref_t": [0, 3, 4, 8, 186, 215], "lincrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "mirna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "ncrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "pirna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172, 215], "rrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "snorna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "snrna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "trna": [0, 8, 55, 56, 108, 109, 141, 142, 171, 172], "legal": [0, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 214], "defin": [0, 3, 4, 7, 8, 9, 14, 15, 16, 19, 23, 28, 29, 30, 33, 35, 36, 40, 42, 43, 56, 57, 109, 110, 142, 143, 172, 173, 212, 213], "yaml": [0, 4, 8, 56, 109, 142, 172, 201, 202, 215], "instead": [0, 3, 4, 7, 8, 14, 15, 28, 29, 55, 56, 57, 59, 60, 61, 62, 63, 64, 67, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 199, 201, 214, 215], "anyth": [0, 1, 8, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194, 214], "BUT": [0, 8, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 194], "expect": [0, 8, 19, 33, 55, 56, 57, 59, 60, 61, 62, 63, 64, 79, 97, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 122, 131, 141, 142, 143, 145, 146, 147, 148, 153, 161, 170, 171, 172, 173, 175, 176, 177, 178, 179, 184, 186, 194, 214, 215], "whose": [0, 8, 56, 60, 61, 62, 63, 70, 74, 81, 107, 109, 114, 115, 116, 142, 146, 147, 170, 172, 177, 178, 214, 215], "13": [0, 8, 56, 86, 92, 109, 125, 142, 156, 172, 186, 188, 214, 215], "filter_by_attribut": [0, 3, 4, 8, 186, 215], "mode": [0, 4, 8, 57, 58, 59, 110, 111, 112, 143, 144, 145, 173, 174, 175], "where": [0, 3, 4, 8, 19, 33, 42, 43, 57, 59, 85, 110, 112, 143, 145, 173, 175, 211, 214, 215], "learn": [0, 7, 8, 57, 110, 143, 173, 214, 215], "genom": [0, 3, 7, 8, 9, 10, 14, 15, 16, 18, 19, 23, 24, 28, 29, 30, 32, 33, 36, 37, 40, 45, 57, 58, 59, 99, 110, 111, 112, 133, 143, 144, 145, 163, 173, 174, 175, 186, 196, 205, 214, 215], "doe": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 57, 59, 67, 90, 110, 112, 143, 145, 165, 173, 175, 214, 215], "attribute1": [0, 8, 57, 87, 110, 126, 143, 157, 173, 186, 189, 215], "attr_ref_table_for_exampl": [0, 8, 57, 87, 110, 126, 143, 157, 173, 186, 189, 215], "7": [0, 1, 8, 57, 63, 68, 87, 88, 90, 110, 115, 119, 126, 127, 143, 147, 150, 157, 158, 173, 178, 181, 186, 189, 190, 214, 215], "OR": [0, 8, 57, 95, 110, 129, 143, 159, 173, 192], "attribute3": [0, 8, 57, 110, 143, 173, 215], "8": [0, 1, 4, 7, 8, 57, 68, 96, 110, 119, 130, 143, 150, 160, 173, 176, 181, 191, 193, 208, 214, 215], "AND": [0, 8, 57, 110, 143, 173], "19": [0, 8, 57, 90, 110, 143, 173, 215], "don": [0, 4, 6, 8, 57, 110, 143, 173, 214, 215], "t": [0, 4, 6, 8, 19, 20, 33, 34, 57, 95, 110, 129, 143, 159, 173, 192, 214, 215], "filter_by_kegg_annot": [0, 4, 8], "kegg_id": [0, 8, 59, 112, 145, 175], "organ": [0, 4, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214], "arabodopsi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "thaliana": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "caenorhabd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214, 215], "elegan": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 214], "danio": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "rerio": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "drosophila": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "melanogast": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "escherichia": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "coli": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "homo": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "sapien": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "mu": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "musculu": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "saccharomyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "cerevisia": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "schizosaccharomyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "pomb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175], "gene_id_typ": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 111, 112, 144, 145, 174, 175, 215], "uniprotkb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 215], "ac": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniparc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref50": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref90": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "uniref100": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "crc64": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ensembl": [0, 4, 8, 16, 18, 30, 32, 36, 37, 58, 59, 90, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 215], "protein": [0, 3, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 36, 37, 40, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 186, 196, 215], "geneid": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "kegg": [0, 4, 7, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214], "patric": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ucsc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "wbparasit": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "arachnoserv": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "araport": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "conoserv": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "dictybas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "echobas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "euhcvdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "flybas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genecard": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genereview": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "hgnc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "legiolist": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "leproma": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "maizegdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "mgi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "mim": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "nextprot": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "opentarget": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "orphanet": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pharmgkb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pombas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pseudocap": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "rgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "sgd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "tuberculist": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "veupathdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "vgnc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "wormbas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214, 215], "xenbas": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "zfin": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "eggnog": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genetre": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "hogenom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "oma": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196, 214], "orthodb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "treefam": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ccd": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "embl": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genbank": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "ddbj": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cd": [0, 1, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "gi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pir": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "refseq": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "nucleotid": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "chitar": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genewiki": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "genomernai": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "phi": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "collectf": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "biocyc": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "plantreactom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "reactom": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "unipathwai": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "cptac": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "proteomicsdb": [0, 8, 16, 18, 30, 32, 36, 37, 58, 59, 99, 111, 112, 133, 144, 145, 163, 174, 175, 196], "pathwai": [0, 4, 7, 8, 18, 32, 37, 59, 112, 145, 175, 214], "specif": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 59, 112, 145, 165, 175, 186, 215], "would": [0, 1, 3, 4, 8, 59, 112, 145, 175, 214, 215], "cel04020": [0, 8, 59, 112, 145, 175], "calcium": [0, 8, 59, 112, 145, 175], "signal": [0, 8, 59, 112, 145, 175, 214, 215], "ncbi": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "taxon": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "fetch": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "go": [0, 4, 7, 8, 16, 18, 30, 32, 36, 37, 41, 59, 112, 145, 175, 214], "annot": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214], "identifi": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214], "featureset": [0, 3, 4, 8, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 42, 43, 59, 112, 145, 175], "rnacentr": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "entrez": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "server": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "attempt": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "map": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "full": [0, 6, 7, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 45, 59, 67, 91, 92, 94, 102, 112, 136, 145, 165, 175, 186, 211, 214, 215], "uniprot": [0, 4, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "websit": [0, 1, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "http": [0, 1, 7, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 215], "www": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 215], "org": [0, 7, 8, 16, 18, 30, 32, 36, 37, 59, 90, 112, 145, 175, 215], "help": [0, 1, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175, 214, 215], "api_idmap": [0, 8, 16, 18, 30, 32, 36, 37, 59, 112, 145, 175], "filter_by_row_sum": [0, 8], "threshold": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 60, 61, 71, 89, 91, 92, 107, 116, 121, 135, 152, 170, 183, 186, 214, 215], "sum": [0, 8, 60, 215], "belov": [0, 8, 60], "minim": [0, 4, 8, 60, 61, 89, 90, 92, 214, 215], "18": [0, 8, 60, 170, 215], "filter_low_read": [0, 8, 90, 91, 92, 93, 94, 215], "lowli": [0, 8, 61, 89], "rpkm": [0, 8, 61, 85, 89, 215], "tpm": [0, 8, 61, 85, 89, 214], "filter_missing_valu": [0, 4, 8, 199, 200, 203, 215], "miss": [0, 8, 62, 114, 146, 177, 214], "check": [0, 1, 8, 62, 114, 146, 177, 214], "filt": [0, 8, 62, 79, 97, 98, 114, 122, 131, 132, 146, 153, 161, 162, 177, 184, 194, 195], "test_deseq_with_nan": [0, 8, 62, 114, 146, 177, 200, 215], "filt_no_nan": [0, 8, 62, 114, 146, 177], "filt_no_nan_basemean": [0, 8, 62, 114, 146, 177], "27": [0, 5, 8, 62, 113, 114, 146, 177, 215], "filt_no_nan_basemean_pv": [0, 8, 62, 114, 146, 177], "pval": [0, 8, 62, 114, 146, 177, 186, 215], "filter_percentil": [0, 4, 8, 215], "entri": [0, 1, 8, 42, 43, 63, 115, 147, 178, 215], "abov": [0, 8, 63, 88, 92, 115, 127, 147, 158, 178, 190, 214, 215], "pvalu": [0, 8, 63, 68, 96, 115, 119, 130, 147, 150, 160, 178, 181, 193, 215], "wa": [0, 4, 7, 8, 45, 63, 67, 115, 147, 178, 203, 214, 215], "log2foldchang": [0, 8, 63, 68, 88, 96, 102, 113, 115, 118, 119, 127, 128, 130, 147, 150, 158, 160, 176, 178, 181, 190, 193, 215], "below": [0, 4, 8, 63, 88, 89, 91, 107, 115, 127, 147, 158, 170, 178, 190, 214, 215], "vuls": [0, 8, 63, 115, 147, 178], "filter_top_n": [0, 4, 8, 200, 215], "100": [0, 4, 8, 64, 71, 90, 91, 92, 93, 94, 117, 121, 148, 152, 179, 183, 214, 215], "how": [0, 1, 5, 8, 15, 16, 18, 23, 29, 30, 32, 40, 64, 117, 148, 179, 186, 214], "mani": [0, 1, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 64, 117, 148, 179, 186, 214, 215], "highest": [0, 8, 64, 117, 148, 179, 214], "lowest": [0, 8, 64, 117, 148, 179, 214], "fold_chang": [0, 4, 8, 215], "numer_nam": [0, 8, 65], "denom_nam": [0, 8, 65], "foldchangefilt": [0, 3, 8, 65, 198, 200], "give": [0, 4, 8, 65, 74, 214], "generar": [0, 8, 65], "counted_fold_chang": [0, 8, 65, 215], "cond1_rep1": [0, 8, 65, 215], "cond1_rep2": [0, 8, 65, 215], "cond2_rep1": [0, 8, 65, 215], "cond_2rep2": [0, 8, 65], "f": [0, 7, 8, 16, 30, 36, 65, 170, 176, 186, 191, 215], "cond2_rep2": [0, 8, 65, 215], "classmethod": [0, 8, 66, 67, 118, 149, 180, 202], "from_fold": [0, 4, 8, 215], "folder_path": [0, 8, 67], "norm_to_rpm": [0, 8, 67, 215], "save_csv": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 67, 186, 215], "counted_fnam": [0, 8, 67, 215], "uncounted_fnam": [0, 8, 67, 215], "input_format": [0, 8, 67], "txt": [0, 4, 8, 20, 34, 67], "over": [0, 4, 8, 15, 16, 29, 30, 67, 89, 215], "htseq": [0, 7, 8, 67, 77], "combin": [0, 8, 16, 30, 36, 67, 90, 214, 215], "them": [0, 1, 4, 8, 10, 24, 67, 214, 215], "uncount": [0, 8, 67, 77, 215], "million": [0, 4, 8, 67, 76, 77, 82, 214, 215], "note": [0, 8, 16, 18, 23, 30, 32, 40, 67, 214, 215], "alwai": [0, 1, 8, 67, 214, 215], "regardless": [0, 8, 67, 214], "htcount": [0, 8, 67], "defualt": [0, 8, 67], "fill": [0, 8, 67], "joint": [0, 8, 67], "unalign": [0, 8, 67, 215], "align": [0, 8, 67, 77, 92, 214, 215], "uniqu": [0, 8, 67], "under": [0, 4, 8, 14, 15, 16, 18, 19, 20, 23, 28, 29, 30, 32, 33, 34, 35, 36, 37, 40, 67, 82, 186, 214, 215], "need": [0, 8, 67, 89, 214, 215], "test_count_from_fold": [0, 8, 67, 215], "name_for_reads_csv_fil": [0, 8, 67, 215], "name_for_uncounted_reads_csv_fil": [0, 8, 67, 215], "head": [0, 8, 86, 125, 156, 188, 215], "posit": [0, 8, 15, 29, 68, 96, 113, 119, 128, 130, 150, 160, 176, 181, 191, 193, 214, 215], "6820": [0, 8, 68, 119, 150, 181, 215], "755327": [0, 8, 68, 119, 150, 181, 215], "567762": [0, 8, 68, 119, 150, 181, 215], "000000e": [0, 8, 68, 119, 150, 181, 215], "00": [0, 8, 68, 90, 119, 150, 181, 215], "3049": [0, 8, 68, 119, 150, 181, 215], "625670": [0, 8, 68, 119, 150, 181, 215], "138071": [0, 8, 68, 119, 150, 181, 215], "660000e": [0, 8, 68, 119, 150, 181, 215], "280000e": [0, 8, 68, 119, 150, 181, 215], "298": [0, 8, 68, 119, 150, 181, 215], "wbgene00000004": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 68, 71, 95, 100, 119, 121, 129, 134, 150, 152, 159, 164, 181, 183, 192, 197, 215], "1432": [0, 8, 68, 119, 150, 181, 215], "911791": [0, 8, 68, 119, 150, 181, 215], "111737": [0, 8, 68, 119, 150, 181, 215], "400000e": [0, 8, 68, 96, 119, 130, 150, 160, 181, 193, 215], "237": [0, 8, 68, 119, 150, 181, 215], "920000e": [0, 8, 68, 119, 150, 181, 215], "233": [0, 8, 68, 119, 150, 181, 215], "wbgene00000005": [0, 8, 22, 39, 68, 95, 100, 119, 129, 134, 150, 159, 164, 181, 192, 197, 215], "4028": [0, 8, 68, 119, 150, 181, 215], "154186": [0, 8, 68, 119, 150, 181, 215], "534112": [0, 8, 68, 119, 150, 181, 215], "700000e": [0, 8, 68, 96, 119, 130, 150, 160, 181, 193, 215], "228": [0, 8, 68, 119, 150, 181, 215], "225": [0, 8, 68, 119, 150, 181, 215], "wbgene00000006": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 68, 95, 100, 119, 129, 134, 150, 159, 164, 181, 192, 197, 215], "1230": [0, 8, 68, 119, 150, 181, 215], "585240": [0, 8, 68, 119, 150, 181, 215], "157428": [0, 8, 68, 119, 150, 181, 215], "216": [0, 8, 68, 92, 119, 150, 181, 215], "590000e": [0, 8, 68, 119, 150, 181, 215], "213": [0, 8, 68, 119, 150, 181, 215], "duplic": [0, 8], "appear": [0, 4, 8, 13, 14, 15, 16, 18, 21, 23, 27, 28, 29, 30, 32, 35, 36, 37, 38, 40, 41, 71, 121, 152, 183, 206, 207, 208, 214, 215], "than": [0, 8, 15, 16, 18, 19, 23, 29, 30, 32, 33, 40, 74, 79, 107, 122, 153, 170, 184, 186, 199, 214, 215], "onc": [0, 6, 8, 90, 214, 215], "correspond": [0, 3, 8, 78, 85, 87, 90, 91, 92, 93, 94, 126, 157, 189, 215], "index": [0, 4, 5, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 72, 208, 214], "myset": [0, 8], "nwbgene00000003": [0, 8], "nwbgene12345678": [0, 8], "mystr": [0, 8], "ma_plot": [0, 4, 8], "ref_column": [0, 8, 70, 74], "split_plot": [0, 8, 70, 82, 90, 91, 92, 93, 94], "ma": [0, 4, 8, 70], "chosen": [0, 8, 70, 74, 215], "upper": [0, 8, 70, 74, 215], "quartil": [0, 8, 70, 74], "closest": [0, 8, 70, 74], "own": [0, 8, 42, 43, 70, 82, 90, 91, 92, 93, 94, 214, 215], "figur": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 42, 43, 70, 81, 82, 85, 90, 91, 92, 93, 94, 135, 214, 215], "majority_vote_intersect": [0, 4, 8], "majority_threshold": [0, 8, 71, 121, 152, 183], "majority_threhold": [0, 4, 8, 71, 121, 152, 183], "major": [0, 1, 8, 71, 121, 152, 183, 214], "vote": [0, 8, 71, 121, 152, 183, 214], "equival": [0, 8, 21, 38, 71, 121, 152, 183], "uphold": [0, 8, 71, 121, 152, 183], "b_set": [0, 8, 71, 121, 152, 183], "normalize_median_of_ratio": [0, 8], "reference_group": [0, 8, 72], "ratio": [0, 4, 8, 72, 73, 214, 215], "mrn": [0, 4, 8, 72, 215], "maza": [0, 8, 72], "et": [0, 4, 7, 8, 16, 30, 36, 72, 75, 214], "al": [0, 4, 7, 8, 16, 30, 36, 72, 75, 214], "2013": [0, 8, 72], "those": [0, 8, 72, 75, 90, 91, 92, 93, 94, 205, 214, 215], "pick": [0, 8, 15, 16, 29, 30, 72, 73, 91, 92, 93, 94, 214, 215], "multipli": [0, 8, 72, 74], "total": [0, 8, 42, 43, 72, 75, 76, 77, 215], "final": [0, 5, 8, 72, 74, 93, 94, 215], "adjust": [0, 8, 72, 74, 102, 116, 214, 215], "symmetri": [0, 8, 72, 74], "integ": [0, 4, 8, 15, 16, 29, 30, 72], "normalize_rl": [0, 8, 215], "rel": [0, 4, 8, 16, 30, 36, 73, 214, 215], "rle": [0, 4, 8, 73, 215], "ander": [0, 7, 8, 73], "huber": [0, 7, 8, 73], "2010": [0, 8, 73, 74, 75, 93], "pseudo": [0, 8, 73], "geometr": [0, 8, 73], "across": [0, 4, 8, 73, 214, 215], "wise": [0, 8, 73, 214], "normalize_tmm": [0, 8, 215], "log_ratio_trim": [0, 8, 74], "sum_trim": [0, 8, 74], "05": [0, 5, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 74, 186], "a_cutoff": [0, 8, 74], "10000000000": [0, 8, 74], "trim": [0, 4, 7, 8, 74, 215], "m": [0, 1, 4, 7, 8, 14, 16, 28, 30, 36, 74, 215], "tmm": [0, 4, 8, 74, 215], "robinson": [0, 8, 74], "oshlack": [0, 8, 74], "edger": [0, 8, 74, 215], "log2": [0, 4, 8, 74, 80, 98, 102, 107, 113, 128, 132, 135, 162, 165, 170, 176, 191, 195, 214, 215], "minu": [0, 8, 74], "extrem": [0, 8, 74, 214], "non": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40, 74, 88, 89, 90, 91, 92, 93, 94, 113, 127, 128, 135, 158, 176, 190, 191, 214], "bottom": [0, 8, 74, 214, 215], "smaller": [0, 8, 74, 214, 215], "cutuff": [0, 8, 74], "avoid": [0, 8, 74, 215], "inf": [0, 8, 74, 165, 215], "next": [0, 8, 74, 214, 215], "being": [0, 4, 8, 74, 91, 214, 215], "invers": [0, 8, 74, 214], "approxim": [0, 8, 74], "fraction": [0, 8, 74, 214], "direct": [0, 8, 74, 113, 128, 176, 191, 214, 215], "1e10": [0, 8, 74], "lower": [0, 4, 8, 74, 107, 170, 214], "bound": [0, 8, 74], "normalize_to_quantil": [0, 8], "quantil": [0, 4, 8, 75, 215], "bullard": [0, 8, 75], "limma": [0, 8, 75, 215], "divid": [0, 8, 75, 76, 77, 78, 90, 214, 215], "yield": [0, 8, 75], "normalize_to_rpm": [0, 4, 8, 215], "normalize_to_rpm_htseqcount": [0, 4, 8, 215], "special_counter_fnam": [0, 8, 77], "ambigu": [0, 8, 77, 215], "rna": [0, 5, 7, 8, 45, 77, 215], "librari": [0, 4, 8, 45, 77, 78, 214], "normalize_with_scaling_factor": [0, 4, 8, 215], "scaling_factor_fnam": [0, 8, 78], "pre": [0, 7, 8, 45, 78, 214], "scaling_factor": [0, 8, 78, 215], "number_filt": [0, 8, 199, 215], "greater": [0, 6, 7, 8, 79, 122, 153, 184, 199, 215], "equal": [0, 8, 79, 88, 97, 122, 127, 131, 153, 158, 161, 184, 190, 194], "lesser": [0, 8, 79, 122, 153, 184, 214], "applai": [0, 8, 79, 97, 122, 131, 153, 161, 184, 194], "particular": [0, 4, 7, 8, 15, 16, 29, 30, 79, 97, 122, 131, 153, 161, 184, 194, 214, 215], "gt": [0, 8, 79, 122, 153, 184, 215], "eq": [0, 8, 79, 97, 122, 131, 153, 161, 184, 194], "lt": [0, 8, 79, 122, 153, 184], "5900": [0, 8, 79, 122, 153, 184], "pairplot": [0, 4, 8, 215], "show_corr": [0, 8, 80], "pairgrid": [0, 8, 80], "pairwis": [0, 8, 80, 214, 215], "relationship": [0, 7, 8, 80, 214, 215], "pseudocount": [0, 4, 8, 80], "raw": [0, 8, 45, 80, 214], "spearman": [0, 8, 80, 90, 91, 92, 94, 214, 215], "coeffici": [0, 8, 80], "pair": [0, 4, 8, 80, 90, 92, 214, 215], "n_compon": [0, 8, 81, 214], "power_transform": [0, 8, 81, 90, 91, 92, 93, 94, 214], "princip": [0, 4, 8, 81, 215], "compon": [0, 4, 8, 16, 30, 36, 81, 215], "most": [0, 3, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 81, 91, 214, 215], "sklearn": [0, 8, 81], "decomposit": [0, 8, 81], "plot_express": [0, 4, 8, 215], "count_unit": [0, 8, 82], "standard": [0, 8, 82, 98, 132, 162, 195, 214], "error": [0, 4, 8, 82, 214, 215], "unit": [0, 8, 82, 214], "Will": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 82, 186], "displai": [0, 3, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 82, 214, 215], "print_featur": [0, 8], "alt_filenam": [0, 8, 84, 124, 155, 187], "myfilenam": [0, 8, 84, 124, 155, 187], "scatter_sample_vs_sampl": [0, 4, 8], "xlabel": [0, 8, 85], "highlight": [0, 4, 8, 85, 214], "avarg": [0, 8, 85], "point": [0, 4, 8, 85, 91, 92, 94, 135, 214, 215], "red": [0, 8, 85, 135], "633": [0, 8, 86, 125, 156, 188, 215], "451": [0, 8, 86, 125, 156, 188, 215], "365": [0, 8, 86, 96, 125, 130, 156, 160, 188, 193, 215], "388": [0, 8, 86, 125, 156, 188, 215], "55": [0, 8, 86, 125, 156, 188, 215], "266": [0, 8, 86, 125, 156, 188, 215], "46": [0, 8, 86, 125, 156, 188, 215], "39": [0, 8, 86, 125, 156, 188, 215], "split_by_attribut": [0, 4, 8], "attribute2": [0, 8, 87, 126, 157, 189, 215], "split_by_percentil": [0, 8], "overlap": [0, 8, 19, 33, 88, 89, 90, 91, 92, 93, 94, 127, 128, 158, 190, 191, 214, 215], "specfieid": [0, 8, 88, 127, 158, 190], "split_by_read": [0, 8], "maximum": [0, 8, 89, 92, 93, 94], "highli": [0, 4, 8, 89, 214], "ha": [0, 8, 89, 128, 191, 214, 215], "low_express": [0, 8, 89], "high_express": [0, 8, 89], "split_clicom": [0, 4, 8], "parameter_dict": [0, 8, 90], "dict": [0, 4, 8, 42, 43, 90, 200], "replicate_group": [0, 8, 90], "ungroup": [0, 8, 90], "evidence_threshold": [0, 8, 90, 214, 215], "6666666666666666": [0, 8, 90], "cluster_unclustered_featur": [0, 8, 90, 214, 215], "min_cluster_s": [0, 8, 90, 91, 214, 215], "plot_styl": [0, 8, 19, 33, 90, 91, 92, 93, 94, 215], "std_area": [0, 8, 90, 91, 92, 93, 94, 215], "std_bar": [0, 8, 90, 91, 92, 93, 94, 215], "gui_mod": [0, 8, 16, 18, 19, 23, 30, 32, 33, 35, 36, 37, 40, 90, 91, 92, 93, 94], "clicom": [0, 4, 8, 90], "mimaroglu": [0, 4, 8, 90], "yagci": [0, 4, 8, 90], "2012": [0, 4, 8, 90], "incorpor": [0, 8, 90, 214, 215], "solut": [0, 8, 90, 214, 215], "come": [0, 8, 90, 214, 215], "due": [0, 8, 90, 215], "natur": [0, 8, 90, 199, 214], "classifi": [0, 8, 90, 91, 214, 215], "nois": [0, 8, 90, 91, 214, 215], "discov": [0, 7, 8, 90, 91, 92, 93, 94, 214, 215], "setup": [0, 1, 6, 8, 90, 214], "influenc": [0, 8, 90, 214, 215], "batch": [0, 4, 8, 90, 214, 215], "effect": [0, 8, 90, 214, 215], "advantag": [0, 8, 90, 214, 215], "repeat": [0, 8, 15, 29, 90, 214], "measur": [0, 8, 90, 214, 215], "improv": [0, 4, 7, 8, 90], "accuraci": [0, 8, 90, 214, 215], "theori": [0, 8, 90], "behind": [0, 8, 90], "public": [0, 6, 8, 90, 214, 215], "doi": [0, 7, 8, 90, 215], "1093": [0, 8, 90], "bib": [0, 8, 90], "bbs057": [0, 8, 90], "power": [0, 4, 8, 90, 91, 92, 93, 94, 214, 215], "transform": [0, 4, 8, 90, 91, 92, 93, 94, 214, 215], "cox": [0, 8, 90, 91, 92, 93, 94, 98, 132, 162, 195, 214], "prior": [0, 4, 8, 90, 91, 92, 93, 94], "initi": [0, 8, 15, 16, 29, 30, 90, 93, 94], "twice": [0, 8, 90], "reliabl": [0, 8, 90], "togeth": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 43, 90, 214, 215], "consid": [0, 4, 8, 90, 91, 214, 215], "forc": [0, 8, 90, 214, 215], "part": [0, 1, 8, 90, 214, 215], "even": [0, 1, 4, 8, 90], "larger": [0, 8, 15, 16, 18, 19, 23, 29, 30, 32, 33, 40, 90, 91, 186, 214, 215], "fewer": [0, 8, 90, 91, 214, 215], "minimum": [0, 8, 35, 36, 37, 90, 91, 214, 215], "seek": [0, 8, 90, 91, 92, 93, 94], "dictionari": [0, 8, 42, 43, 90, 200, 215], "field": [0, 8, 90, 214], "support": [0, 1, 3, 4, 7, 8, 16, 18, 23, 30, 32, 40, 90, 91, 92, 94, 165, 199, 214, 215], "k": [0, 4, 8, 90, 93, 94], "medoid": [0, 4, 8, 90, 93, 94], "hdbscan": [0, 4, 7, 8, 90, 91], "prefer": [0, 4, 8, 90, 214, 215], "yoi": [0, 8, 90], "n_cluster": [0, 8, 90, 92, 93, 94, 214, 215], "cosin": [0, 8, 90, 91, 92, 94, 215], "four": [0, 8, 90], "time": [0, 4, 5, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 90, 93, 94], "style": [0, 4, 8, 43, 90, 91, 92, 93, 94, 214, 215], "dev_stag": [0, 8, 90, 91, 92, 93, 94], "elegans_developmental_stag": [0, 8, 90, 91, 92, 93, 94], "tsv": [0, 4, 8, 90, 91, 92, 93, 94, 214], "44072": [0, 8, 90, 91, 92, 93, 94], "2326": [0, 8, 90, 91, 92, 93, 94], "46398": [0, 8, 90, 91, 92, 93, 94], "140": [0, 8, 90, 93], "ys1": [0, 8, 90, 91, 92, 94, 215], "yr1": [0, 8, 90, 91, 92, 94, 214, 215], "jackknif": [0, 8, 90, 91, 92, 94, 214, 215], "kmedoid": [0, 8, 90], "found": [0, 8, 90, 91, 214], "49": [0, 8, 90], "similar": [0, 4, 8, 90, 91, 92, 94, 215], "32": [0, 8, 90, 215], "651": [0, 8, 90], "06it": [0, 8, 90], "find": [0, 7, 8, 90, 91, 214, 215], "cliqu": [0, 8, 90], "42436": [0, 8, 90], "61385": [0, 8, 90], "87it": [0, 8, 90], "153": [0, 8, 90, 91], "unclust": [0, 8, 90, 91, 214, 215], "95": [0, 8, 90], "1864": [0, 8, 90], "462": [0, 8, 90], "2115": [0, 8, 90], "211": [0, 8, 90], "2122": [0, 8, 90, 91], "204": [0, 8, 90, 91], "2123": [0, 8, 90], "203": [0, 8, 90], "2128": [0, 8, 90], "198": [0, 8, 90], "2167": [0, 8, 90], "159": [0, 8, 90], "2179": [0, 8, 90], "147": [0, 8, 90], "2200": [0, 8, 90, 91, 93], "126": [0, 8, 90, 91, 93], "2204": [0, 8, 90], "122": [0, 8, 90], "2229": [0, 8, 90, 94], "97": [0, 8, 90, 94, 96, 130, 160, 193, 215], "2234": [0, 8, 90, 91], "92": [0, 8, 90, 91], "2238": [0, 8, 90, 91, 92], "88": [0, 8, 90, 91, 92], "2241": [0, 8, 90, 91, 93], "85": [0, 8, 90, 91, 93], "2263": [0, 8, 90], "63": [0, 8, 90], "2279": [0, 8, 90], "47": [0, 8, 90], "split_hdbscan": [0, 4, 8], "min_sampl": [0, 8, 91], "pearson": [0, 8, 91, 92, 94, 215], "manhattan": [0, 8, 91, 92, 94, 215], "l1": [0, 8, 91, 92, 94, 214, 215], "l2": [0, 8, 91, 92, 94, 215], "cluster_selection_epsilon": [0, 8, 91], "cluster_selection_method": [0, 8, 91], "eom": [0, 8, 91], "leaf": [0, 8, 91], "return_prob": [0, 8, 91], "ndarrai": [0, 8, 24, 91], "neighbourhood": [0, 8, 91], "core": [0, 8, 91], "higher": [0, 8, 15, 29, 91, 186, 214, 215], "conserv": [0, 8, 15, 29, 91], "merg": [0, 8, 91, 92, 214, 215], "select": [0, 8, 91, 214, 215], "condens": [0, 8, 91], "tree": [0, 8, 16, 30, 36, 91, 214, 215], "excess": [0, 8, 91], "mass": [0, 8, 91], "persist": [0, 8, 91], "fine": [0, 8, 91], "grain": [0, 8, 91, 214], "homogen": [0, 8, 91], "arrai": [0, 8, 91, 214, 215], "probabl": [0, 8, 14, 28, 91, 214, 215], "assign": [0, 8, 91], "categor": [0, 4, 8, 19, 33, 91, 214], "otherswis": [0, 8, 91], "141": [0, 8, 91, 93], "344": [0, 8, 91], "79": [0, 8, 91], "2019": [0, 5, 8, 91], "307": [0, 8, 91], "2146": [0, 8, 91], "180": [0, 8, 91], "2168": [0, 8, 91], "158": [0, 8, 91], "2173": [0, 8, 91], "2176": [0, 8, 91], "150": [0, 8, 91, 214], "2183": [0, 8, 91], "143": [0, 8, 91], "2192": [0, 8, 91, 94], "134": [0, 8, 91, 94], "2244": [0, 8, 91], "2246": [0, 8, 91, 92], "split_hierarch": [0, 4, 8], "gap": [0, 8, 92, 93, 94, 214, 215], "silhouett": [0, 8, 92, 93, 94, 214, 215], "distance_threshold": [0, 8, 92], "max_n_clusters_estim": [0, 8, 92, 93, 94], "slihouett": [0, 8, 92, 93, 94], "deriv": [0, 8, 92, 215], "accept": [0, 4, 8, 92, 215], "criterion": [0, 8, 92, 214, 215], "observ": [0, 8, 92, 186, 214, 215], "try": [0, 4, 8, 92, 93, 94, 214], "optim": [0, 7, 8, 92, 93, 94, 214, 215], "appropri": [0, 8, 92, 93, 94, 214, 215], "1718": [0, 8, 92], "608": [0, 8, 92], "1979": [0, 8, 92], "347": [0, 8, 92], "2094": [0, 8, 92], "232": [0, 8, 92], "2110": [0, 8, 92], "2156": [0, 8, 92], "170": [0, 8, 92], "2191": [0, 8, 92], "135": [0, 8, 92], "2195": [0, 8, 92], "131": [0, 8, 92], "2223": [0, 8, 92], "103": [0, 8, 92], "2224": [0, 8, 92], "102": [0, 8, 92], "2252": [0, 8, 92, 94], "74": [0, 8, 92, 94, 96, 130, 160, 193, 215], "2286": [0, 8, 92], "center": [0, 8, 41, 92, 214, 215], "split_kmean": [0, 4, 8, 215], "n_init": [0, 8, 93, 94], "max_it": [0, 8, 93, 94], "300": [0, 8, 93, 94], "random_se": [0, 4, 8, 15, 16, 18, 23, 29, 30, 32, 40, 93, 94, 186, 214, 215], "random": [0, 4, 7, 8, 15, 16, 18, 23, 29, 30, 32, 40, 93, 94, 186, 214], "make": [0, 1, 4, 8, 93, 94, 214], "determinist": [0, 8, 93, 94, 214], "seed": [0, 8, 15, 16, 29, 30, 93, 94, 214, 215], "best": [0, 1, 8, 93, 94, 215], "consecut": [0, 8, 93, 94], "term": [0, 3, 4, 7, 8, 16, 30, 36, 41, 93, 94, 214], "inertia": [0, 8, 93, 94], "1801": [0, 8, 93], "525": [0, 7, 8, 93], "316": [0, 8, 93], "2059": [0, 8, 93], "267": [0, 8, 93], "2102": [0, 8, 93], "224": [0, 8, 93], "2185": [0, 8, 93], "2186": [0, 8, 93], "2219": [0, 8, 93], "107": [0, 8, 93], "2225": [0, 8, 93], "101": [0, 8, 93], "2250": [0, 8, 93], "76": [0, 8, 93], "2259": [0, 8, 93], "67": [0, 8, 93], "2276": [0, 8, 93], "split_kmedoid": [0, 4, 8], "1967": [0, 8, 94], "359": [0, 8, 94], "2020": [0, 5, 8, 94], "306": [0, 8, 94], "2071": [0, 8, 94], "255": [0, 8, 94], "2131": [0, 8, 94], "195": [0, 8, 94], "2145": [0, 8, 94], "181": [0, 8, 94], "2157": [0, 8, 94], "169": [0, 8, 94], "2159": [0, 8, 94], "167": [0, 8, 94], "2182": [0, 8, 94], "144": [0, 8, 94], "2190": [0, 8, 94], "136": [0, 8, 94], "2268": [0, 8, 94], "58": [0, 8, 94], "2275": [0, 8, 94], "51": [0, 8, 94], "wbgene00000017": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000024": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000010": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000020": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000029": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000019": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000023": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000025": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000014": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000027": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000021": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000012": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000026": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000007": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000008": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000013": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000011": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000015": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "wbgene00000018": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000016": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197], "wbgene00000028": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000022": [0, 8, 95, 96, 100, 129, 130, 134, 159, 160, 164, 192, 193, 197, 215], "wbgene00000009": [0, 8, 95, 100, 129, 134, 159, 164, 192, 197, 215], "tail": [0, 8, 215], "2236": [0, 8, 96, 130, 160, 193, 215], "185837": [0, 8, 96, 130, 160, 193, 215], "477374": [0, 8, 96, 130, 160, 193, 215], "910000e": [0, 8, 96, 130, 160, 193, 215], "81": [0, 8, 96, 130, 160, 193, 215], "460000e": [0, 8, 96, 130, 160, 193, 215], "78": [0, 8, 96, 130, 160, 193, 215], "343": [0, 8, 96, 130, 160, 193, 215], "648987": [0, 8, 96, 130, 160, 193, 215], "037191": [0, 8, 96, 130, 160, 193, 215], "320000e": [0, 8, 96, 130, 160, 193, 215], "72": [0, 8, 96, 130, 160, 193, 215], "175": [0, 8, 96, 130, 160, 193, 215], "142856": [0, 8, 96, 130, 160, 193, 215], "352044": [0, 8, 96, 130, 160, 193, 215], "580000e": [0, 8, 96, 130, 160, 193, 215], "120000e": [0, 8, 96, 130, 160, 193, 215], "71": [0, 8, 96, 130, 160, 193, 215], "219": [0, 8, 96, 130, 160, 193, 215], "163200": [0, 8, 96, 130, 160, 193, 215], "913657": [0, 8, 96, 130, 160, 193, 215], "420000e": [0, 8, 96, 130, 160, 193, 215], "69": [0, 8, 96, 130, 160, 193, 215], "1066": [0, 8, 96, 130, 160, 193, 215], "242402": [0, 8, 96, 130, 160, 193, 215], "811281": [0, 8, 96, 130, 160, 193, 215], "813048": [0, 8, 96, 130, 160, 193, 215], "101303": [0, 8, 96, 130, 160, 193, 215], "740000e": [0, 8, 96, 130, 160, 193, 215], "3168": [0, 8, 96, 130, 160, 193, 215], "566714": [0, 8, 96, 130, 160, 193, 215], "906719": [0, 8, 96, 130, 160, 193, 215], "600000e": [0, 8, 96, 130, 160, 193, 215], "93": [0, 8, 96, 130, 160, 193, 215], "340000e": [0, 8, 96, 130, 160, 193, 215], "221": [0, 8, 96, 130, 160, 193, 215], "925724": [0, 8, 96, 130, 160, 193, 215], "801676": [0, 8, 96, 130, 160, 193, 215], "230000e": [0, 8, 96, 130, 160, 193, 215], "84": [0, 8, 96, 130, 160, 193, 215], "820000e": [0, 8, 96, 130, 160, 193, 215], "text_filt": [0, 8], "start": [0, 4, 8, 97, 131, 161, 194, 214, 215], "text": [0, 8, 43, 97, 131, 161, 194, 215], "ct": [0, 8, 97, 131, 161, 194], "sw": [0, 8, 97, 131, 161, 194], "ew": [0, 8, 97, 131, 161, 194], "ac3": [0, 8, 97, 131, 161, 194], "17": [0, 7, 8, 97, 131, 161, 194, 215], "ln": [0, 8, 98, 132, 162, 195, 214], "callabl": [0, 8, 98, 132, 162, 195], "function_kwarg": [0, 8, 98, 132, 162, 195], "logx": [0, 8, 98, 132, 162, 195], "taken": [0, 8, 98, 132, 162, 195, 215], "filt_log10": [0, 8, 98, 132, 162, 195], "lambda": [0, 8, 98, 132, 162, 195], "violin_plot": [0, 4, 8], "log_10": [0, 8, 101], "insid": [0, 7, 8, 101], "log2fc_col": [0, 8, 102, 118, 215], "padj_col": [0, 8, 102, 118, 215], "suppress_warn": [0, 8, 66, 102, 118, 165, 180], "deseq": [0, 8, 102, 136], "filter_abs_log2_fold_chang": [0, 8, 215], "abslog2fc": [0, 8, 107, 170], "log2fc": [0, 8, 107, 170], "went": [0, 8, 107, 170], "up": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 107, 135, 170, 214, 215], "less": [0, 8, 14, 28, 107, 170, 214, 215], "down": [0, 8, 107, 135, 170, 214, 215], "sample_deseq": [0, 8, 107, 113, 116], "29": [0, 8, 107, 113, 116], "filter_fold_change_direct": [0, 8, 215], "po": [0, 8, 113, 128, 176], "neg": [0, 8, 15, 16, 29, 30, 113, 128, 135, 176, 191, 214, 215], "filter_signific": [0, 8, 215], "alpha": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 116, 135, 186], "did": [0, 8, 116, 214, 215], "significantli": [0, 8, 116, 135, 186, 214, 215], "signific": [0, 4, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 116, 135, 186, 214, 215], "p": [0, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 102, 116, 135, 186, 214, 215], "split_fold_change_direct": [0, 8, 215], "filteirng": [0, 8, 128], "volcano_plot": [0, 8, 215], "log2fc_threshold": [0, 8, 135], "volcano": [0, 8, 135, 214], "adj": [0, 8, 135], "upregul": [0, 8, 135, 214, 215], "downregul": [0, 8, 135, 214], "blue": [0, 8, 135, 214], "paint": [0, 8, 135], "regul": [0, 8, 135, 214, 215], "numerator_nam": [0, 8, 165, 180], "denominator_nam": [0, 8, 165, 180], "repres": [0, 3, 8, 165, 214, 215], "could": [0, 1, 8, 165, 214, 215], "incorrect": [0, 8, 165], "fc_1": [0, 8, 170, 176, 186, 191, 215], "randomization_test": [0, 8, 215], "rep": [0, 8, 15, 29, 186], "10000": [0, 8, 15, 16, 18, 23, 29, 30, 32, 40, 186], "examin": [0, 8, 186], "background": [0, 3, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "score": [0, 8, 14, 16, 18, 23, 28, 30, 32, 40, 41, 186, 214, 215], "repetit": [0, 8, 15, 29, 186, 215], "000": [0, 8, 15, 29, 186, 215], "dir": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "No": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186], "requir": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 214, 215], "request": [0, 4, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 215], "prompt": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 186, 214, 215], "f_background": [0, 8, 186, 215], "code": [0, 3, 4, 5, 6, 7, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 36, 40, 186, 214], "f_test": [0, 8, 186, 215], "rand_test_r": [0, 8, 186, 215], "806873": [0, 8, 186, 215], "360264": [0, 8, 186, 215], "ignor": [0, 8, 191, 215], "pos_log2fc": [0, 8, 191], "neg_log2fc": [0, 8, 191], "pipelin": [0, 3, 4, 7, 8], "filter_typ": [0, 8, 198, 200, 215], "collect": [0, 8, 198], "sequenti": [0, 8, 198, 200, 214], "_apply_filter_norm_sort": 0, "func": [0, 8, 199], "filter_object": [0, 8, 200], "arg": [0, 8, 199], "_apply_oth": 0, "other_output": 0, "other_cnt": 0, "counter": [0, 215], "alreadi": [0, 4, 45, 214], "call": [0, 4, 7, 214, 215], "_apply_split": 0, "_func_signatur": 0, "signatur": [0, 4], "_param_str": 0, "argumentss": 0, "add_funct": [0, 8, 200, 203, 215], "correspod": [0, 8, 199], "columnnam": [0, 8, 199], "virtual": [0, 8, 199], "apply_to": [0, 4, 8, 199, 215], "unkeyword": [0, 8, 199], "pipe": [0, 8, 198, 199, 200, 203, 215], "col1": [0, 8, 199], "ident": [0, 8, 200, 214], "noth": [0, 8, 200], "load": [0, 3, 4, 8, 45, 102, 136, 165, 200, 214], "d_filter": [0, 8, 200, 215], "export_pipelin": [0, 8], "export": [0, 4, 8, 201, 214], "import_pipelin": [0, 8], "remove_last_funct": [0, 8, 215], "These": [0, 8, 9, 214], "ontologi": [0, 4, 7, 8, 9, 16, 30, 36, 214, 215], "tissu": [0, 8, 9, 214], "phenotyp": [0, 8, 9], "gene_set": [0, 8, 10, 24, 215], "set_nam": [0, 4, 8, 10, 12, 24, 26, 215], "preform": [0, 8, 10, 24], "self": 0, "anoth": [0, 4, 102, 214, 215], "en": [0, 8, 11, 13, 17, 21, 22, 25, 27, 31, 38, 39, 215], "change_set_nam": [0, 4, 8], "new_nam": [0, 8, 12, 26], "rankedset": [0, 3, 4, 8, 13, 17, 21], "against": [0, 8, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 27, 28, 29, 30, 31, 32, 33, 38, 39, 40, 215], "compar": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39, 215], "en2": [0, 8, 13, 17, 21, 22, 27, 31, 38, 39], "enrich_hypergeometr": [0, 4, 8, 215], "background_gen": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 215], "attr_ref_path": [0, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40, 215], "biotype_ref_path": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40], "return_nonsignific": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214], "return_fig": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 215], "plot_horizont": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "parallel": [0, 4, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214], "deprac": [0, 8, 14, 15, 28, 29], "pleas": [0, 1, 7, 8, 14, 15, 28, 29], "user_defined_enrich": [0, 4, 8, 14, 15, 28, 29], "deplet": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 215], "hypergeometr": [0, 4, 8, 14, 16, 18, 23, 28, 30, 32, 35, 36, 37, 40, 214, 215], "variabl": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 214, 215], "success": [0, 8, 14, 15, 28, 29, 215], "we": [0, 8, 14, 28, 215], "randomli": [0, 4, 8, 14, 28, 215], "replac": [0, 4, 8, 14, 28, 215], "case": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214, 215], "correct": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "benjamini": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "hochberg": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "step": [0, 1, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 214], "procedur": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 214], "fdr": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40], "In": [0, 7, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 214, 215], "clariti": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41], "linear": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 41, 215], "smallest": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 214, 215], "rais": [0, 8, 14, 15, 19, 23, 28, 29, 33, 35, 40], "cannot": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 40, 214, 215], "ones": [0, 8, 14, 15, 18, 23, 28, 29, 32, 35, 40], "horizont": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "bar": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 214, 215], "vertic": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 37, 40, 41, 215], "process": [0, 6, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214, 215], "shorter": [0, 8, 14, 15, 16, 18, 23, 28, 29, 30, 32, 35, 36, 40, 214], "return_figur": [0, 8, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 40], "enrich_random": [0, 4, 8, 41, 215], "bias": [0, 8, 15, 29], "estim": [0, 7, 8, 15, 29, 214, 215], "real": [0, 8, 15, 29, 214, 215], "approach": [0, 8, 15, 29, 215], "infin": [0, 8, 15, 29], "unbias": [0, 8, 15, 29], "pseudorandom": [0, 8, 15, 16, 29, 30], "By": [0, 8, 15, 16, 29, 30, 214, 215], "get": [0, 7, 8, 15, 16, 29, 30, 214, 215], "consist": [0, 4, 8, 15, 16, 29, 30, 206, 207, 214, 215], "go_enrich": [0, 4, 8, 215], "statistical_test": [0, 8, 16, 18, 23, 30, 32, 40, 215], "fisher": [0, 8, 16, 18, 23, 30, 32, 40, 215], "propagate_annot": [0, 8, 16, 30, 36, 58, 111, 144, 174], "classic": [0, 8, 16, 30, 36, 215], "elim": [0, 8, 16, 30, 36, 215], "aspect": [0, 4, 8, 16, 30, 36, 214], "biological_process": [0, 8, 16, 30, 36], "molecular": [0, 8, 16, 30, 36, 214, 215], "cellular": [0, 8, 16, 30, 36, 214, 215], "evidence_typ": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "phylogenet": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "author": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "curat": [0, 8, 16, 18, 30, 32, 36, 37, 58, 111, 144, 174, 214, 215], "electron": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "excluded_evidence_typ": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "databas": [0, 8, 16, 30, 36, 58, 111, 144, 174], "excluded_databas": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "qualifi": [0, 8, 16, 30, 36, 58, 111, 144, 174], "contributes_to": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "colocalizes_with": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "excluded_qualifi": [0, 8, 16, 30, 36, 58, 111, 144, 174, 215], "plot_ontology_graph": [0, 8, 16, 30, 36, 215], "ontology_graph_format": [0, 8, 16, 30, 36, 215], "pdf": [0, 8, 16, 30, 36, 37, 215], "svg": [0, 8, 16, 30, 215], "png": [0, 8, 16, 30, 215], "randomization_rep": [0, 8, 16, 18, 23, 30, 32, 40, 215], "via": [0, 6, 7, 8, 16, 30, 36, 215], "solr": [0, 8, 16, 30, 36], "search": [0, 8, 16, 30, 36], "engin": [0, 8, 16, 30, 36], "golr": [0, 8, 16, 30, 36], "some": [0, 4, 7, 8, 16, 18, 23, 30, 32, 40, 214, 215], "propag": [0, 8, 16, 18, 23, 30, 32, 36, 40, 214], "dag": [0, 8, 16, 30, 36, 215], "root": [0, 8, 16, 30, 36], "termin": [0, 6, 7, 8, 16, 30, 36, 215], "node": [0, 8, 16, 30, 36, 215], "manner": [0, 8, 16, 30, 36], "children": [0, 8, 16, 30, 36], "parent": [0, 8, 16, 30, 36, 215], "allm": [0, 8, 16, 30, 36], "proopag": [0, 8, 16, 30, 36], "alexa": [0, 8, 16, 30, 36], "pubm": [0, 8, 16, 30, 36, 215], "nlm": [0, 8, 16, 30, 36, 215], "nih": [0, 8, 16, 30, 36, 215], "gov": [0, 8, 16, 30, 36, 215], "16606683": [0, 8, 16, 30, 36, 215], "molecular_funct": [0, 8, 16, 30, 36], "cellular_compon": [0, 8, 16, 30, 36], "evid": [0, 8, 16, 30, 36, 214], "categori": [0, 8, 16, 30, 36, 214, 215], "consortium": [0, 8, 16, 30, 36, 215], "geneontologi": [0, 8, 16, 30, 36, 215], "doc": [0, 1, 8, 16, 30, 36, 215], "amigo": [0, 8, 16, 30, 36], "xref": [0, 8, 16, 30, 36], "spefici": [0, 4, 8, 16, 30, 36], "depict": [0, 8, 16, 30, 36, 214, 215], "repitit": [0, 8, 16, 18, 23, 30, 32, 40, 215], "common": [0, 8, 17, 31, 205, 214], "kegg_enrich": [0, 8, 215], "kyoto": [0, 8, 18, 32, 37], "encyclopedia": [0, 8, 18, 32, 37], "non_categorical_enrich": [0, 8, 215], "parametric_test": [0, 8, 19, 33, 215], "plot_log_scal": [0, 8, 19, 33, 215], "interleav": [0, 8, 19, 33, 215], "n_bin": [0, 8, 19, 33], "sign": [0, 8, 19, 33, 215], "parametr": [0, 8, 19, 33, 215], "logarithm": [0, 4, 8, 19, 33, 214, 215], "histogram": [0, 8, 19, 33, 214, 215], "semi": [0, 8, 19, 33, 214], "transpar": [0, 8, 19, 33, 43], "obsrev": [0, 8, 19, 33], "bin": [0, 8, 19, 33], "save_txt": [0, 8, 215], "doesn": [0, 8, 20, 34, 214], "ONE": [0, 8, 21, 38], "neither": [0, 8, 21, 38], "b": [0, 1, 8, 21, 38, 43, 214], "ranked_gen": [0, 8, 24, 215], "rank": [0, 3, 4, 7, 8, 24, 215], "meaning": [0, 8, 24, 214, 215], "vector": [0, 8], "single_set_enrich": [0, 4, 8, 215], "xl": [0, 4, 7, 8, 35, 36, 37, 215], "mhg": [0, 4, 7, 8, 35, 36, 37, 215], "develop": [0, 1, 5, 8, 35, 36, 37, 214, 215], "prof": [0, 8, 35, 36, 37], "zohar": [0, 8, 35, 36, 37], "yakhini": [0, 7, 8, 35, 36, 37], "colleagu": [0, 8, 35, 36, 37], "florian": [0, 8, 35, 36, 37], "wagner": [0, 4, 7, 8, 35, 36, 37], "single_set_go_enrich": [0, 4, 8, 215], "single_set_kegg_enrich": [0, 8, 215], "plot_pathway_graph": [0, 8, 37], "pathway_graphs_format": [0, 8, 37], "_fetch_set": 0, "obj": [0, 4, 8, 42, 43], "upset_plot": [0, 4, 8, 215], "venn_diagram": [0, 4, 8, 215], "turn": 0, "python": [0, 1, 4, 6, 7, 8, 42, 43, 215], "kei": [0, 8, 42, 43, 215], "plot_enrichment_result": [0, 8, 215], "results_df": [0, 8, 41], "en_score_col": [0, 8, 41], "log2_fold_enrich": [0, 8, 41, 215], "name_col": [0, 8, 41], "center_bar": [0, 8, 41], "log_2": [0, 8, 41], "asterisk": [0, 8, 41, 215], "around": [0, 8, 41, 214, 215], "ylim": [0, 8, 41], "set_color": [0, 8, 42, 43], "black": [0, 8, 42, 43], "upset": [0, 4, 8, 42, 214], "show_percentag": [0, 8, 42], "attr_ref_table_path": [0, 8, 42, 43], "fig": [0, 8, 42, 43], "gene1": [0, 8, 10, 24, 42, 43, 215], "gene2": [0, 8, 10, 24, 42, 43, 215], "gene3": [0, 8, 42, 43, 215], "name_of_attribute_from_reference_t": [0, 8, 42, 43], "iif": [0, 8, 42], "subset": [0, 1, 8, 42, 43, 215], "mix": [0, 8, 42], "percentag": [0, 8, 42, 214], "entir": [0, 8, 42, 214], "onto": [0, 8, 42, 43], "shade": [0, 8, 42], "add_outlin": [0, 8, 43], "linecolor": [0, 8, 43], "linestyl": [0, 8, 43], "solid": [0, 8, 43], "dash": [0, 8, 43], "linewidth": [0, 8, 43], "set_fonts": [0, 8, 43], "subset_fonts": [0, 8, 43], "normalize_to": [0, 8, 43], "venn": [0, 4, 7, 8, 43], "diagram": [0, 4, 8, 43], "circl": [0, 4, 8, 43, 214], "opac": [0, 8, 43], "while": [0, 4, 8, 43, 214, 215], "opaqu": [0, 8, 43], "area": [0, 8, 43, 214], "outlin": [0, 4, 8, 43], "widdth": [0, 8, 43], "sometim": [0, 4, 8, 43], "tune": [0, 8, 43, 215], "overal": [0, 8, 43], "fitur": [0, 8, 43], "fit": [0, 8, 43, 214, 215], "better": [0, 4, 8, 43, 215], "venndiagram": [0, 8, 43], "patch": [0, 1, 8, 43], "pars": [0, 4, 8, 205, 206, 207, 208], "parse_gene_name_str": [0, 8], "daf": [0, 8, 206, 207, 215], "lin15b": [0, 8, 206], "sequenc": [0, 4, 5, 7, 8, 206, 207], "z": [0, 5, 7, 8, 206, 207], "charact": [0, 8, 206, 207], "saeg": [0, 8, 206], "lin": [0, 8, 206, 215], "15b": [0, 8, 206, 215], "cyp": [0, 8, 206], "23a1lin": [0, 8, 206], "15a": [0, 8, 206], "wbgene12345678": [0, 8, 206, 208], "ghf5h": [0, 8, 206], "23a1": [0, 8, 206], "parse_sequence_name_str": [0, 8], "y55d5a": [0, 8, 207, 215], "digit": [0, 8, 207, 208], "cele_y55d5a": [0, 8, 207], "5t23g5": [0, 8, 207], "6wbgene00000000": [0, 8, 207], "zk662": [0, 8, 207], "t23g5": [0, 8, 207, 215], "parse_wbgene_str": [0, 8, 215], "wbgene98765432wbgene00000000": [0, 8, 208], "genewbgene44444444daf": [0, 8, 208], "16a5ghb": [0, 8, 208], "wbgene55555555": [0, 8, 208], "wbgene44444444": [0, 8, 208], "wbgene98765432": [0, 8, 208], "wbgene00000000": [0, 8, 208], "print_settings_fil": [0, 8], "configur": [0, 8, 209], "my_attribute_reference_table_path": [0, 8, 209, 212], "my_biotype_reference_table_path": [0, 8, 209, 213], "reset_settings_fil": [0, 8], "reset": [0, 8, 210], "local": [0, 1, 8, 210, 214], "delet": [0, 8, 210, 214], "warn": [0, 8, 45, 102, 165, 210, 214], "action": [0, 8, 210, 214, 215], "irrevers": [0, 8, 210], "save_to_csv": [0, 8], "control": [0, 8, 211], "directori": [0, 4, 8, 211, 215], "set_attr_ref_table_path": [0, 3, 8, 215], "wish": [0, 8, 212, 213, 214], "set_biotype_ref_table_path": [0, 3, 8, 215], "mainli": 0, "refer": [3, 4, 5, 8, 11, 14, 15, 16, 18, 19, 23, 25, 28, 29, 30, 32, 33, 35, 40, 42, 43, 48, 56, 57, 70, 72, 74, 87, 104, 109, 110, 126, 138, 142, 143, 157, 167, 172, 173, 186, 189, 209, 212, 213, 214], "intestin": [3, 215], "epigenet": [3, 214, 215], "paralog": [3, 214, 215], "abut": 3, "gener": [3, 4, 5, 7, 14, 15, 16, 18, 19, 23, 28, 29, 30, 32, 33, 35, 36, 37, 40, 42, 43, 46, 49, 50, 51, 54, 70, 73, 75, 80, 81, 84, 85, 90, 93, 94, 101, 105, 124, 135, 139, 155, 168, 187, 214], "filter": [3, 4, 5, 7, 10, 11, 14, 15, 16, 18, 19, 23, 24, 25, 28, 29, 30, 32, 33, 40, 205, 211], "enrich": [3, 4, 5, 7], "modul": [3, 4, 9, 44, 199, 205], "lncrna": 3, "rnalysi": [1, 3, 4, 6, 214], "matric": [3, 4, 7, 214], "detail": [1, 3, 214, 215], "enrichmemt": 3, "store": [3, 215], "structur": [3, 102, 165, 215], "offer": [3, 214], "util": [3, 4, 215], "subtyp": [3, 215], "unsort": 3, "howev": [3, 214, 215], "introduc": [4, 215], "qualiti": [4, 215], "life": [4, 214], "graphic": [4, 5, 214], "interfac": [4, 5, 214], "translat": [4, 215], "extend": 4, "translate_gene_id": [4, 8], "filter_by_go_annot": [4, 8], "fastq": [4, 7], "adapt": [4, 7], "cutadapt": [4, 7], "mrna": [4, 214], "quantif": [4, 7, 214], "kallisto": [4, 7], "now": [1, 4, 214, 215], "replicates_group": [4, 214, 215], "refactor": 4, "filter_biotyp": 4, "queue": 4, "computation": 4, "intens": 4, "task": 4, "bug": [4, 5, 7], "disappear": 4, "except": [4, 215], "dure": [4, 214, 215], "caus": [4, 214], "crash": 4, "auxillari": 4, "window": [4, 6, 7, 214, 215], "properli": [4, 214, 215], "restor": 4, "encount": 4, "minor": [1, 4], "renam": [4, 214], "supplement": 4, "correctli": [4, 215], "tutori": [4, 5, 7], "video": 4, "deprec": 4, "longer": 4, "ensur": [4, 214], "among": 4, "unweight": 4, "issu": [1, 4, 45, 102, 165, 214, 215], "recent": 4, "api": [4, 5, 214, 215], "moreov": [4, 214, 215], "slightli": 4, "cach": 4, "runtim": 4, "reflect": [4, 214], "implement": [4, 214, 215], "small": [4, 214], "infer": [4, 214], "priorit": 4, "occur": [4, 215], "befor": [1, 4, 214], "exact": [4, 214, 215], "spuriou": 4, "occurs": 4, "wai": [1, 4, 7, 214], "customiz": 4, "quicker": 4, "conveni": 4, "elabor": [4, 215], "pattern": [4, 214, 215], "perfofm": 4, "eden": [4, 7], "plo": [4, 7, 215], "biol": [4, 7], "2007": [4, 7, 214, 215], "One": [4, 214, 215], "2015": [4, 214], "let": [4, 214], "enrich_randomization_parallel": [4, 215], "parallel_process": 4, "session": [4, 214], "activ": [4, 215], "six": [4, 214, 215], "y_titl": 4, "clearli": 4, "data_scal": 4, "ob": [4, 215], "exp": [4, 215], "respect": [4, 214], "boolean": [4, 215], "_missing_from_biotype_refer": 4, "not_in_biotype_refer": 4, "hint": 4, "empti": [4, 214, 215], "few": [4, 214, 215], "docstr": [1, 4], "printout": 4, "sever": [4, 215], "speed": 4, "board": 4, "feature_str": 4, "abl": [4, 214, 215], "depracationwarn": 4, "linux": 4, "system": [1, 4, 214], "wrong": 4, "utf": 4, "encod": 4, "won": [4, 214, 215], "upsetplot": [4, 7], "divis": 4, "prevent": 4, "previou": [4, 214], "stabl": [4, 5], "releas": [4, 5], "pypi": [1, 4, 6, 7, 215], "upgrad": 4, "report": [4, 5, 7, 214], "write": [4, 7, 214], "been": [4, 214, 215], "deseq_highlight": 4, "load_csv": 4, "clearer": 4, "predict": 4, "comprehens": 4, "filter_by_ref_table_attr": 4, "split_by_ref_table_attr": 4, "norm_reads_with_size_factor": 4, "norm_reads_to_rpm": 4, "made": [4, 214], "hidden": 4, "feature_name_to_wbgen": 4, "beta": 4, "link": [5, 7, 214, 215], "sourc": [5, 7, 214], "depend": [5, 214, 215], "credit": [1, 5], "cite": [5, 215], "contributor": 5, "github": [1, 5, 6], "page": [5, 214], "intro": 5, "word": 5, "glossari": 5, "2022": [5, 7], "11": [5, 7, 214], "07": 5, "04": 5, "02": 5, "2021": 5, "03": 5, "filter_biotype_from_gtf": [0, 8], "go_id": [8, 58, 111, 144, 174], "from_datafram": 8, "translate_to": [8, 99, 133, 163, 196], "translate_from": [8, 99, 133, 163, 196], "remove_unmapped_gen": [8, 99, 133, 163, 196], "filter_types_rev": 8, "readable_nam": 8, "__init__": [10, 24, 45, 102, 136, 165, 198], "downstream": [10, 24, 214], "my_set": [10, 24, 215], "my": [10, 24, 214, 215], "filter_obj": [10, 24], "my_other_set": [10, 24, 215], "valid": [45, 102, 165, 214], "drop": [45, 102, 136, 214], "deseq_pip": [198, 215], "command": [6, 7, 214, 215], "gui": [7, 215], "consol": [7, 215], "run_gui": [7, 215], "click": [214, 215], "overview": [7, 214, 215], "button": [214, 215], "entireti": 215, "desir": [214, 215], "until": 215, "At": [214, 215], "moment": 215, "histori": [1, 214, 215], "redo": [214, 215], "resiz": 215, "workspac": 215, "right": [214, 215], "accident": 215, "worri": 215, "through": [1, 6, 7, 214, 215], "edit": 215, "menu": [214, 215], "soon": 215, "review": 215, "extract": 215, "preview": [214, 215], "pane": 215, "just": [1, 215], "workflow": 215, "faster": 215, "prone": 215, "easier": [1, 214, 215], "understand": 215, "built": 215, "rapid": [214, 215], "section": 215, "principl": [214, 215], "look": [1, 214, 215], "glimps": 215, "line": [7, 214, 215], "access": 215, "our": 215, "directli": [214, 215], "represent": 215, "5954": 215, "remain": [214, 215], "17781": 215, "unaffect": 215, "unchang": 215, "becam": 215, "continu": 215, "suppos": 215, "kept": 215, "want": [1, 214, 215], "throw": [214, 215], "rest": [214, 215], "There": [214, 215], "project": [1, 7, 214, 215], "yet": 215, "sinc": [214, 215], "500": 215, "myfold": 215, "test_deseq_below0": 215, "75basemeangt500": 215, "altern": [7, 215], "alternative_filenam": 215, "later": [214, 215], "Or": [7, 215], "eahc": 215, "return_format": 215, "easili": 215, "here": [1, 214, 215], "18129": 215, "b9": 215, "bioc": 215, "assum": [1, 214, 215], "lfcse": 215, "stat": 215, "044": 215, "329404": 215, "158938": 215, "94783": 215, "96e": 215, "80e": 215, "813": 215, "291484": 215, "93189": 215, "74e": 215, "40e": 215, "567": 215, "190439": 215, "51433": 215, "60e": 215, "34e": 215, "9257": 215, "246313": 215, "49419": 215, "23e": 215, "82e": 215, "186": 215, "129606": 215, "11463": 215, "91e": 215, "46e": 215, "649": 215, "03719": 215, "219781": 215, "3691": 215, "32e": 215, "70e": 215, "1429": 215, "347777": 215, "26471": 215, "58e": 215, "12e": 215, "1632": 215, "217802": 215, "96885": 215, "42e": 215, "similarli": [214, 215], "insignific": 215, "With": 215, "magnitud": [214, 215], "capabl": 215, "softwar": [7, 215], "featurecount": 215, "readthedoc": 215, "io": [1, 215], "master": 215, "html": 215, "unintend": 215, "interact": [214, 215], "sam": 215, "bam": 215, "nativ": 215, "weren": 215, "low": 215, "376": 215, "177": 215, "__no_featur": 215, "__ambigu": 215, "__too_low_aqu": 215, "__not_align": 215, "121": 215, "__alignment_not_uniqu": 215, "deault": 215, "unmap": 215, "uq": 215, "normalize_quantil": 215, "normalize_mrn": 215, "simpli": [214, 215], "sample4": 215, "96": 215, "special": 215, "37": 215, "145": 215, "77": 215, "9468": 215, "11354": 215, "14009": 215, "30287": 215, "108": 215, "290": 215, "557": 215, "893": 215, "109853": 215, "277653": 215, "88653": 215, "96012": 215, "Such": 215, "cell": [214, 215], "__alignment_no_uniqu": 215, "wide": [214, 215], "varieti": 215, "five_clust": 215, "len": 215, "two_clust": 215, "model": [214, 215], "silhouette_clust": 215, "rang": 215, "gap_stat_clust": 215, "evalu": 215, "outcom": 215, "partit": 215, "squar": [7, 215], "eucliean": 215, "therefor": [214, 215], "main": [214, 215], "simplic": 215, "veri": [214, 215], "dissimilar": [214, 215], "eucliidean": 215, "cityblock": 215, "heyer": 215, "kruglyak": 215, "yooseph": 215, "1999": 215, "son": [214, 215], "baek": [214, 215], "hamm": 215, "scikit": [7, 215], "agglom": 215, "aim": 215, "further": [214, 215], "eventu": 215, "connect": 215, "decid": [214, 215], "cut": 215, "height": 215, "specifii": 215, "stand": [214, 215], "densiti": [7, 215], "applic": [214, 215], "springer": 215, "com": [1, 6, 7, 215], "chapter": 215, "1007": 215, "978": 215, "642": 215, "37456": 215, "2_14": 215, "tradit": [214, 215], "hsbscan": [214, 215], "assumpt": [214, 215], "hope": [214, 215], "unlik": [214, 215], "outlier": [214, 215], "guess": [214, 215], "interest": 215, "1016": 215, "j": [7, 215], "eswa": 215, "2011": [7, 214, 215], "08": 215, "059": 215, "potenti": [214, 215], "weak": [214, 215], "account": [214, 215], "robustli": [214, 215], "themselv": [214, 215], "th": [214, 215], "reduc": [214, 215], "increas": [214, 215], "robust": [214, 215], "larg": [214, 215], "quick": [214, 215], "strong": 215, "numerator_read": 215, "denominator_read": 215, "underli": 215, "lack": 215, "famili": 215, "enter": [214, 215], "mean_numerator_read": 215, "mean_denominator_read": 215, "cond3_rep1": 215, "cond3_rep2": 215, "condition1": 215, "condition2": 215, "51828": 215, "36026": 215, "becaus": [214, 215], "itself": 215, "column1": 215, "repr": 215, "alongsid": [214, 215], "output_dict": 215, "biotypes_1": 215, "biotypes_2": 215, "output_dict_inplac": 215, "append": 215, "hyperosmot": 215, "anslys": 215, "my_filter_obj": 215, "my_python_set": 215, "wbgene0245200": 215, "wbgene00402029": 215, "third": 215, "paresd": 215, "path_to_my_fil": 215, "product": 215, "speci": 215, "know": [214, 215], "6239": 215, "mischaracter": 215, "sure": [1, 214, 215], "furthermor": 215, "certain": [214, 215], "deem": 215, "importantli": 215, "usual": [214, 215], "my_background_set": 215, "feature1": 215, "feature2": 215, "feature3": 215, "oppos": 215, "mark": [214, 215], "sucess": 215, "bia": 215, "zero": 215, "topic": 215, "21044043": 215, "discret": 215, "contribut": 215, "locomot": 215, "wnt": 215, "carri": 215, "antioxid": 215, "atp": 215, "chaperon": 215, "locat": [214, 215], "granul": 215, "mitochondrion": 215, "exclus": [214, 215], "associ": [214, 215], "kind": [214, 215], "silico": 215, "statement": 215, "judgement": 215, "homologi": 215, "definit": 215, "iea": 215, "ikr": 215, "arabidopsi": 215, "resourc": 215, "explicit": 215, "demonstr": 215, "facilit": 215, "complex": 215, "organel": 215, "somewhat": 215, "cyclic": 215, "site": 215, "hexos": 215, "biosynthet": 215, "metabol": 215, "sens": 215, "said": 215, "upstream": 215, "unfortun": [214, 215], "neighbor": [214, 215], "discoveri": 215, "rate": 215, "deal": 215, "problem": 215, "de": 215, "compromis": 215, "suggest": [214, 215], "propagation_method": 215, "after": [214, 215], "orient": [214, 215], "custom": [7, 215], "barplot": 215, "0001556": 215, "oocyt": 215, "matur": 215, "1327": 215, "319": 215, "49722119558": 215, "0000999": 215, "0043186": 215, "89": 215, "244": 215, "87": 215, "46013879322": 215, "cel00010": 215, "glycolysi": 215, "gluconeogenesi": 215, "nematod": [214, 215], "cel00030": 215, "pentos": 215, "phosphat": 215, "retreiv": 215, "peform": 215, "neuron": 215, "male": 215, "attirubt": 215, "student": 215, "meet": [1, 215], "wbgene00003002": 215, "wbgene00004201": 215, "wbgene00300139": 215, "union_result": 215, "limit": 215, "tool": [7, 214, 215], "inher": 215, "behav": 215, "journal": [7, 215], "ploscompbiol": 215, "articl": [1, 215], "1371": [7, 215], "pcbi": [7, 215], "0030039": [7, 215], "arxiv": [7, 215], "ab": 215, "1507": [7, 215], "07905": [7, 215], "my_ranked_set": 215, "my_list": 215, "much": [214, 215], "comapr": 215, "ranked_set": 215, "wbgene00000106": 215, "wbgene00000041": 215, "wbgene00000105": 215, "go_en_result": 215, "en_result": 215, "emploi": 215, "sets_to_visu": 215, "gene4": 215, "accur": 215, "proport": [214, 215], "app": 215, "parser": 215, "nearest": [214, 215], "feature_indic": [214, 215], "wbgene0000001": [214, 215], "wbgene0000002": [214, 215], "241": [214, 215], "wbgene0000003": [214, 215], "wbgene0000004": [214, 215], "wbgene0000005": [214, 215], "insensit": 215, "futur": [214, 215], "the_new_attribute_reference_table_path": 215, "the_new_biotype_reference_table_path": 215, "whenev": [214, 215], "read_attr_ref_table_path": 215, "read_biotype_ref_table_path": 215, "attr_table_path": 215, "the_attribute_reference_table_path_that_was_saved_in_the_settings_fil": 215, "biotype_table_path": 215, "the_biotype_reference_table_path_that_was_saved_in_the_settings_fil": 215, "wbgene00023495": 215, "my_str": 215, "wbgene00000002wbgene00000003": 215, "wbgene00000004g": 215, "wbgene000000002": 215, "welcom": 1, "greatli": 1, "appreci": 1, "littl": 1, "bit": [1, 214], "guyteichman": [1, 6, 7], "might": [1, 6, 7, 214], "troubleshoot": 1, "reproduc": [1, 214], "tag": 1, "open": [1, 7, 214], "whoever": 1, "offici": [1, 214], "web": 1, "blog": 1, "send": 1, "propos": 1, "work": [1, 6, 7, 214], "scope": 1, "narrow": 1, "rememb": [1, 214], "volunt": 1, "driven": 1, "readi": 1, "fork": 1, "repo": 1, "clone": [1, 6], "git": [1, 6], "your_name_her": 1, "virtualenv": 1, "virtualenvwrapp": 1, "mkvirtualenv": 1, "py": [1, 6], "branch": 1, "checkout": 1, "bugfix": 1, "re": [1, 214], "flake8": 1, "tox": 1, "pip": [1, 6, 7], "commit": 1, "push": 1, "readm": 1, "rst": 1, "coveral": 1, "test_rnalysi": 1, "remind": 1, "maintain": 1, "Then": [1, 6, 7, 214], "bumpvers": 1, "travi": 1, "citat": 4, "typo": 4, "machin": [6, 7], "graphviz": [6, 7], "microsoft": [6, 7, 214], "download": [6, 214], "repositori": 6, "analyz": [7, 214], "suit": 7, "research": 7, "question": [7, 214], "visualis": 7, "explor": [7, 214], "global": 7, "profil": 7, "dimension": [7, 214], "reduct": [7, 214], "share": [7, 214], "integr": 7, "seq": 7, "bracket": 7, "along": [7, 214], "launch": 7, "numba": 7, "extra": 7, "statsmodel": 7, "joblib": 7, "tqdm": 7, "appdir": 7, "grid_strategi": 7, "pyyaml": 7, "xlmhg": 7, "pairwisedist": 7, "typing_extens": 7, "pyqt5": 7, "qdarkstyl": 7, "teichman": 7, "cohen": 7, "ganon": 7, "o": 7, "dunski": 7, "shani": 7, "gingold": 7, "h": 7, "rechavi": 7, "biorxiv": 7, "517851": 7, "1101": 7, "martin": 7, "high": [7, 214], "throughput": 7, "embnet": 7, "pp": 7, "14806": 7, "ej": 7, "200": [7, 214], "brai": 7, "pimentel": 7, "melst": 7, "Near": 7, "probabilist": 7, "nat": 7, "biotechnol": 7, "34": 7, "527": 7, "2016": 7, "1038": 7, "nbt": 7, "3519": 7, "love": 7, "mi": 7, "w": 7, "2014": [7, 214], "moder": 7, "biologi": 7, "550": 7, "1186": 7, "s13059": 7, "014": 7, "0550": 7, "l": 7, "mcinn": 7, "heali": 7, "astel": 7, "volum": 7, "2017": 7, "lipson": 7, "yogev": 7, "motif": 7, "dna": 7, "e39": 7, "48550": 7, "gmail": 7, "dror": 7, "netta": 7, "shachar": 7, "cookiecutt": 7, "audreyr": 7, "pypackag": 7, "templat": 7, "cover": 214, "focu": 214, "publicli": 214, "literatur": 214, "gave": 214, "readabl": 214, "choos": 214, "u": 214, "dedic": 214, "fragment": 214, "kilobas": 214, "fpkm": 214, "mandatori": 214, "actual": 214, "regard": 214, "rather": 214, "fairli": 214, "gruop": 214, "finish": 214, "tab": 214, "expand": 214, "hover": 214, "cursor": 214, "everyth": 214, "unfilt": 214, "conveniet": 214, "unless": 214, "expelicitli": 214, "undon": 214, "happi": 214, "chose": 214, "scroll": 214, "panel": 214, "undo": 214, "thousand": 214, "still": 214, "difficult": 214, "vari": 214, "remedi": 214, "rearrang": 214, "captur": 214, "sub": 214, "That": 214, "standardaz": 214, "undesir": 214, "skew": 214, "disabl": 214, "neutral": 214, "largest": 214, "amount": 214, "preceed": 214, "perhap": 214, "worth": 214, "ey": 214, "interestingli": 214, "circular": 214, "worm": 214, "hypothesi": 214, "pc1": 214, "arrang": 214, "germlin": 214, "embryo": 214, "mostli": 214, "gonad": 214, "adult": 214, "quantiti": 214, "germ": 214, "l4": 214, "larva": 214, "prolifer": 214, "l3": 214, "pc2": 214, "spot": 214, "trend": 214, "seem": 214, "earlier": 214, "unexpress": 214, "wbgene00003864": 214, "almost": 214, "embryon": 214, "skn": 214, "wbgene00004804": 214, "pop": 214, "possibli": 214, "unlaid": 214, "convei": 214, "had": 214, "subgroup": 214, "cycl": 214, "abund": 214, "illustr": 214, "simplest": 214, "challeng": 214, "aren": 214, "reason": 214, "tempor": 214, "fortun": 214, "good": 214, "known": 214, "especi": 214, "wait": 214, "anslysi": 214, "left": 214, "orang": 214, "On": 214, "peak": 214, "granular": 214, "enough": 214, "regular": 214, "biggest": 214, "character": 214, "quit": 214, "degre": 214, "ok": 214, "cancel": 214, "reveal": 214, "obviou": 214, "again": 214, "move": 214, "emsembl": 214, "concensu": 214, "agre": 214, "half": 214, "mind": 214, "plu": 214, "progress": 214, "commonli": 214, "thw": 214, "enlarg": 214, "back": 214, "unannot": 214, "successfulli": 214, "ancestor": 214, "depth": 214, "geo": 214, "caenorhabidti": 214, "stress": 214, "goal": 214, "answer": 214, "exposur": 214, "expos": 214, "osmot": 214, "gse107704": 214, "unstrand": 214, "srr6348197": 214, "srr6348198": 214, "srr6348199": 214, "srr6348200": 214, "srr6348201": 214, "srr6348202": 214, "starvat": 214, "gse124178": 214, "strand": 214, "srr8359132": 214, "srr8359133": 214, "srr8359142": 214, "srr8359134": 214, "srr8359135": 214, "srr8359136": 214, "heat": 214, "shock": 214, "gse132838": 214, "srr9310678": 214, "srr9310679": 214, "srr9310680": 214, "srr9310681": 214, "srr9310682": 214, "srr9310683": 214, "opportun": 214, "xyz": 214, "detect": 214, "uaualli": 214, "popular": 214, "friendli": 214, "programmat": 214, "portion": 214, "leftov": 214, "happen": 214, "written": 214, "prime": 214, "illumina": 214, "truseq": 214, "agatcggaagagcacacgtctgaactccagtca": 214, "three_prime_adapt": 214, "dialog": 214, "flank": 214, "10bp": 214, "discard_untrimmed_read": 214, "discard": 214, "didn": 214, "awai": 214, "screen": 214, "agatcggaagagcgtcgtgtagggaaagagtg": 214, "reorder": 214, "proce": 214, "pseudoalign": 214, "target": 214, "transcriptom": 214, "physic": 214, "proceed": 214, "fasta": 214, "As": 214, "deviaton": 214, "accordingli": 214, "new_sample_nam": 214, "excel": 214, "scaledtpm": 214, "soneson": 214, "tximport": 214, "un": 214, "forward": 214, "underneath": 214, "subfold": 214, "revers": 214, "languag": 214, "side": 214, "genotyp": 214, "ctrl1": 214, "ctrl": 214, "ctrl2": 214, "ctrl3": 214, "osm1": 214, "osm": 214, "osm2": 214, "osm3": 214, "googl": 214, "sheet": 214, "prepar": 214, "matter": 214, "ran": 214, "straight": 214, "decent": 214, "chanc": 214, "ll": 214, "mistak": 214, "textbox": 214, "notic": 214, "close": 214, "resum": 214, "hard": 214, "big": 214, "seen": 214, "downregl": 214, "simplifi": 214, "primari": 214, "middl": 214, "luckili": 214, "newli": 214, "evolv": 214, "codon": 214, "deviat": 214, "norm": 214, "ye": 214, "convert": 214, "attirbut": 214, "mock": 214, "gut": 214, "houri": 214, "dalzel": 214, "yigit": 214, "2006": 214, "presenc": 214, "inflat": 214, "concern": 214, "123": 214, "18924": 214, "conclud": 214, "encompass": 214, "familiar": 214, "deeper": 214, "dive": 214, "feel": 214, "free": 214, "discuss": 214, "luck": 214, "bioinformat": 214, "endeavor": 214}, "objects": {"rnalysis": [[9, 0, 0, "-", "enrichment"], [44, 0, 0, "-", "filtering"], [205, 0, 0, "-", "general"]], "rnalysis.enrichment": [[10, 1, 1, "", "FeatureSet"], [24, 1, 1, "", "RankedSet"], [41, 3, 1, "", "plot_enrichment_results"], [42, 3, 1, "", "upset_plot"], [43, 3, 1, "", "venn_diagram"]], "rnalysis.enrichment.FeatureSet": [[10, 2, 1, "", "__init__"], [11, 2, 1, "", "biotypes"], [12, 2, 1, "", "change_set_name"], [13, 2, 1, "", "difference"], [14, 2, 1, "", "enrich_hypergeometric"], [15, 2, 1, "", "enrich_randomization"], [16, 2, 1, "", "go_enrichment"], [17, 2, 1, "", "intersection"], [18, 2, 1, "", "kegg_enrichment"], [19, 2, 1, "", "non_categorical_enrichment"], [20, 2, 1, "", "save_txt"], [21, 2, 1, "", "symmetric_difference"], [22, 2, 1, "", "union"], [23, 2, 1, "", "user_defined_enrichment"]], "rnalysis.enrichment.RankedSet": [[24, 2, 1, "", "__init__"], [25, 2, 1, "", "biotypes"], [26, 2, 1, "", "change_set_name"], [27, 2, 1, "", "difference"], [28, 2, 1, "", "enrich_hypergeometric"], [29, 2, 1, "", "enrich_randomization"], [30, 2, 1, "", "go_enrichment"], [31, 2, 1, "", "intersection"], [32, 2, 1, "", "kegg_enrichment"], [33, 2, 1, "", "non_categorical_enrichment"], [34, 2, 1, "", "save_txt"], [35, 2, 1, "", "single_set_enrichment"], [36, 2, 1, "", "single_set_go_enrichment"], [37, 2, 1, "", "single_set_kegg_enrichment"], [38, 2, 1, "", "symmetric_difference"], [39, 2, 1, "", "union"], [40, 2, 1, "", "user_defined_enrichment"]], "rnalysis.filtering": [[45, 1, 1, "", "CountFilter"], [102, 1, 1, "", "DESeqFilter"], [136, 1, 1, "", "Filter"], [165, 1, 1, "", "FoldChangeFilter"], [198, 1, 1, "", "Pipeline"], [204, 3, 1, "", "readable_name"]], "rnalysis.filtering.CountFilter": [[45, 2, 1, "", "__init__"], [46, 2, 1, "", "average_replicate_samples"], [47, 2, 1, "", "biotypes_from_gtf"], [48, 2, 1, "", "biotypes_from_ref_table"], [49, 2, 1, "", "box_plot"], [50, 2, 1, "", "clustergram"], [51, 2, 1, "", "describe"], [52, 2, 1, "", "difference"], [53, 2, 1, "", "differential_expression_deseq2"], [54, 2, 1, "", "enhanced_box_plot"], [55, 2, 1, "", "filter_biotype_from_gtf"], [56, 2, 1, "", "filter_biotype_from_ref_table"], [57, 2, 1, "", "filter_by_attribute"], [58, 2, 1, "", "filter_by_go_annotations"], [59, 2, 1, "", "filter_by_kegg_annotations"], [60, 2, 1, "", "filter_by_row_sum"], [61, 2, 1, "", "filter_low_reads"], [62, 2, 1, "", "filter_missing_values"], [63, 2, 1, "", "filter_percentile"], [64, 2, 1, "", "filter_top_n"], [65, 2, 1, "", "fold_change"], [66, 2, 1, "", "from_dataframe"], [67, 2, 1, "", "from_folder"], [68, 2, 1, "", "head"], [69, 2, 1, "", "intersection"], [70, 2, 1, "", "ma_plot"], [71, 2, 1, "", "majority_vote_intersection"], [72, 2, 1, "", "normalize_median_of_ratios"], [73, 2, 1, "", "normalize_rle"], [74, 2, 1, "", "normalize_tmm"], [75, 2, 1, "", "normalize_to_quantile"], [76, 2, 1, "", "normalize_to_rpm"], [77, 2, 1, "", "normalize_to_rpm_htseqcount"], [78, 2, 1, "", "normalize_with_scaling_factors"], [79, 2, 1, "", "number_filters"], [80, 2, 1, "", "pairplot"], [81, 2, 1, "", "pca"], [82, 2, 1, "", "plot_expression"], [83, 2, 1, "", "print_features"], [84, 2, 1, "", "save_csv"], [85, 2, 1, "", "scatter_sample_vs_sample"], [86, 2, 1, "", "sort"], [87, 2, 1, "", "split_by_attribute"], [88, 2, 1, "", "split_by_percentile"], [89, 2, 1, "", "split_by_reads"], [90, 2, 1, "", "split_clicom"], [91, 2, 1, "", "split_hdbscan"], [92, 2, 1, "", "split_hierarchical"], [93, 2, 1, "", "split_kmeans"], [94, 2, 1, "", "split_kmedoids"], [95, 2, 1, "", "symmetric_difference"], [96, 2, 1, "", "tail"], [97, 2, 1, "", "text_filters"], [98, 2, 1, "", "transform"], [99, 2, 1, "", "translate_gene_ids"], [100, 2, 1, "", "union"], [101, 2, 1, "", "violin_plot"]], "rnalysis.filtering.DESeqFilter": [[102, 2, 1, "", "__init__"], [103, 2, 1, "", "biotypes_from_gtf"], [104, 2, 1, "", "biotypes_from_ref_table"], [105, 2, 1, "", "describe"], [106, 2, 1, "", "difference"], [107, 2, 1, "", "filter_abs_log2_fold_change"], [108, 2, 1, "", "filter_biotype_from_gtf"], [109, 2, 1, "", "filter_biotype_from_ref_table"], [110, 2, 1, "", "filter_by_attribute"], [111, 2, 1, "", "filter_by_go_annotations"], [112, 2, 1, "", "filter_by_kegg_annotations"], [113, 2, 1, "", "filter_fold_change_direction"], [114, 2, 1, "", "filter_missing_values"], [115, 2, 1, "", "filter_percentile"], [116, 2, 1, "", "filter_significant"], [117, 2, 1, "", "filter_top_n"], [118, 2, 1, "", "from_dataframe"], [119, 2, 1, "", "head"], [120, 2, 1, "", "intersection"], [121, 2, 1, "", "majority_vote_intersection"], [122, 2, 1, "", "number_filters"], [123, 2, 1, "", "print_features"], [124, 2, 1, "", "save_csv"], [125, 2, 1, "", "sort"], [126, 2, 1, "", "split_by_attribute"], [127, 2, 1, "", "split_by_percentile"], [128, 2, 1, "", "split_fold_change_direction"], [129, 2, 1, "", "symmetric_difference"], [130, 2, 1, "", "tail"], [131, 2, 1, "", "text_filters"], [132, 2, 1, "", "transform"], [133, 2, 1, "", "translate_gene_ids"], [134, 2, 1, "", "union"], [135, 2, 1, "", "volcano_plot"]], "rnalysis.filtering.Filter": [[136, 2, 1, "", "__init__"], [137, 2, 1, "", "biotypes_from_gtf"], [138, 2, 1, "", "biotypes_from_ref_table"], [139, 2, 1, "", "describe"], [140, 2, 1, "", "difference"], [141, 2, 1, "", "filter_biotype_from_gtf"], [142, 2, 1, "", "filter_biotype_from_ref_table"], [143, 2, 1, "", "filter_by_attribute"], [144, 2, 1, "", "filter_by_go_annotations"], [145, 2, 1, "", "filter_by_kegg_annotations"], [146, 2, 1, "", "filter_missing_values"], [147, 2, 1, "", "filter_percentile"], [148, 2, 1, "", "filter_top_n"], [149, 2, 1, "", "from_dataframe"], [150, 2, 1, "", "head"], [151, 2, 1, "", "intersection"], [152, 2, 1, "", "majority_vote_intersection"], [153, 2, 1, "", "number_filters"], [154, 2, 1, "", "print_features"], [155, 2, 1, "", "save_csv"], [156, 2, 1, "", "sort"], [157, 2, 1, "", "split_by_attribute"], [158, 2, 1, "", "split_by_percentile"], [159, 2, 1, "", "symmetric_difference"], [160, 2, 1, "", "tail"], [161, 2, 1, "", "text_filters"], [162, 2, 1, "", "transform"], [163, 2, 1, "", "translate_gene_ids"], [164, 2, 1, "", "union"]], "rnalysis.filtering.FoldChangeFilter": [[165, 2, 1, "", "__init__"], [166, 2, 1, "", "biotypes_from_gtf"], [167, 2, 1, "", "biotypes_from_ref_table"], [168, 2, 1, "", "describe"], [169, 2, 1, "", "difference"], [170, 2, 1, "", "filter_abs_log2_fold_change"], [171, 2, 1, "", "filter_biotype_from_gtf"], [172, 2, 1, "", "filter_biotype_from_ref_table"], [173, 2, 1, "", "filter_by_attribute"], [174, 2, 1, "", "filter_by_go_annotations"], [175, 2, 1, "", "filter_by_kegg_annotations"], [176, 2, 1, "", "filter_fold_change_direction"], [177, 2, 1, "", "filter_missing_values"], [178, 2, 1, "", "filter_percentile"], [179, 2, 1, "", "filter_top_n"], [180, 2, 1, "", "from_dataframe"], [181, 2, 1, "", "head"], [182, 2, 1, "", "intersection"], [183, 2, 1, "", "majority_vote_intersection"], [184, 2, 1, "", "number_filters"], [185, 2, 1, "", "print_features"], [186, 2, 1, "", "randomization_test"], [187, 2, 1, "", "save_csv"], [188, 2, 1, "", "sort"], [189, 2, 1, "", "split_by_attribute"], [190, 2, 1, "", "split_by_percentile"], [191, 2, 1, "", "split_fold_change_direction"], [192, 2, 1, "", "symmetric_difference"], [193, 2, 1, "", "tail"], [194, 2, 1, "", "text_filters"], [195, 2, 1, "", "transform"], [196, 2, 1, "", "translate_gene_ids"], [197, 2, 1, "", "union"]], "rnalysis.filtering.Pipeline": [[198, 2, 1, "", "__init__"], [199, 2, 1, "", "add_function"], [200, 2, 1, "", "apply_to"], [201, 2, 1, "", "export_pipeline"], [202, 2, 1, "", "import_pipeline"], [203, 2, 1, "", "remove_last_function"]], "rnalysis.general": [[206, 3, 1, "", "parse_gene_name_string"], [207, 3, 1, "", "parse_sequence_name_string"], [208, 3, 1, "", "parse_wbgene_string"], [209, 3, 1, "", "print_settings_file"], [210, 3, 1, "", "reset_settings_file"], [211, 3, 1, "", "save_to_csv"], [212, 3, 1, "", "set_attr_ref_table_path"], [213, 3, 1, "", "set_biotype_ref_table_path"]]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:function"}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "function", "Python function"]}, "titleterms": {"api": 0, "refer": [0, 215], "rnalysi": [0, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 215], "filter": [0, 8, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 214, 215], "modul": [0, 5, 8, 215], "enrich": [0, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 214, 215], "gener": [0, 8, 205, 206, 207, 208, 209, 210, 211, 212, 213, 215], "util": 0, "glossari": 3, "histori": [4, 5], "3": [4, 5], "2": [4, 5, 214], "2022": 4, "11": 4, "23": 4, "ad": 4, "chang": [4, 5, 215], "fix": [1, 4], "1": [4, 214], "0": 4, "10": 4, "16": 4, "12": 4, "07": 4, "05": 4, "04": 4, "02": 4, "2021": 4, "5": 4, "2020": 4, "27": 4, "4": 4, "03": 4, "28": 4, "remov": [4, 214], "2019": 4, "document": [1, 5], "about": 5, "start": [1, 5], "indic": [5, 215], "tabl": [5, 215], "packag": 8, "featureset": [10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 215], "biotyp": [11, 25, 215], "change_set_nam": [12, 26], "differ": [13, 27, 52, 106, 140, 169, 215], "enrich_hypergeometr": [14, 28], "enrich_random": [15, 29], "go_enrich": [16, 30], "intersect": [17, 31, 69, 120, 151, 182, 215], "kegg_enrich": [18, 32], "non_categorical_enrich": [19, 33], "save_txt": [20, 34], "symmetric_differ": [21, 38, 95, 129, 159, 192], "union": [22, 39, 100, 134, 164, 197], "user_defined_enrich": [23, 40], "rankedset": [24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 215], "single_set_enrich": 35, "single_set_go_enrich": 36, "single_set_kegg_enrich": 37, "plot_enrichment_result": 41, "upset_plot": 42, "venn_diagram": 43, "countfilt": [45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 215], "average_replicate_sampl": 46, "biotypes_from_gtf": [47, 103, 137, 166], "biotypes_from_ref_t": [48, 104, 138, 167], "box_plot": 49, "clustergram": 50, "describ": [51, 105, 139, 168], "differential_expression_deseq2": 53, "enhanced_box_plot": 54, "filter_biotype_from_gtf": [55, 108, 141, 171], "filter_biotype_from_ref_t": [56, 109, 142, 172], "filter_by_attribut": [57, 110, 143, 173], "filter_by_go_annot": [58, 111, 144, 174], "filter_by_kegg_annot": [59, 112, 145, 175], "filter_by_row_sum": 60, "filter_low_read": 61, "filter_missing_valu": [62, 114, 146, 177], "filter_percentil": [63, 115, 147, 178], "filter_top_n": [64, 117, 148, 179], "fold_chang": 65, "from_datafram": [66, 118, 149, 180], "from_fold": 67, "head": [68, 119, 150, 181], "ma_plot": 70, "majority_vote_intersect": [71, 121, 152, 183], "normalize_median_of_ratio": 72, "normalize_rl": 73, "normalize_tmm": 74, "normalize_to_quantil": 75, "normalize_to_rpm": 76, "normalize_to_rpm_htseqcount": 77, "normalize_with_scaling_factor": 78, "number_filt": [79, 122, 153, 184], "pairplot": 80, "pca": 81, "plot_express": 82, "print_featur": [83, 123, 154, 185], "save_csv": [84, 124, 155, 187], "scatter_sample_vs_sampl": 85, "sort": [86, 125, 156, 188, 215], "split_by_attribut": [87, 126, 157, 189], "split_by_percentil": [88, 127, 158, 190], "split_by_read": 89, "split_clicom": 90, "split_hdbscan": 91, "split_hierarch": 92, "split_kmean": 93, "split_kmedoid": 94, "tail": [96, 130, 160, 193], "text_filt": [97, 131, 161, 194], "transform": [98, 132, 162, 195], "translate_gene_id": [99, 133, 163, 196], "violin_plot": 101, "deseqfilt": [102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 215], "filter_abs_log2_fold_chang": [107, 170], "filter_fold_change_direct": [113, 176], "filter_signific": 116, "split_fold_change_direct": [128, 191], "volcano_plot": 135, "foldchangefilt": [165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 215], "randomization_test": 186, "pipelin": [198, 199, 200, 201, 202, 203, 214, 215], "add_funct": 199, "apply_to": 200, "export_pipelin": 201, "import_pipelin": 202, "remove_last_funct": 203, "readable_nam": 204, "user": 215, "guid": 215, "graphic": 215, "interfac": 215, "open": 215, "program": 215, "load": 215, "examin": [214, 215], "your": 215, "undo": 215, "oper": 215, "you": 215, "appli": [214, 215], "place": 215, "new": 215, "save": 215, "made": 215, "work": 215, "multipl": 215, "same": 215, "time": [214, 215], "type": [1, 215], "offer": 215, "wai": 215, "analyz": 215, "data": [214, 215], "creat": [214, 215], "graph": 215, "tab": 215, "icon": 215, "restor": 215, "close": 215, "import": 215, "list": 215, "gene": [214, 215], "set": [214, 215], "visual": [214, 215], "between": [214, 215], "perform": 215, "analysi": [214, 215], "streamlin": 215, "one": 215, "more": 215, "export": 215, "share": 215, "make": 215, "reproduc": 215, "object": 215, "initi": 215, "view": 215, "result": 215, "us": [7, 215], "an": 215, "attribut": [214, 215], "deseq2": [214, 215], "output": 215, "file": [214, 215], "from": [6, 215], "csv": 215, "uniqu": 215, "exploratori": [214, 215], "count": 215, "matric": 215, "folder": 215, "htseq": 215, "txt": 215, "pre": 215, "normal": 215, "read": [214, 215], "cluster": [214, 215], "k": [214, 215], "mean": 215, "medoid": [214, 215], "hierarch": 215, "hdbscan": [214, 215], "clicom": [214, 215], "fold": 215, "featur": [1, 215], "exist": 215, "random": 215, "test": 215, "sequenti": 215, "go": 215, "defin": [214, 215], "correct": 215, "organ": 215, "id": 215, "dataset": [214, 215], "background": [214, 215], "choos": 215, "statist": 215, "option": 215, "term": 215, "aspect": 215, "annot": 215, "evid": 215, "code": 215, "databas": 215, "qualifi": 215, "propag": 215, "method": 215, "plot": 215, "paramet": 215, "kegg": 215, "pathwai": 215, "which": 215, "calcul": 215, "non": 215, "categor": 215, "visualis": 215, "singl": 215, "without": 215, "venn": [214, 215], "diagram": [214, 215], "upset": 215, "what": [7, 215], "i": [7, 215], "default": 215, "path": 215, "pars": 215, "c": 215, "elegan": 215, "name": 215, "wbgene": 215, "sequenc": [214, 215], "regular": 215, "express": [214, 215], "contribut": 1, "report": 1, "bug": 1, "implement": 1, "write": 1, "submit": 1, "feedback": 1, "get": 1, "pull": 1, "request": 1, "guidelin": 1, "tip": 1, "deploi": 1, "index": 2, "25": 4, "instal": [6, 7], "stabl": 6, "releas": 6, "sourc": 6, "can": 7, "do": 7, "how": 7, "depend": 7, "credit": 7, "cite": 7, "develop": 7, "lead": 7, "contributor": 7, "parse_gene_name_str": 206, "parse_sequence_name_str": 207, "parse_wbgene_str": 208, "print_settings_fil": 209, "reset_settings_fil": 210, "save_to_csv": 211, "set_attr_ref_table_path": 212, "set_biotype_ref_table_path": 213, "A": 214, "z": 214, "tutori": 214, "exampl": 214, "intro": 214, "recommend": 214, "seri": 214, "rna": 214, "The": 214, "preprocess": 214, "out": 214, "lowli": 214, "varianc": 214, "our": 214, "princip": 214, "compon": 214, "similar": 214, "development": 214, "stage": 214, "compar": 214, "specif": 214, "over": 214, "simpl": 214, "approach": 214, "distanc": 214, "base": 214, "fine": 214, "tune": 214, "densiti": 214, "complex": 214, "ensembl": 214, "run": 214, "differenti": 214, "quantifi": 214, "fastq": 214, "qualiti": 214, "control": 214, "fastqc": 214, "trim": 214, "adapt": 214, "low": 214, "cutadapt": 214, "kallisto": 214, "custom": 214, "extract": 214, "interesct": 214, "subset": 214, "we": 214, "ar": 214, "interest": 214, "final": 214, "word": 214}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx": 57}, "alltitles": {"API Reference": [[0, "api-reference"]], "rnalysis.filtering module": [[0, "rnalysis-filtering-module"], [8, "rnalysis-filtering-module"]], "rnalysis.enrichment module": [[0, "rnalysis-enrichment-module"], [8, "rnalysis-enrichment-module"]], "rnalysis.general module": [[0, "rnalysis-general-module"], [8, "rnalysis-general-module"]], "rnalysis.utils module": [[0, "rnalysis-utils-module"]], "Contributing": [[1, "contributing"]], "Types of Contributions": [[1, "types-of-contributions"]], "Report Bugs": [[1, "report-bugs"]], "Fix Bugs": [[1, "fix-bugs"]], "Implement Features": [[1, "implement-features"]], "Write Documentation": [[1, "write-documentation"]], "Submit Feedback": [[1, "submit-feedback"]], "Get Started!": [[1, "get-started"]], "Pull Request Guidelines": [[1, "pull-request-guidelines"]], "Tips": [[1, "tips"]], "Deploying": [[1, "deploying"]], "Index": [[2, "index"]], "Glossary": [[3, "glossary"]], "History": [[4, "history"]], "3.2.2 (2022-11-25)": [[4, "id1"]], "Fixed": [[4, "fixed"], [4, "id3"], [4, "id6"], [4, "id10"], [4, "id15"], [4, "id21"], [4, "id25"], [4, "id29"], [4, "id33"], [4, "id36"], [4, "id40"]], "3.2.1 (2022-11-25)": [[4, "id2"]], "Changed": [[4, "changed"], [4, "id5"], [4, "id9"], [4, "id14"], [4, "id17"], [4, "id20"], [4, "id24"], [4, "id28"], [4, "id32"], [4, "id35"], [4, "id39"]], "3.2.0 (2022-11-23)": [[4, "id4"]], "Added": [[4, "added"], [4, "id8"], [4, "id13"], [4, "id19"], [4, "id23"], [4, "id27"], [4, "id31"], [4, "id38"]], "3.1.0 (2022-10-16)": [[4, "id7"]], "3.0.1 (2022-10-12)": [[4, "id11"]], "3.0.0 (2022-10-10)": [[4, "id12"]], "2.1.1 (2022-07-05)": [[4, "id16"]], "2.1.0 (2022-04-16)": [[4, "id18"]], "2.0.1 (2022-04-02)": [[4, "id22"]], "2.0.0 (2021-12-05)": [[4, "id26"]], "1.3.5 (2020-05-27)": [[4, "id30"]], "1.3.4 (2020-04-07)": [[4, "id34"]], "1.3.3 (2020-03-28)": [[4, "id37"]], "Removed": [[4, "removed"]], "1.3.2 (2019-12-11)": [[4, "id41"]], "RNAlysis 3.2.2 documentation": [[5, "rnalysis-release-documentation"]], "About RNAlysis:": [[5, null]], "Starting with RNAlysis:": [[5, null]], "Change history:": [[5, null]], "Modules:": [[5, "modules"]], "Indices and tables:": [[5, null]], "Installation": [[6, "installation"]], "Stable release": [[6, "stable-release"]], "From sources": [[6, "from-sources"]], "What is RNAlysis?": [[7, "what-is-rnalysis"]], "What can I do with RNAlysis?": [[7, "what-can-i-do-with-rnalysis"]], "How do I install it?": [[7, "how-do-i-install-it"]], "How do I use it?": [[7, "how-do-i-use-it"]], "Dependencies": [[7, "dependencies"]], "Credits": [[7, "credits"]], "How do I cite RNAlysis?": [[7, "how-do-i-cite-rnalysis"]], "Development Lead": [[7, "development-lead"]], "Contributors": [[7, "contributors"]], "rnalysis package": [[8, "rnalysis-package"]], "rnalysis.enrichment": [[9, "rnalysis-enrichment"]], "rnalysis.enrichment.FeatureSet": [[10, "rnalysis-enrichment-featureset"]], "rnalysis.enrichment.FeatureSet.biotypes": [[11, "rnalysis-enrichment-featureset-biotypes"]], "rnalysis.enrichment.FeatureSet.change_set_name": [[12, "rnalysis-enrichment-featureset-change-set-name"]], "rnalysis.enrichment.FeatureSet.difference": [[13, "rnalysis-enrichment-featureset-difference"]], "rnalysis.enrichment.FeatureSet.enrich_hypergeometric": [[14, "rnalysis-enrichment-featureset-enrich-hypergeometric"]], "rnalysis.enrichment.FeatureSet.enrich_randomization": [[15, "rnalysis-enrichment-featureset-enrich-randomization"]], "rnalysis.enrichment.FeatureSet.go_enrichment": [[16, "rnalysis-enrichment-featureset-go-enrichment"]], "rnalysis.enrichment.FeatureSet.intersection": [[17, "rnalysis-enrichment-featureset-intersection"]], "rnalysis.enrichment.FeatureSet.kegg_enrichment": [[18, "rnalysis-enrichment-featureset-kegg-enrichment"]], "rnalysis.enrichment.FeatureSet.non_categorical_enrichment": [[19, "rnalysis-enrichment-featureset-non-categorical-enrichment"]], "rnalysis.enrichment.FeatureSet.save_txt": [[20, "rnalysis-enrichment-featureset-save-txt"]], "rnalysis.enrichment.FeatureSet.symmetric_difference": [[21, "rnalysis-enrichment-featureset-symmetric-difference"]], "rnalysis.enrichment.FeatureSet.union": [[22, "rnalysis-enrichment-featureset-union"]], "rnalysis.enrichment.FeatureSet.user_defined_enrichment": [[23, "rnalysis-enrichment-featureset-user-defined-enrichment"]], "rnalysis.enrichment.RankedSet": [[24, "rnalysis-enrichment-rankedset"]], "rnalysis.enrichment.RankedSet.biotypes": [[25, "rnalysis-enrichment-rankedset-biotypes"]], "rnalysis.enrichment.RankedSet.change_set_name": [[26, "rnalysis-enrichment-rankedset-change-set-name"]], "rnalysis.enrichment.RankedSet.difference": [[27, "rnalysis-enrichment-rankedset-difference"]], "rnalysis.enrichment.RankedSet.enrich_hypergeometric": [[28, "rnalysis-enrichment-rankedset-enrich-hypergeometric"]], "rnalysis.enrichment.RankedSet.enrich_randomization": [[29, "rnalysis-enrichment-rankedset-enrich-randomization"]], "rnalysis.enrichment.RankedSet.go_enrichment": [[30, "rnalysis-enrichment-rankedset-go-enrichment"]], "rnalysis.enrichment.RankedSet.intersection": [[31, "rnalysis-enrichment-rankedset-intersection"]], "rnalysis.enrichment.RankedSet.kegg_enrichment": [[32, "rnalysis-enrichment-rankedset-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.non_categorical_enrichment": [[33, "rnalysis-enrichment-rankedset-non-categorical-enrichment"]], "rnalysis.enrichment.RankedSet.save_txt": [[34, "rnalysis-enrichment-rankedset-save-txt"]], "rnalysis.enrichment.RankedSet.single_set_enrichment": [[35, "rnalysis-enrichment-rankedset-single-set-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_go_enrichment": [[36, "rnalysis-enrichment-rankedset-single-set-go-enrichment"]], "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment": [[37, "rnalysis-enrichment-rankedset-single-set-kegg-enrichment"]], "rnalysis.enrichment.RankedSet.symmetric_difference": [[38, "rnalysis-enrichment-rankedset-symmetric-difference"]], "rnalysis.enrichment.RankedSet.union": [[39, "rnalysis-enrichment-rankedset-union"]], "rnalysis.enrichment.RankedSet.user_defined_enrichment": [[40, "rnalysis-enrichment-rankedset-user-defined-enrichment"]], "rnalysis.enrichment.plot_enrichment_results": [[41, "rnalysis-enrichment-plot-enrichment-results"]], "rnalysis.enrichment.upset_plot": [[42, "rnalysis-enrichment-upset-plot"]], "rnalysis.enrichment.venn_diagram": [[43, "rnalysis-enrichment-venn-diagram"]], "rnalysis.filtering": [[44, "rnalysis-filtering"]], "rnalysis.filtering.CountFilter": [[45, "rnalysis-filtering-countfilter"]], "rnalysis.filtering.CountFilter.average_replicate_samples": [[46, "rnalysis-filtering-countfilter-average-replicate-samples"]], "rnalysis.filtering.CountFilter.biotypes_from_gtf": [[47, "rnalysis-filtering-countfilter-biotypes-from-gtf"]], "rnalysis.filtering.CountFilter.biotypes_from_ref_table": [[48, "rnalysis-filtering-countfilter-biotypes-from-ref-table"]], "rnalysis.filtering.CountFilter.box_plot": [[49, "rnalysis-filtering-countfilter-box-plot"]], "rnalysis.filtering.CountFilter.clustergram": [[50, "rnalysis-filtering-countfilter-clustergram"]], "rnalysis.filtering.CountFilter.describe": [[51, "rnalysis-filtering-countfilter-describe"]], "rnalysis.filtering.CountFilter.difference": [[52, "rnalysis-filtering-countfilter-difference"]], "rnalysis.filtering.CountFilter.differential_expression_deseq2": [[53, "rnalysis-filtering-countfilter-differential-expression-deseq2"]], "rnalysis.filtering.CountFilter.enhanced_box_plot": [[54, "rnalysis-filtering-countfilter-enhanced-box-plot"]], "rnalysis.filtering.CountFilter.filter_biotype_from_gtf": [[55, "rnalysis-filtering-countfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table": [[56, "rnalysis-filtering-countfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.CountFilter.filter_by_attribute": [[57, "rnalysis-filtering-countfilter-filter-by-attribute"]], "rnalysis.filtering.CountFilter.filter_by_go_annotations": [[58, "rnalysis-filtering-countfilter-filter-by-go-annotations"]], "rnalysis.filtering.CountFilter.filter_by_kegg_annotations": [[59, "rnalysis-filtering-countfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.CountFilter.filter_by_row_sum": [[60, "rnalysis-filtering-countfilter-filter-by-row-sum"]], "rnalysis.filtering.CountFilter.filter_low_reads": [[61, "rnalysis-filtering-countfilter-filter-low-reads"]], "rnalysis.filtering.CountFilter.filter_missing_values": [[62, "rnalysis-filtering-countfilter-filter-missing-values"]], "rnalysis.filtering.CountFilter.filter_percentile": [[63, "rnalysis-filtering-countfilter-filter-percentile"]], "rnalysis.filtering.CountFilter.filter_top_n": [[64, "rnalysis-filtering-countfilter-filter-top-n"]], "rnalysis.filtering.CountFilter.fold_change": [[65, "rnalysis-filtering-countfilter-fold-change"]], "rnalysis.filtering.CountFilter.from_dataframe": [[66, "rnalysis-filtering-countfilter-from-dataframe"]], "rnalysis.filtering.CountFilter.from_folder": [[67, "rnalysis-filtering-countfilter-from-folder"]], "rnalysis.filtering.CountFilter.head": [[68, "rnalysis-filtering-countfilter-head"]], "rnalysis.filtering.CountFilter.intersection": [[69, "rnalysis-filtering-countfilter-intersection"]], "rnalysis.filtering.CountFilter.ma_plot": [[70, "rnalysis-filtering-countfilter-ma-plot"]], "rnalysis.filtering.CountFilter.majority_vote_intersection": [[71, "rnalysis-filtering-countfilter-majority-vote-intersection"]], "rnalysis.filtering.CountFilter.normalize_median_of_ratios": [[72, "rnalysis-filtering-countfilter-normalize-median-of-ratios"]], "rnalysis.filtering.CountFilter.normalize_rle": [[73, "rnalysis-filtering-countfilter-normalize-rle"]], "rnalysis.filtering.CountFilter.normalize_tmm": [[74, "rnalysis-filtering-countfilter-normalize-tmm"]], "rnalysis.filtering.CountFilter.normalize_to_quantile": [[75, "rnalysis-filtering-countfilter-normalize-to-quantile"]], "rnalysis.filtering.CountFilter.normalize_to_rpm": [[76, "rnalysis-filtering-countfilter-normalize-to-rpm"]], "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount": [[77, "rnalysis-filtering-countfilter-normalize-to-rpm-htseqcount"]], "rnalysis.filtering.CountFilter.normalize_with_scaling_factors": [[78, "rnalysis-filtering-countfilter-normalize-with-scaling-factors"]], "rnalysis.filtering.CountFilter.number_filters": [[79, "rnalysis-filtering-countfilter-number-filters"]], "rnalysis.filtering.CountFilter.pairplot": [[80, "rnalysis-filtering-countfilter-pairplot"]], "rnalysis.filtering.CountFilter.pca": [[81, "rnalysis-filtering-countfilter-pca"]], "rnalysis.filtering.CountFilter.plot_expression": [[82, "rnalysis-filtering-countfilter-plot-expression"]], "rnalysis.filtering.CountFilter.print_features": [[83, "rnalysis-filtering-countfilter-print-features"]], "rnalysis.filtering.CountFilter.save_csv": [[84, "rnalysis-filtering-countfilter-save-csv"]], "rnalysis.filtering.CountFilter.scatter_sample_vs_sample": [[85, "rnalysis-filtering-countfilter-scatter-sample-vs-sample"]], "rnalysis.filtering.CountFilter.sort": [[86, "rnalysis-filtering-countfilter-sort"]], "rnalysis.filtering.CountFilter.split_by_attribute": [[87, "rnalysis-filtering-countfilter-split-by-attribute"]], "rnalysis.filtering.CountFilter.split_by_percentile": [[88, "rnalysis-filtering-countfilter-split-by-percentile"]], "rnalysis.filtering.CountFilter.split_by_reads": [[89, "rnalysis-filtering-countfilter-split-by-reads"]], "rnalysis.filtering.CountFilter.split_clicom": [[90, "rnalysis-filtering-countfilter-split-clicom"]], "rnalysis.filtering.CountFilter.split_hdbscan": [[91, "rnalysis-filtering-countfilter-split-hdbscan"]], "rnalysis.filtering.CountFilter.split_hierarchical": [[92, "rnalysis-filtering-countfilter-split-hierarchical"]], "rnalysis.filtering.CountFilter.split_kmeans": [[93, "rnalysis-filtering-countfilter-split-kmeans"]], "rnalysis.filtering.CountFilter.split_kmedoids": [[94, "rnalysis-filtering-countfilter-split-kmedoids"]], "rnalysis.filtering.CountFilter.symmetric_difference": [[95, "rnalysis-filtering-countfilter-symmetric-difference"]], "rnalysis.filtering.CountFilter.tail": [[96, "rnalysis-filtering-countfilter-tail"]], "rnalysis.filtering.CountFilter.text_filters": [[97, "rnalysis-filtering-countfilter-text-filters"]], "rnalysis.filtering.CountFilter.transform": [[98, "rnalysis-filtering-countfilter-transform"]], "rnalysis.filtering.CountFilter.translate_gene_ids": [[99, "rnalysis-filtering-countfilter-translate-gene-ids"]], "rnalysis.filtering.CountFilter.union": [[100, "rnalysis-filtering-countfilter-union"]], "rnalysis.filtering.CountFilter.violin_plot": [[101, "rnalysis-filtering-countfilter-violin-plot"]], "rnalysis.filtering.DESeqFilter": [[102, "rnalysis-filtering-deseqfilter"]], "rnalysis.filtering.DESeqFilter.biotypes_from_gtf": [[103, "rnalysis-filtering-deseqfilter-biotypes-from-gtf"]], "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table": [[104, "rnalysis-filtering-deseqfilter-biotypes-from-ref-table"]], "rnalysis.filtering.DESeqFilter.describe": [[105, "rnalysis-filtering-deseqfilter-describe"]], "rnalysis.filtering.DESeqFilter.difference": [[106, "rnalysis-filtering-deseqfilter-difference"]], "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change": [[107, "rnalysis-filtering-deseqfilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf": [[108, "rnalysis-filtering-deseqfilter-filter-biotype-from-gtf"]], "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table": [[109, "rnalysis-filtering-deseqfilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.DESeqFilter.filter_by_attribute": [[110, "rnalysis-filtering-deseqfilter-filter-by-attribute"]], "rnalysis.filtering.DESeqFilter.filter_by_go_annotations": [[111, "rnalysis-filtering-deseqfilter-filter-by-go-annotations"]], "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations": [[112, "rnalysis-filtering-deseqfilter-filter-by-kegg-annotations"]], "rnalysis.filtering.DESeqFilter.filter_fold_change_direction": [[113, "rnalysis-filtering-deseqfilter-filter-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.filter_missing_values": [[114, "rnalysis-filtering-deseqfilter-filter-missing-values"]], "rnalysis.filtering.DESeqFilter.filter_percentile": [[115, "rnalysis-filtering-deseqfilter-filter-percentile"]], "rnalysis.filtering.DESeqFilter.filter_significant": [[116, "rnalysis-filtering-deseqfilter-filter-significant"]], "rnalysis.filtering.DESeqFilter.filter_top_n": [[117, "rnalysis-filtering-deseqfilter-filter-top-n"]], "rnalysis.filtering.DESeqFilter.from_dataframe": [[118, "rnalysis-filtering-deseqfilter-from-dataframe"]], "rnalysis.filtering.DESeqFilter.head": [[119, "rnalysis-filtering-deseqfilter-head"]], "rnalysis.filtering.DESeqFilter.intersection": [[120, "rnalysis-filtering-deseqfilter-intersection"]], "rnalysis.filtering.DESeqFilter.majority_vote_intersection": [[121, "rnalysis-filtering-deseqfilter-majority-vote-intersection"]], "rnalysis.filtering.DESeqFilter.number_filters": [[122, "rnalysis-filtering-deseqfilter-number-filters"]], "rnalysis.filtering.DESeqFilter.print_features": [[123, "rnalysis-filtering-deseqfilter-print-features"]], "rnalysis.filtering.DESeqFilter.save_csv": [[124, "rnalysis-filtering-deseqfilter-save-csv"]], "rnalysis.filtering.DESeqFilter.sort": [[125, "rnalysis-filtering-deseqfilter-sort"]], "rnalysis.filtering.DESeqFilter.split_by_attribute": [[126, "rnalysis-filtering-deseqfilter-split-by-attribute"]], "rnalysis.filtering.DESeqFilter.split_by_percentile": [[127, "rnalysis-filtering-deseqfilter-split-by-percentile"]], "rnalysis.filtering.DESeqFilter.split_fold_change_direction": [[128, "rnalysis-filtering-deseqfilter-split-fold-change-direction"]], "rnalysis.filtering.DESeqFilter.symmetric_difference": [[129, "rnalysis-filtering-deseqfilter-symmetric-difference"]], "rnalysis.filtering.DESeqFilter.tail": [[130, "rnalysis-filtering-deseqfilter-tail"]], "rnalysis.filtering.DESeqFilter.text_filters": [[131, "rnalysis-filtering-deseqfilter-text-filters"]], "rnalysis.filtering.DESeqFilter.transform": [[132, "rnalysis-filtering-deseqfilter-transform"]], "rnalysis.filtering.DESeqFilter.translate_gene_ids": [[133, "rnalysis-filtering-deseqfilter-translate-gene-ids"]], "rnalysis.filtering.DESeqFilter.union": [[134, "rnalysis-filtering-deseqfilter-union"]], "rnalysis.filtering.DESeqFilter.volcano_plot": [[135, "rnalysis-filtering-deseqfilter-volcano-plot"]], "rnalysis.filtering.Filter": [[136, "rnalysis-filtering-filter"]], "rnalysis.filtering.Filter.biotypes_from_gtf": [[137, "rnalysis-filtering-filter-biotypes-from-gtf"]], "rnalysis.filtering.Filter.biotypes_from_ref_table": [[138, "rnalysis-filtering-filter-biotypes-from-ref-table"]], "rnalysis.filtering.Filter.describe": [[139, "rnalysis-filtering-filter-describe"]], "rnalysis.filtering.Filter.difference": [[140, "rnalysis-filtering-filter-difference"]], "rnalysis.filtering.Filter.filter_biotype_from_gtf": [[141, "rnalysis-filtering-filter-filter-biotype-from-gtf"]], "rnalysis.filtering.Filter.filter_biotype_from_ref_table": [[142, "rnalysis-filtering-filter-filter-biotype-from-ref-table"]], "rnalysis.filtering.Filter.filter_by_attribute": [[143, "rnalysis-filtering-filter-filter-by-attribute"]], "rnalysis.filtering.Filter.filter_by_go_annotations": [[144, "rnalysis-filtering-filter-filter-by-go-annotations"]], "rnalysis.filtering.Filter.filter_by_kegg_annotations": [[145, "rnalysis-filtering-filter-filter-by-kegg-annotations"]], "rnalysis.filtering.Filter.filter_missing_values": [[146, "rnalysis-filtering-filter-filter-missing-values"]], "rnalysis.filtering.Filter.filter_percentile": [[147, "rnalysis-filtering-filter-filter-percentile"]], "rnalysis.filtering.Filter.filter_top_n": [[148, "rnalysis-filtering-filter-filter-top-n"]], "rnalysis.filtering.Filter.from_dataframe": [[149, "rnalysis-filtering-filter-from-dataframe"]], "rnalysis.filtering.Filter.head": [[150, "rnalysis-filtering-filter-head"]], "rnalysis.filtering.Filter.intersection": [[151, "rnalysis-filtering-filter-intersection"]], "rnalysis.filtering.Filter.majority_vote_intersection": [[152, "rnalysis-filtering-filter-majority-vote-intersection"]], "rnalysis.filtering.Filter.number_filters": [[153, "rnalysis-filtering-filter-number-filters"]], "rnalysis.filtering.Filter.print_features": [[154, "rnalysis-filtering-filter-print-features"]], "rnalysis.filtering.Filter.save_csv": [[155, "rnalysis-filtering-filter-save-csv"]], "rnalysis.filtering.Filter.sort": [[156, "rnalysis-filtering-filter-sort"]], "rnalysis.filtering.Filter.split_by_attribute": [[157, "rnalysis-filtering-filter-split-by-attribute"]], "rnalysis.filtering.Filter.split_by_percentile": [[158, "rnalysis-filtering-filter-split-by-percentile"]], "rnalysis.filtering.Filter.symmetric_difference": [[159, "rnalysis-filtering-filter-symmetric-difference"]], "rnalysis.filtering.Filter.tail": [[160, "rnalysis-filtering-filter-tail"]], "rnalysis.filtering.Filter.text_filters": [[161, "rnalysis-filtering-filter-text-filters"]], "rnalysis.filtering.Filter.transform": [[162, "rnalysis-filtering-filter-transform"]], "rnalysis.filtering.Filter.translate_gene_ids": [[163, "rnalysis-filtering-filter-translate-gene-ids"]], "rnalysis.filtering.Filter.union": [[164, "rnalysis-filtering-filter-union"]], "rnalysis.filtering.FoldChangeFilter": [[165, "rnalysis-filtering-foldchangefilter"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf": [[166, "rnalysis-filtering-foldchangefilter-biotypes-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table": [[167, "rnalysis-filtering-foldchangefilter-biotypes-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.describe": [[168, "rnalysis-filtering-foldchangefilter-describe"]], "rnalysis.filtering.FoldChangeFilter.difference": [[169, "rnalysis-filtering-foldchangefilter-difference"]], "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change": [[170, "rnalysis-filtering-foldchangefilter-filter-abs-log2-fold-change"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf": [[171, "rnalysis-filtering-foldchangefilter-filter-biotype-from-gtf"]], "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table": [[172, "rnalysis-filtering-foldchangefilter-filter-biotype-from-ref-table"]], "rnalysis.filtering.FoldChangeFilter.filter_by_attribute": [[173, "rnalysis-filtering-foldchangefilter-filter-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations": [[174, "rnalysis-filtering-foldchangefilter-filter-by-go-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations": [[175, "rnalysis-filtering-foldchangefilter-filter-by-kegg-annotations"]], "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction": [[176, "rnalysis-filtering-foldchangefilter-filter-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.filter_missing_values": [[177, "rnalysis-filtering-foldchangefilter-filter-missing-values"]], "rnalysis.filtering.FoldChangeFilter.filter_percentile": [[178, "rnalysis-filtering-foldchangefilter-filter-percentile"]], "rnalysis.filtering.FoldChangeFilter.filter_top_n": [[179, "rnalysis-filtering-foldchangefilter-filter-top-n"]], "rnalysis.filtering.FoldChangeFilter.from_dataframe": [[180, "rnalysis-filtering-foldchangefilter-from-dataframe"]], "rnalysis.filtering.FoldChangeFilter.head": [[181, "rnalysis-filtering-foldchangefilter-head"]], "rnalysis.filtering.FoldChangeFilter.intersection": [[182, "rnalysis-filtering-foldchangefilter-intersection"]], "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection": [[183, "rnalysis-filtering-foldchangefilter-majority-vote-intersection"]], "rnalysis.filtering.FoldChangeFilter.number_filters": [[184, "rnalysis-filtering-foldchangefilter-number-filters"]], "rnalysis.filtering.FoldChangeFilter.print_features": [[185, "rnalysis-filtering-foldchangefilter-print-features"]], "rnalysis.filtering.FoldChangeFilter.randomization_test": [[186, "rnalysis-filtering-foldchangefilter-randomization-test"]], "rnalysis.filtering.FoldChangeFilter.save_csv": [[187, "rnalysis-filtering-foldchangefilter-save-csv"]], "rnalysis.filtering.FoldChangeFilter.sort": [[188, "rnalysis-filtering-foldchangefilter-sort"]], "rnalysis.filtering.FoldChangeFilter.split_by_attribute": [[189, "rnalysis-filtering-foldchangefilter-split-by-attribute"]], "rnalysis.filtering.FoldChangeFilter.split_by_percentile": [[190, "rnalysis-filtering-foldchangefilter-split-by-percentile"]], "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction": [[191, "rnalysis-filtering-foldchangefilter-split-fold-change-direction"]], "rnalysis.filtering.FoldChangeFilter.symmetric_difference": [[192, "rnalysis-filtering-foldchangefilter-symmetric-difference"]], "rnalysis.filtering.FoldChangeFilter.tail": [[193, "rnalysis-filtering-foldchangefilter-tail"]], "rnalysis.filtering.FoldChangeFilter.text_filters": [[194, "rnalysis-filtering-foldchangefilter-text-filters"]], "rnalysis.filtering.FoldChangeFilter.transform": [[195, "rnalysis-filtering-foldchangefilter-transform"]], "rnalysis.filtering.FoldChangeFilter.translate_gene_ids": [[196, "rnalysis-filtering-foldchangefilter-translate-gene-ids"]], "rnalysis.filtering.FoldChangeFilter.union": [[197, "rnalysis-filtering-foldchangefilter-union"]], "rnalysis.filtering.Pipeline": [[198, "rnalysis-filtering-pipeline"]], "rnalysis.filtering.Pipeline.add_function": [[199, "rnalysis-filtering-pipeline-add-function"]], "rnalysis.filtering.Pipeline.apply_to": [[200, "rnalysis-filtering-pipeline-apply-to"]], "rnalysis.filtering.Pipeline.export_pipeline": [[201, "rnalysis-filtering-pipeline-export-pipeline"]], "rnalysis.filtering.Pipeline.import_pipeline": [[202, "rnalysis-filtering-pipeline-import-pipeline"]], "rnalysis.filtering.Pipeline.remove_last_function": [[203, "rnalysis-filtering-pipeline-remove-last-function"]], "rnalysis.filtering.readable_name": [[204, "rnalysis-filtering-readable-name"]], "rnalysis.general": [[205, "rnalysis-general"]], "rnalysis.general.parse_gene_name_string": [[206, "rnalysis-general-parse-gene-name-string"]], "rnalysis.general.parse_sequence_name_string": [[207, "rnalysis-general-parse-sequence-name-string"]], "rnalysis.general.parse_wbgene_string": [[208, "rnalysis-general-parse-wbgene-string"]], "rnalysis.general.print_settings_file": [[209, "rnalysis-general-print-settings-file"]], "rnalysis.general.reset_settings_file": [[210, "rnalysis-general-reset-settings-file"]], "rnalysis.general.save_to_csv": [[211, "rnalysis-general-save-to-csv"]], "rnalysis.general.set_attr_ref_table_path": [[212, "rnalysis-general-set-attr-ref-table-path"]], "rnalysis.general.set_biotype_ref_table_path": [[213, "rnalysis-general-set-biotype-ref-table-path"]], "A-to-Z tutorial - example analysis": [[214, "a-to-z-tutorial-example-analysis"]], "Intro and recommendations": [[214, "intro-and-recommendations"]], "Analysis #1 - time series RNA sequencing": [[214, "analysis-1-time-series-rna-sequencing"]], "The dataset": [[214, "the-dataset"], [214, "id5"]], "Data preprocessing and exploratory data analysis": [[214, "data-preprocessing-and-exploratory-data-analysis"]], "Filter out lowly-expressed genes": [[214, "filter-out-lowly-expressed-genes"]], "Examine variance in our data with Principal Component Analysis": [[214, "examine-variance-in-our-data-with-principal-component-analysis"]], "Examine similarity between developmental stages": [[214, "examine-similarity-between-developmental-stages"]], "Compare the expression of specific genes over the developmental stages": [[214, "compare-the-expression-of-specific-genes-over-the-developmental-stages"]], "Clustering analysis": [[214, "clustering-analysis"]], "The simple approach - distance-based clustering with K-Medoids": [[214, "the-simple-approach-distance-based-clustering-with-k-medoids"]], "Fine-tuning our approach - density-based clustering with HDBSCAN": [[214, "fine-tuning-our-approach-density-based-clustering-with-hdbscan"]], "The complex approach - ensemble-based clustering with CLICOM": [[214, "the-complex-approach-ensemble-based-clustering-with-clicom"]], "Enrichment analysis": [[214, "enrichment-analysis"], [214, "id8"]], "Running enrichment analysis": [[214, "running-enrichment-analysis"], [214, "id10"]], "Analysis #2 - differential expression data": [[214, "analysis-2-differential-expression-data"]], "Quantify FASTQ files and Differential Expression Analysis": [[214, "quantify-fastq-files-and-differential-expression-analysis"]], "Quality control with FastQC": [[214, "quality-control-with-fastqc"]], "Trim adapters and remove low-quality reads with CutAdapt": [[214, "trim-adapters-and-remove-low-quality-reads-with-cutadapt"]], "Quantify gene expression with kallisto": [[214, "quantify-gene-expression-with-kallisto"]], "Run differential expression analysis with DESeq2": [[214, "run-differential-expression-analysis-with-deseq2"]], "Data filtering and visualization with customized Pipelines": [[214, "data-filtering-and-visualization-with-customized-pipelines"]], "Create a customized Pipeline": [[214, "create-a-customized-pipeline"]], "Apply the Pipeline to our datasets": [[214, "apply-the-pipeline-to-our-datasets"]], "Visualizing and extracting gene set interesctions": [[214, "visualizing-and-extracting-gene-set-interesctions"]], "Create a Venn diagram": [[214, "create-a-venn-diagram"]], "Extract the gene subsets we are interested in": [[214, "extract-the-gene-subsets-we-are-interested-in"]], "Define a background set": [[214, "define-a-background-set"]], "Define our custom enrichment attributes": [[214, "define-our-custom-enrichment-attributes"]], "Final words": [[214, "final-words"]], "User guide": [[215, "user-guide"]], "RNAlysis graphical user interface": [[215, "rnalysis-graphical-user-interface"]], "Open the program": [[215, "open-the-program"]], "Load a table": [[215, "load-a-table"]], "Examine your table": [[215, "examine-your-table"]], "Filter your table": [[215, "filter-your-table"]], "Undo the operations you applied to your table": [[215, "undo-the-operations-you-applied-to-your-table"]], "Apply your operations \u2018in-place\u2019 or apply on a new table": [[215, "apply-your-operations-in-place-or-apply-on-a-new-table"]], "Save the changes you made to your table": [[215, "save-the-changes-you-made-to-your-table"]], "Work on multiple tables at the same time": [[215, "work-on-multiple-tables-at-the-same-time"]], "Different types of tables offer different ways to filter and analyze your data": [[215, "different-types-of-tables-offer-different-ways-to-filter-and-analyze-your-data"]], "Create and save graphs": [[215, "create-and-save-graphs"]], "Sort your tabs and change their icons": [[215, "sort-your-tabs-and-change-their-icons"]], "Restore tabs you closed": [[215, "restore-tabs-you-closed"]], "Import lists of genes as Gene Sets": [[215, "import-lists-of-genes-as-gene-sets"]], "Visualize the intersections between your tables and gene sets": [[215, "visualize-the-intersections-between-your-tables-and-gene-sets"]], "Apply set operations to your tables and gene sets": [[215, "apply-set-operations-to-your-tables-and-gene-sets"]], "Perform enrichment analysis on your tables and gene sets": [[215, "perform-enrichment-analysis-on-your-tables-and-gene-sets"]], "Create Pipelines to streamline your data analysis": [[215, "create-pipelines-to-streamline-your-data-analysis"]], "Apply Pipelines to one or more of your tables": [[215, "apply-pipelines-to-one-or-more-of-your-tables"]], "Export and share Pipelines to make your analysis more reproducible": [[215, "export-and-share-pipelines-to-make-your-analysis-more-reproducible"]], "RNAlysis filtering module": [[215, "rnalysis-filtering-module"]], "Working with Filter objects": [[215, "working-with-filter-objects"]], "Initialize a Filter object": [[215, "initialize-a-filter-object"]], "View a Filter object": [[215, "view-a-filter-object"]], "Filtering operations": [[215, "filtering-operations"]], "Performing set operations on multiple Filter objects": [[215, "performing-set-operations-on-multiple-filter-objects"]], "Saving Filter results": [[215, "saving-filter-results"]], "Using an Attribute Reference Table for filter operations": [[215, "using-an-attribute-reference-table-for-filter-operations"]], "Using a Biotype Reference Table for filter operations": [[215, "using-a-biotype-reference-table-for-filter-operations"]], "Filtering DESeq2 output files with filtering.DESeqFilter": [[215, "filtering-deseq2-output-files-with-filtering-deseqfilter"]], "Loading from a csv file": [[215, "loading-from-a-csv-file"]], "Filtering operations unique to DESeqFilter": [[215, "filtering-operations-unique-to-deseqfilter"]], "Data visualization and exploratory data analysis with DESeqFilter": [[215, "data-visualization-and-exploratory-data-analysis-with-deseqfilter"]], "Filtering count matrices with filtering.CountFilter": [[215, "filtering-count-matrices-with-filtering-countfilter"]], "Generating an CountFilter object from a folder of HTSeq-count output .txt files": [[215, "generating-an-countfilter-object-from-a-folder-of-htseq-count-output-txt-files"]], "Loading from a pre-made csv file": [[215, "loading-from-a-pre-made-csv-file"]], "Filtering operations unique to CountFilter": [[215, "filtering-operations-unique-to-countfilter"]], "Normalizing reads with CountFilter": [[215, "normalizing-reads-with-countfilter"]], "Data clustering with CountFilter": [[215, "data-clustering-with-countfilter"]], "K-Means clustering": [[215, "k-means-clustering"]], "K-Medoids clustering": [[215, "k-medoids-clustering"]], "Hierarchical clustering": [[215, "hierarchical-clustering"]], "HDBSCAN clustering": [[215, "hdbscan-clustering"]], "CLICOM clustering": [[215, "clicom-clustering"]], "Data visualization and exploratory data analysis with CountFilter": [[215, "data-visualization-and-exploratory-data-analysis-with-countfilter"]], "Filtering fold-change data of features using filtering.FoldChangeFilter": [[215, "filtering-fold-change-data-of-features-using-filtering-foldchangefilter"]], "Loading fold change data from a csv file": [[215, "loading-fold-change-data-from-a-csv-file"]], "Generating fold change data from an existing CountFilter object": [[215, "generating-fold-change-data-from-an-existing-countfilter-object"]], "Performing randomization tests on a FoldChangeFilter object": [[215, "performing-randomization-tests-on-a-foldchangefilter-object"]], "Sequentially applying filtering operations using Pipelines": [[215, "sequentially-applying-filtering-operations-using-pipelines"]], "RNAlysis enrichment module": [[215, "rnalysis-enrichment-module"]], "Working with FeatureSet objects": [[215, "working-with-featureset-objects"]], "Initialize an FeatureSet object": [[215, "initialize-an-featureset-object"]], "GO Enrichment": [[215, "go-enrichment"]], "Define the correct organism and gene ID type for your dataset": [[215, "define-the-correct-organism-and-gene-id-type-for-your-dataset"], [215, "id15"]], "Define the background set": [[215, "define-the-background-set"], [215, "id16"], [215, "id24"], [215, "id32"]], "Choose the statistical test (optional)": [[215, "choose-the-statistical-test-optional"], [215, "id17"], [215, "id25"], [215, "id33"]], "Filter GO Terms by GO aspects (optional)": [[215, "filter-go-terms-by-go-aspects-optional"]], "Filter GO Annotations by Evidence Codes (optional)": [[215, "filter-go-annotations-by-evidence-codes-optional"]], "Filter GO Annotations by database (optional)": [[215, "filter-go-annotations-by-database-optional"]], "Filter GO Annotations by Qualifiers (optional)": [[215, "filter-go-annotations-by-qualifiers-optional"]], "Choose annotation propagation method (optional)": [[215, "choose-annotation-propagation-method-optional"]], "Choose plotting parameters (optional)": [[215, "choose-plotting-parameters-optional"], [215, "id18"], [215, "id26"], [215, "id34"]], "Enrichment analysis output": [[215, "enrichment-analysis-output"], [215, "id23"], [215, "id31"]], "KEGG Pathways enrichment": [[215, "kegg-pathways-enrichment"]], "Enrichment analysis for user-defined attributes": [[215, "enrichment-analysis-for-user-defined-attributes"]], "Choose which user-defined attributes to calculate enrichment for": [[215, "choose-which-user-defined-attributes-to-calculate-enrichment-for"]], "Performing enrichment analysis for non-categorical user-defined attributes": [[215, "performing-enrichment-analysis-for-non-categorical-user-defined-attributes"]], "Choose which user-defined non-categorical attributes to calculate enrichment for": [[215, "choose-which-user-defined-non-categorical-attributes-to-calculate-enrichment-for"]], "Non-Categorical Enrichment analysis output": [[215, "non-categorical-enrichment-analysis-output"]], "Performing set operations and visualisation on multiple FeatureSet objects": [[215, "performing-set-operations-and-visualisation-on-multiple-featureset-objects"]], "Saving indices from FeatureSet to a .txt file": [[215, "saving-indices-from-featureset-to-a-txt-file"]], "Working with RankedSet objects": [[215, "working-with-rankedset-objects"]], "Initialize an RankedSet object": [[215, "initialize-an-rankedset-object"]], "Performing single-set GO Enrichment analysis without a background set": [[215, "performing-single-set-go-enrichment-analysis-without-a-background-set"]], "Performing single-set KEGG Enrichment analysis without a background set": [[215, "performing-single-set-kegg-enrichment-analysis-without-a-background-set"]], "Performing single-set enrichment analysis for user-defined attributes without a background set": [[215, "performing-single-set-enrichment-analysis-for-user-defined-attributes-without-a-background-set"]], "Visualizing sets, intersections, and enrichment": [[215, "visualizing-sets-intersections-and-enrichment"]], "Plotting results of enrichment analysis": [[215, "plotting-results-of-enrichment-analysis"]], "Plotting Venn Diagrams and UpSet Plots": [[215, "plotting-venn-diagrams-and-upset-plots"]], "RNAlysis general module": [[215, "rnalysis-general-module"]], "Set and load a Reference Table": [[215, "set-and-load-a-reference-table"]], "What is an Attribute Reference Table?": [[215, "what-is-an-attribute-reference-table"]], "What is a Biotype Reference Table?": [[215, "what-is-a-biotype-reference-table"]], "Set a Reference Table as default": [[215, "set-a-reference-table-as-default"]], "Load the default Attribute Reference Table path": [[215, "load-the-default-attribute-reference-table-path"]], "Parse C. elegans gene names, WBGene indices and sequence names using regular expressions": [[215, "parse-c-elegans-gene-names-wbgene-indices-and-sequence-names-using-regular-expressions"]]}, "indexentries": {"attribute reference table": [[3, "term-Attribute-Reference-Table"]], "biotype reference table": [[3, "term-Biotype-Reference-Table"]], "countfilter": [[3, "term-CountFilter"]], "deseqfilter": [[3, "term-DESeqFilter"]], "featureset": [[3, "term-FeatureSet"]], "filter": [[3, "term-Filter"]], "filter object": [[3, "term-Filter-object"]], "filter objects": [[3, "term-Filter-objects"]], "foldchangefilter": [[3, "term-FoldChangeFilter"]], "pipeline": [[3, "term-Pipeline"]], "rankedset": [[3, "term-RankedSet"]], "module": [[9, "module-rnalysis.enrichment"], [44, "module-rnalysis.filtering"], [205, "module-rnalysis.general"]], "rnalysis.enrichment": [[9, "module-rnalysis.enrichment"]], "featureset (class in rnalysis.enrichment)": [[10, "rnalysis.enrichment.FeatureSet"]], "__init__() (rnalysis.enrichment.featureset method)": [[10, "rnalysis.enrichment.FeatureSet.__init__"]], "biotypes() (rnalysis.enrichment.featureset method)": [[11, "rnalysis.enrichment.FeatureSet.biotypes"]], "change_set_name() (rnalysis.enrichment.featureset method)": [[12, "rnalysis.enrichment.FeatureSet.change_set_name"]], "difference() (rnalysis.enrichment.featureset method)": [[13, "rnalysis.enrichment.FeatureSet.difference"]], "enrich_hypergeometric() (rnalysis.enrichment.featureset method)": [[14, "rnalysis.enrichment.FeatureSet.enrich_hypergeometric"]], "enrich_randomization() (rnalysis.enrichment.featureset method)": [[15, "rnalysis.enrichment.FeatureSet.enrich_randomization"]], "go_enrichment() (rnalysis.enrichment.featureset method)": [[16, "rnalysis.enrichment.FeatureSet.go_enrichment"]], "intersection() (rnalysis.enrichment.featureset method)": [[17, "rnalysis.enrichment.FeatureSet.intersection"]], "kegg_enrichment() (rnalysis.enrichment.featureset method)": [[18, "rnalysis.enrichment.FeatureSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.featureset method)": [[19, "rnalysis.enrichment.FeatureSet.non_categorical_enrichment"]], "save_txt() (rnalysis.enrichment.featureset method)": [[20, "rnalysis.enrichment.FeatureSet.save_txt"]], "symmetric_difference() (rnalysis.enrichment.featureset method)": [[21, "rnalysis.enrichment.FeatureSet.symmetric_difference"]], "union() (rnalysis.enrichment.featureset method)": [[22, "rnalysis.enrichment.FeatureSet.union"]], "user_defined_enrichment() (rnalysis.enrichment.featureset method)": [[23, "rnalysis.enrichment.FeatureSet.user_defined_enrichment"]], "rankedset (class in rnalysis.enrichment)": [[24, "rnalysis.enrichment.RankedSet"]], "__init__() (rnalysis.enrichment.rankedset method)": [[24, "rnalysis.enrichment.RankedSet.__init__"]], "biotypes() (rnalysis.enrichment.rankedset method)": [[25, "rnalysis.enrichment.RankedSet.biotypes"]], "change_set_name() (rnalysis.enrichment.rankedset method)": [[26, "rnalysis.enrichment.RankedSet.change_set_name"]], "difference() (rnalysis.enrichment.rankedset method)": [[27, "rnalysis.enrichment.RankedSet.difference"]], "enrich_hypergeometric() (rnalysis.enrichment.rankedset method)": [[28, "rnalysis.enrichment.RankedSet.enrich_hypergeometric"]], "enrich_randomization() (rnalysis.enrichment.rankedset method)": [[29, "rnalysis.enrichment.RankedSet.enrich_randomization"]], "go_enrichment() (rnalysis.enrichment.rankedset method)": [[30, "rnalysis.enrichment.RankedSet.go_enrichment"]], "intersection() (rnalysis.enrichment.rankedset method)": [[31, "rnalysis.enrichment.RankedSet.intersection"]], "kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[32, "rnalysis.enrichment.RankedSet.kegg_enrichment"]], "non_categorical_enrichment() (rnalysis.enrichment.rankedset method)": [[33, "rnalysis.enrichment.RankedSet.non_categorical_enrichment"]], "save_txt() (rnalysis.enrichment.rankedset method)": [[34, "rnalysis.enrichment.RankedSet.save_txt"]], "single_set_enrichment() (rnalysis.enrichment.rankedset method)": [[35, "rnalysis.enrichment.RankedSet.single_set_enrichment"]], "single_set_go_enrichment() (rnalysis.enrichment.rankedset method)": [[36, "rnalysis.enrichment.RankedSet.single_set_go_enrichment"]], "single_set_kegg_enrichment() (rnalysis.enrichment.rankedset method)": [[37, "rnalysis.enrichment.RankedSet.single_set_kegg_enrichment"]], "symmetric_difference() (rnalysis.enrichment.rankedset method)": [[38, "rnalysis.enrichment.RankedSet.symmetric_difference"]], "union() (rnalysis.enrichment.rankedset method)": [[39, "rnalysis.enrichment.RankedSet.union"]], "user_defined_enrichment() (rnalysis.enrichment.rankedset method)": [[40, "rnalysis.enrichment.RankedSet.user_defined_enrichment"]], "plot_enrichment_results() (in module rnalysis.enrichment)": [[41, "rnalysis.enrichment.plot_enrichment_results"]], "upset_plot() (in module rnalysis.enrichment)": [[42, "rnalysis.enrichment.upset_plot"]], "venn_diagram() (in module rnalysis.enrichment)": [[43, "rnalysis.enrichment.venn_diagram"]], "rnalysis.filtering": [[44, "module-rnalysis.filtering"]], "countfilter (class in rnalysis.filtering)": [[45, "rnalysis.filtering.CountFilter"]], "__init__() (rnalysis.filtering.countfilter method)": [[45, "rnalysis.filtering.CountFilter.__init__"]], "average_replicate_samples() (rnalysis.filtering.countfilter method)": [[46, "rnalysis.filtering.CountFilter.average_replicate_samples"]], "biotypes_from_gtf() (rnalysis.filtering.countfilter method)": [[47, "rnalysis.filtering.CountFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.countfilter method)": [[48, "rnalysis.filtering.CountFilter.biotypes_from_ref_table"]], "box_plot() (rnalysis.filtering.countfilter method)": [[49, "rnalysis.filtering.CountFilter.box_plot"]], "clustergram() (rnalysis.filtering.countfilter method)": [[50, "rnalysis.filtering.CountFilter.clustergram"]], "describe() (rnalysis.filtering.countfilter method)": [[51, "rnalysis.filtering.CountFilter.describe"]], "difference() (rnalysis.filtering.countfilter method)": [[52, "rnalysis.filtering.CountFilter.difference"]], "differential_expression_deseq2() (rnalysis.filtering.countfilter method)": [[53, "rnalysis.filtering.CountFilter.differential_expression_deseq2"]], "enhanced_box_plot() (rnalysis.filtering.countfilter method)": [[54, "rnalysis.filtering.CountFilter.enhanced_box_plot"]], "filter_biotype_from_gtf() (rnalysis.filtering.countfilter method)": [[55, "rnalysis.filtering.CountFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.countfilter method)": [[56, "rnalysis.filtering.CountFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.countfilter method)": [[57, "rnalysis.filtering.CountFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.countfilter method)": [[58, "rnalysis.filtering.CountFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.countfilter method)": [[59, "rnalysis.filtering.CountFilter.filter_by_kegg_annotations"]], "filter_by_row_sum() (rnalysis.filtering.countfilter method)": [[60, "rnalysis.filtering.CountFilter.filter_by_row_sum"]], "filter_low_reads() (rnalysis.filtering.countfilter method)": [[61, "rnalysis.filtering.CountFilter.filter_low_reads"]], "filter_missing_values() (rnalysis.filtering.countfilter method)": [[62, "rnalysis.filtering.CountFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.countfilter method)": [[63, "rnalysis.filtering.CountFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.countfilter method)": [[64, "rnalysis.filtering.CountFilter.filter_top_n"]], "fold_change() (rnalysis.filtering.countfilter method)": [[65, "rnalysis.filtering.CountFilter.fold_change"]], "from_dataframe() (rnalysis.filtering.countfilter class method)": [[66, "rnalysis.filtering.CountFilter.from_dataframe"]], "from_folder() (rnalysis.filtering.countfilter class method)": [[67, "rnalysis.filtering.CountFilter.from_folder"]], "head() (rnalysis.filtering.countfilter method)": [[68, "rnalysis.filtering.CountFilter.head"]], "intersection() (rnalysis.filtering.countfilter method)": [[69, "rnalysis.filtering.CountFilter.intersection"]], "ma_plot() (rnalysis.filtering.countfilter method)": [[70, "rnalysis.filtering.CountFilter.ma_plot"]], "majority_vote_intersection() (rnalysis.filtering.countfilter method)": [[71, "rnalysis.filtering.CountFilter.majority_vote_intersection"]], "normalize_median_of_ratios() (rnalysis.filtering.countfilter method)": [[72, "rnalysis.filtering.CountFilter.normalize_median_of_ratios"]], "normalize_rle() (rnalysis.filtering.countfilter method)": [[73, "rnalysis.filtering.CountFilter.normalize_rle"]], "normalize_tmm() (rnalysis.filtering.countfilter method)": [[74, "rnalysis.filtering.CountFilter.normalize_tmm"]], "normalize_to_quantile() (rnalysis.filtering.countfilter method)": [[75, "rnalysis.filtering.CountFilter.normalize_to_quantile"]], "normalize_to_rpm() (rnalysis.filtering.countfilter method)": [[76, "rnalysis.filtering.CountFilter.normalize_to_rpm"]], "normalize_to_rpm_htseqcount() (rnalysis.filtering.countfilter method)": [[77, "rnalysis.filtering.CountFilter.normalize_to_rpm_htseqcount"]], "normalize_with_scaling_factors() (rnalysis.filtering.countfilter method)": [[78, "rnalysis.filtering.CountFilter.normalize_with_scaling_factors"]], "number_filters() (rnalysis.filtering.countfilter method)": [[79, "rnalysis.filtering.CountFilter.number_filters"]], "pairplot() (rnalysis.filtering.countfilter method)": [[80, "rnalysis.filtering.CountFilter.pairplot"]], "pca() (rnalysis.filtering.countfilter method)": [[81, "rnalysis.filtering.CountFilter.pca"]], "plot_expression() (rnalysis.filtering.countfilter method)": [[82, "rnalysis.filtering.CountFilter.plot_expression"]], "print_features() (rnalysis.filtering.countfilter method)": [[83, "rnalysis.filtering.CountFilter.print_features"]], "save_csv() (rnalysis.filtering.countfilter method)": [[84, "rnalysis.filtering.CountFilter.save_csv"]], "scatter_sample_vs_sample() (rnalysis.filtering.countfilter method)": [[85, "rnalysis.filtering.CountFilter.scatter_sample_vs_sample"]], "sort() (rnalysis.filtering.countfilter method)": [[86, "rnalysis.filtering.CountFilter.sort"]], "split_by_attribute() (rnalysis.filtering.countfilter method)": [[87, "rnalysis.filtering.CountFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.countfilter method)": [[88, "rnalysis.filtering.CountFilter.split_by_percentile"]], "split_by_reads() (rnalysis.filtering.countfilter method)": [[89, "rnalysis.filtering.CountFilter.split_by_reads"]], "split_clicom() (rnalysis.filtering.countfilter method)": [[90, "rnalysis.filtering.CountFilter.split_clicom"]], "split_hdbscan() (rnalysis.filtering.countfilter method)": [[91, "rnalysis.filtering.CountFilter.split_hdbscan"]], "split_hierarchical() (rnalysis.filtering.countfilter method)": [[92, "rnalysis.filtering.CountFilter.split_hierarchical"]], "split_kmeans() (rnalysis.filtering.countfilter method)": [[93, "rnalysis.filtering.CountFilter.split_kmeans"]], "split_kmedoids() (rnalysis.filtering.countfilter method)": [[94, "rnalysis.filtering.CountFilter.split_kmedoids"]], "symmetric_difference() (rnalysis.filtering.countfilter method)": [[95, "rnalysis.filtering.CountFilter.symmetric_difference"]], "tail() (rnalysis.filtering.countfilter method)": [[96, "rnalysis.filtering.CountFilter.tail"]], "text_filters() (rnalysis.filtering.countfilter method)": [[97, "rnalysis.filtering.CountFilter.text_filters"]], "transform() (rnalysis.filtering.countfilter method)": [[98, "rnalysis.filtering.CountFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.countfilter method)": [[99, "rnalysis.filtering.CountFilter.translate_gene_ids"]], "union() (rnalysis.filtering.countfilter method)": [[100, "rnalysis.filtering.CountFilter.union"]], "violin_plot() (rnalysis.filtering.countfilter method)": [[101, "rnalysis.filtering.CountFilter.violin_plot"]], "deseqfilter (class in rnalysis.filtering)": [[102, "rnalysis.filtering.DESeqFilter"]], "__init__() (rnalysis.filtering.deseqfilter method)": [[102, "rnalysis.filtering.DESeqFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.deseqfilter method)": [[103, "rnalysis.filtering.DESeqFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[104, "rnalysis.filtering.DESeqFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.deseqfilter method)": [[105, "rnalysis.filtering.DESeqFilter.describe"]], "difference() (rnalysis.filtering.deseqfilter method)": [[106, "rnalysis.filtering.DESeqFilter.difference"]], "filter_abs_log2_fold_change() (rnalysis.filtering.deseqfilter method)": [[107, "rnalysis.filtering.DESeqFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.deseqfilter method)": [[108, "rnalysis.filtering.DESeqFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.deseqfilter method)": [[109, "rnalysis.filtering.DESeqFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.deseqfilter method)": [[110, "rnalysis.filtering.DESeqFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.deseqfilter method)": [[111, "rnalysis.filtering.DESeqFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.deseqfilter method)": [[112, "rnalysis.filtering.DESeqFilter.filter_by_kegg_annotations"]], "filter_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[113, "rnalysis.filtering.DESeqFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.deseqfilter method)": [[114, "rnalysis.filtering.DESeqFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.deseqfilter method)": [[115, "rnalysis.filtering.DESeqFilter.filter_percentile"]], "filter_significant() (rnalysis.filtering.deseqfilter method)": [[116, "rnalysis.filtering.DESeqFilter.filter_significant"]], "filter_top_n() (rnalysis.filtering.deseqfilter method)": [[117, "rnalysis.filtering.DESeqFilter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.deseqfilter class method)": [[118, "rnalysis.filtering.DESeqFilter.from_dataframe"]], "head() (rnalysis.filtering.deseqfilter method)": [[119, "rnalysis.filtering.DESeqFilter.head"]], "intersection() (rnalysis.filtering.deseqfilter method)": [[120, "rnalysis.filtering.DESeqFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.deseqfilter method)": [[121, "rnalysis.filtering.DESeqFilter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.deseqfilter method)": [[122, "rnalysis.filtering.DESeqFilter.number_filters"]], "print_features() (rnalysis.filtering.deseqfilter method)": [[123, "rnalysis.filtering.DESeqFilter.print_features"]], "save_csv() (rnalysis.filtering.deseqfilter method)": [[124, "rnalysis.filtering.DESeqFilter.save_csv"]], "sort() (rnalysis.filtering.deseqfilter method)": [[125, "rnalysis.filtering.DESeqFilter.sort"]], "split_by_attribute() (rnalysis.filtering.deseqfilter method)": [[126, "rnalysis.filtering.DESeqFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.deseqfilter method)": [[127, "rnalysis.filtering.DESeqFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.deseqfilter method)": [[128, "rnalysis.filtering.DESeqFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.deseqfilter method)": [[129, "rnalysis.filtering.DESeqFilter.symmetric_difference"]], "tail() (rnalysis.filtering.deseqfilter method)": [[130, "rnalysis.filtering.DESeqFilter.tail"]], "text_filters() (rnalysis.filtering.deseqfilter method)": [[131, "rnalysis.filtering.DESeqFilter.text_filters"]], "transform() (rnalysis.filtering.deseqfilter method)": [[132, "rnalysis.filtering.DESeqFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.deseqfilter method)": [[133, "rnalysis.filtering.DESeqFilter.translate_gene_ids"]], "union() (rnalysis.filtering.deseqfilter method)": [[134, "rnalysis.filtering.DESeqFilter.union"]], "volcano_plot() (rnalysis.filtering.deseqfilter method)": [[135, "rnalysis.filtering.DESeqFilter.volcano_plot"]], "filter (class in rnalysis.filtering)": [[136, "rnalysis.filtering.Filter"]], "__init__() (rnalysis.filtering.filter method)": [[136, "rnalysis.filtering.Filter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.filter method)": [[137, "rnalysis.filtering.Filter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.filter method)": [[138, "rnalysis.filtering.Filter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.filter method)": [[139, "rnalysis.filtering.Filter.describe"]], "difference() (rnalysis.filtering.filter method)": [[140, "rnalysis.filtering.Filter.difference"]], "filter_biotype_from_gtf() (rnalysis.filtering.filter method)": [[141, "rnalysis.filtering.Filter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.filter method)": [[142, "rnalysis.filtering.Filter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.filter method)": [[143, "rnalysis.filtering.Filter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.filter method)": [[144, "rnalysis.filtering.Filter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.filter method)": [[145, "rnalysis.filtering.Filter.filter_by_kegg_annotations"]], "filter_missing_values() (rnalysis.filtering.filter method)": [[146, "rnalysis.filtering.Filter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.filter method)": [[147, "rnalysis.filtering.Filter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.filter method)": [[148, "rnalysis.filtering.Filter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.filter class method)": [[149, "rnalysis.filtering.Filter.from_dataframe"]], "head() (rnalysis.filtering.filter method)": [[150, "rnalysis.filtering.Filter.head"]], "intersection() (rnalysis.filtering.filter method)": [[151, "rnalysis.filtering.Filter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.filter method)": [[152, "rnalysis.filtering.Filter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.filter method)": [[153, "rnalysis.filtering.Filter.number_filters"]], "print_features() (rnalysis.filtering.filter method)": [[154, "rnalysis.filtering.Filter.print_features"]], "save_csv() (rnalysis.filtering.filter method)": [[155, "rnalysis.filtering.Filter.save_csv"]], "sort() (rnalysis.filtering.filter method)": [[156, "rnalysis.filtering.Filter.sort"]], "split_by_attribute() (rnalysis.filtering.filter method)": [[157, "rnalysis.filtering.Filter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.filter method)": [[158, "rnalysis.filtering.Filter.split_by_percentile"]], "symmetric_difference() (rnalysis.filtering.filter method)": [[159, "rnalysis.filtering.Filter.symmetric_difference"]], "tail() (rnalysis.filtering.filter method)": [[160, "rnalysis.filtering.Filter.tail"]], "text_filters() (rnalysis.filtering.filter method)": [[161, "rnalysis.filtering.Filter.text_filters"]], "transform() (rnalysis.filtering.filter method)": [[162, "rnalysis.filtering.Filter.transform"]], "translate_gene_ids() (rnalysis.filtering.filter method)": [[163, "rnalysis.filtering.Filter.translate_gene_ids"]], "union() (rnalysis.filtering.filter method)": [[164, "rnalysis.filtering.Filter.union"]], "foldchangefilter (class in rnalysis.filtering)": [[165, "rnalysis.filtering.FoldChangeFilter"]], "__init__() (rnalysis.filtering.foldchangefilter method)": [[165, "rnalysis.filtering.FoldChangeFilter.__init__"]], "biotypes_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[166, "rnalysis.filtering.FoldChangeFilter.biotypes_from_gtf"]], "biotypes_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[167, "rnalysis.filtering.FoldChangeFilter.biotypes_from_ref_table"]], "describe() (rnalysis.filtering.foldchangefilter method)": [[168, "rnalysis.filtering.FoldChangeFilter.describe"]], "difference() (rnalysis.filtering.foldchangefilter method)": [[169, "rnalysis.filtering.FoldChangeFilter.difference"]], "filter_abs_log2_fold_change() (rnalysis.filtering.foldchangefilter method)": [[170, "rnalysis.filtering.FoldChangeFilter.filter_abs_log2_fold_change"]], "filter_biotype_from_gtf() (rnalysis.filtering.foldchangefilter method)": [[171, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_gtf"]], "filter_biotype_from_ref_table() (rnalysis.filtering.foldchangefilter method)": [[172, "rnalysis.filtering.FoldChangeFilter.filter_biotype_from_ref_table"]], "filter_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[173, "rnalysis.filtering.FoldChangeFilter.filter_by_attribute"]], "filter_by_go_annotations() (rnalysis.filtering.foldchangefilter method)": [[174, "rnalysis.filtering.FoldChangeFilter.filter_by_go_annotations"]], "filter_by_kegg_annotations() (rnalysis.filtering.foldchangefilter method)": [[175, "rnalysis.filtering.FoldChangeFilter.filter_by_kegg_annotations"]], "filter_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[176, "rnalysis.filtering.FoldChangeFilter.filter_fold_change_direction"]], "filter_missing_values() (rnalysis.filtering.foldchangefilter method)": [[177, "rnalysis.filtering.FoldChangeFilter.filter_missing_values"]], "filter_percentile() (rnalysis.filtering.foldchangefilter method)": [[178, "rnalysis.filtering.FoldChangeFilter.filter_percentile"]], "filter_top_n() (rnalysis.filtering.foldchangefilter method)": [[179, "rnalysis.filtering.FoldChangeFilter.filter_top_n"]], "from_dataframe() (rnalysis.filtering.foldchangefilter class method)": [[180, "rnalysis.filtering.FoldChangeFilter.from_dataframe"]], "head() (rnalysis.filtering.foldchangefilter method)": [[181, "rnalysis.filtering.FoldChangeFilter.head"]], "intersection() (rnalysis.filtering.foldchangefilter method)": [[182, "rnalysis.filtering.FoldChangeFilter.intersection"]], "majority_vote_intersection() (rnalysis.filtering.foldchangefilter method)": [[183, "rnalysis.filtering.FoldChangeFilter.majority_vote_intersection"]], "number_filters() (rnalysis.filtering.foldchangefilter method)": [[184, "rnalysis.filtering.FoldChangeFilter.number_filters"]], "print_features() (rnalysis.filtering.foldchangefilter method)": [[185, "rnalysis.filtering.FoldChangeFilter.print_features"]], "randomization_test() (rnalysis.filtering.foldchangefilter method)": [[186, "rnalysis.filtering.FoldChangeFilter.randomization_test"]], "save_csv() (rnalysis.filtering.foldchangefilter method)": [[187, "rnalysis.filtering.FoldChangeFilter.save_csv"]], "sort() (rnalysis.filtering.foldchangefilter method)": [[188, "rnalysis.filtering.FoldChangeFilter.sort"]], "split_by_attribute() (rnalysis.filtering.foldchangefilter method)": [[189, "rnalysis.filtering.FoldChangeFilter.split_by_attribute"]], "split_by_percentile() (rnalysis.filtering.foldchangefilter method)": [[190, "rnalysis.filtering.FoldChangeFilter.split_by_percentile"]], "split_fold_change_direction() (rnalysis.filtering.foldchangefilter method)": [[191, "rnalysis.filtering.FoldChangeFilter.split_fold_change_direction"]], "symmetric_difference() (rnalysis.filtering.foldchangefilter method)": [[192, "rnalysis.filtering.FoldChangeFilter.symmetric_difference"]], "tail() (rnalysis.filtering.foldchangefilter method)": [[193, "rnalysis.filtering.FoldChangeFilter.tail"]], "text_filters() (rnalysis.filtering.foldchangefilter method)": [[194, "rnalysis.filtering.FoldChangeFilter.text_filters"]], "transform() (rnalysis.filtering.foldchangefilter method)": [[195, "rnalysis.filtering.FoldChangeFilter.transform"]], "translate_gene_ids() (rnalysis.filtering.foldchangefilter method)": [[196, "rnalysis.filtering.FoldChangeFilter.translate_gene_ids"]], "union() (rnalysis.filtering.foldchangefilter method)": [[197, "rnalysis.filtering.FoldChangeFilter.union"]], "pipeline (class in rnalysis.filtering)": [[198, "rnalysis.filtering.Pipeline"]], "__init__() (rnalysis.filtering.pipeline method)": [[198, "rnalysis.filtering.Pipeline.__init__"]], "add_function() (rnalysis.filtering.pipeline method)": [[199, "rnalysis.filtering.Pipeline.add_function"]], "apply_to() (rnalysis.filtering.pipeline method)": [[200, "rnalysis.filtering.Pipeline.apply_to"]], "export_pipeline() (rnalysis.filtering.pipeline method)": [[201, "rnalysis.filtering.Pipeline.export_pipeline"]], "import_pipeline() (rnalysis.filtering.pipeline class method)": [[202, "rnalysis.filtering.Pipeline.import_pipeline"]], "remove_last_function() (rnalysis.filtering.pipeline method)": [[203, "rnalysis.filtering.Pipeline.remove_last_function"]], "readable_name() (in module rnalysis.filtering)": [[204, "rnalysis.filtering.readable_name"]], "rnalysis.general": [[205, "module-rnalysis.general"]], "parse_gene_name_string() (in module rnalysis.general)": [[206, "rnalysis.general.parse_gene_name_string"]], "parse_sequence_name_string() (in module rnalysis.general)": [[207, "rnalysis.general.parse_sequence_name_string"]], "parse_wbgene_string() (in module rnalysis.general)": [[208, "rnalysis.general.parse_wbgene_string"]], "print_settings_file() (in module rnalysis.general)": [[209, "rnalysis.general.print_settings_file"]], "reset_settings_file() (in module rnalysis.general)": [[210, "rnalysis.general.reset_settings_file"]], "save_to_csv() (in module rnalysis.general)": [[211, "rnalysis.general.save_to_csv"]], "set_attr_ref_table_path() (in module rnalysis.general)": [[212, "rnalysis.general.set_attr_ref_table_path"]], "set_biotype_ref_table_path() (in module rnalysis.general)": [[213, "rnalysis.general.set_biotype_ref_table_path"]]}})
\ No newline at end of file
diff --git a/docs/build/tutorial.html b/docs/build/tutorial.html
index 9f07652b8..bf4b9bade 100644
--- a/docs/build/tutorial.html
+++ b/docs/build/tutorial.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>A-to-Z tutorial - example analysis &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>A-to-Z tutorial - example analysis &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
diff --git a/docs/build/user_guide.html b/docs/build/user_guide.html
index 3de1c034a..7c53d0e0a 100644
--- a/docs/build/user_guide.html
+++ b/docs/build/user_guide.html
@@ -4,7 +4,7 @@
   <meta charset="utf-8" /><meta name="generator" content="Docutils 0.17.1: http://docutils.sourceforge.net/" />
 
   <meta name="viewport" content="width=device-width, initial-scale=1.0" />
-  <title>User guide &mdash; RNAlysis 3.2.1 documentation</title>
+  <title>User guide &mdash; RNAlysis 3.2.2 documentation</title>
       <link rel="stylesheet" href="_static/pygments.css" type="text/css" />
       <link rel="stylesheet" href="_static/css/theme.css" type="text/css" />
     <link rel="shortcut icon" href="_static/favicon.ico"/>
